Background
Glioma, a common primary brain tumor, is one of the most highly vascularized tumors in humans [
1,
2], characterizing by sustained neovascularization [
3,
4] containing initial vascular choice and subsequent angiogenesis [
5]. According to the classification by World Health Organization, gliomas are histologically categorized into grades I to IV. Glioblastoma (GBM, grade IV), the most serious form of malignant gliomas, is highly invasive and fatal [
6]. Although advances is achieved in present treatments, the prognosis for GBM remains poor and a median survival time is only 12 to 15 months [
7‐
9]. Moreover, rapid tumor development and resistance to both chemotherapy and radiotherapy are common in GBM [
5], leading to a low 1-year survival rate [
10,
11]. Hence, it remains to explore the molecular mechanisms on glioma progression and to seek new effective therapeutic strategies of glioma.
Abnormal vascularization is thought as another characteristic of GBM and gliomas originate from the angiogenic tumors. The neurovascular unit is revealed to promote the development of tumor [
12]. Glioma vasculature is characterized by angiogenesis and endotheliosis, which are histological labels of high-grade gliomas [
12]. Angiogenesis is the process that new blood vessels were generated from previous ones and promote endothelial cells to proliferate, migrate, and form new tubular structures [
13]. These regions are reported to provide specific microenvironments for the brain tumor stem-like cells to stay [
14]. Currently, GBM cells have been demonstrated to excrete both exosomes and microvesicles in their acroteric microenvironment [
15‐
17], validating several mechanisms including angiogenesis stimulation, on tumor development [
18]. Moreover, exosomes contain multiple angiogenic molecules such as angiogenin and vascular endothelial growth factor (VEGF) [
18].
Kininogen-1 (KNG1) can exert antiangiogenic effect and exhibit inhibitory property on the proliferation of endothelial cells [
19]. The high molecular weight kininogen [
20], the full length kininogen-1 polypeptide, is reported to release the bradykinin by proteolytic cleavage. Bradykinin can stimulate the B2 receptor [
21,
22] and epidermal growth factor receptor (EGFR) signaling pathways to enhance the gliomas invasion [
23,
24], and then to promote angiogenesis through the increased VEGF expression. Bradykinin antagonists are reported to suppress the viability of glioma tumor cells [
25,
26], and KNG1 can suppress angiogenesis [
27] and metastasis [
20]. Recently, KNG1 has identified as a serum biomarker for advanced colorectal adenoma and colorectal cancer [
28] as well as a potential prognostizc biomarker for oral cancer [
29]. Nevertheless, the effect of KNG1 on the glioma is rarely known and our purpose is to explore whether KNG1 can play a role in glioma.
Methods
Clinical samples
A total of 83 serum specimens were obtained from normal (
n = 14) and glioma patients (
n = 69) in The Second Affiliated Hospital of Zhejiang University School of Medicine from January, 2016 to December, 2017 were used for quantitative polymerase chain reaction (qPCR) analysis. Glioma was diagnosed according to the 2007 WHO Classification of Tumors of the Central Nervous System. Written informed consent was provided to each patients for surgical procedures. This study was approved by the Specialty Committee on Ethics of The Second Affiliated Hospital of Zhejiang University School of Medicine. Furthermore, detailed clinicopathologic characteristics of the patients were listed in Table
1.
Table 1
Correlation between gene expression and clinical characteristics
Age | | | 0.076 |
< 60 | 93 | 76 | |
≥ 60 | 92 | 109 | |
Gender | | | 0.15 |
female | 67 | 54 | |
male | 118 | 131 | |
Grade | | | 0.614 |
G1 + G2 | 118 | 114 | |
G3 + G4 | 64 | 69 | |
Pathologic Stage | | | 0.586 |
I + II | 128 | 128 | |
III + IV | 48 | 42 | |
Pathologic-T | | | 0.696 |
T1 + T2 | 135 | 139 | |
T3 + T4 | 48 | 45 | |
Pathologic-N | | | 0.122 |
N0 | 125 | 127 | |
N1 | 4 | 0 | |
Pathologic-M | | | 1.000 |
M0 | 133 | 133 | |
M1 | 2 | 2 | |
Identification of differentially expressed genes (DEGs)
The mRNA expression data for GBM were downloaded from The Cancer Genome Atlas (TCGA) database (
https://cancergenome.nih.gov/), including 169 tumor samples (survival time information was available) and 5 normal samples, which were collected from some of the 169 patients with GBM. As an R package, edgeR was used to identify DEGs between glioma and normal patients with the instruction manual. DEGs were ensured according to the following rule: log
2 fold change (FC) ≥ 2; the
P value and false discovery rate (FDR) < 0.05. A heatmap and volcano plot of the DEGs were drawn in the R platform. The top 100 overlapping DEGs based on the |log
2FC| values were subjected for further analysis.
Protein-protein interactions network
The direct (physical) and indirect (functional) associations of DEGs were evaluated based on STRING database (
http://string.embl.de/), providing an important assessment and integration of PPI [
30]. Interactive relationships among DEGs were statistically obvious with an interaction score .0.4. Furthermore, we also analyzed the gene ontology [
15] terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment for the top 8 core genes, respectively.
Functional annotation and pathway enrichment analysis of DEGs
To identify the DEGs’ functional annotation, we analyzed GO terms and KEGG pathway enrichment with Database for Annotation, Visualization, and Integrated Discovery (DAVID) v.6.8 (
https://david.ncifcrf.gov/tools.jsp) [
31]. And a
P < 0.05 for statistical significance.
Cell culture
The glioma cell lines including SWO-38, U87-MG, SHG-44 and T98G were obtained from the Cell Library of the Chinese Academy of Sciences (Shanghai, China). The glioma cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS, Gibco), 100 U/ml penicillin-streptomycin (Gibco) and 2 mM L-glutamine (Gibco) at 37 °C with 5% CO2 in an incubator. The media was replaced every 3–4 days and the cultures were split using 0.25% trypsin (Gibco).
Cell transfection
Cells (4 × 105) were cultured in 6-well plates. After culture for 24 h, the medium was replaced by Opti-MEM (Invitrogen) and cultured. The pcDNA3.1-KNG1 and control vector were designed and cloned by Takara Biotechnology (Dalian) Co., LTD. In total, plasmids were transfected according to the Lipofectamine 2000 protocol (Invitrogen, Grand Island, NY, USA). After incubation for another 48 h, the treated cells were used for the further study.
Measurement of cell viability
Normal and transfected cells at a concentration of 2 × 105 were seeded in 96-well plates and cell viability was detected by a cell counting kit-8 (Beyotime, Beijing, China). The medium was renewed and CCK-8 was added at time points (12, 24 and 48 h) for another 4 h. The absorbance was detected at 450 nm with an iMark microplate reader (Bio-Rad, Hercules, CA, USA).
Angiogenesis assays
The glioma cells were divided into 3 groups: normal, untreated cell; NC, cells were transfected with negative control vector; KNG1 group, cells transfected with KNG1 overexpression vector. After incubation as pre-described, the medium in each group was collected. Matrigel (BD Biosciences, SanJose, CA, USA) was placed in a 4 °C refrigerator for 12 h for liquefaction, and then was added to each well of a 96-well plate and solidified in an incubator for 30 min. The endothelial cells at a density of 4 × 104/well were seeded into the plates with matrigel and were respectively maintained in the medium which were collected from the each group. After 20 h culturing, the result was observed under an inverted microscope. The tube formation was according to the formula: 1000 × Total Area of Connected Tubes/Total Image Area.
Apoptosis and cell cycle analysis
Apoptosis and cell cycle assays were measured by the Annexin V-fluorescein isothiocyanate apoptosis kit and cell cycle analysis kit (BD Biosciences, SanJose, CA, USA) according to the protocols. The results were analyzed with a FACSCalibur flow cytometer (BD Biosciences).
Total RNA of renal tissues was isolated using Trizol reagent (Invitrogen, San Diego, CA, USA). Briefly, renal tissues were homogenized in 700 μL Trizol reagent followed by 300 μL chloroform. Then the samples were mixed for 5 min. After centrifugation (12,000 g for 15 min at 4 °C), the supernatant was carefully drew into a new tube. Equal volume of isopropyl alcohol was added and incubated at room temperature for 20 min. Following the centrifugation (12,000 g at 4 °C for 10 min), the supernatants were removed completely and the precipitate was washed twice by 75% ethanol. Finally, nuclease-free DEPC water was added to elute the RNA. The concentration and purity were detected by Shimadzu UV-2550 UV-visible spectrophotometer (Suzhou, China). The cDNA was obtained by 1 μg RNA according to the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). In brief, the RNA was incubated with 2X RT master mix containing 10 × RT Buffer, 25 × dNTP Mix, 10 × RT Random Primers and MultiScribe™ Reverse Transcriptase at 25 °C for 10 min followed by 37 °C for 2 h and 85 °C for 5 min. Then the PCR products were separated on a 1% agarose gel with ethidium bromide staining. Densitometry was analyzed with the 200TM-Image software (Bio-Rad, USA) and GAPDH served as an internal reference gene. The specific primers were list in Table
2.
Table 2
Sequences of primers used for quantitative real-time PCR assays
KNG1 | CCTTTGGAATGGTGATACCG | CGCAAATCTTGGTAGGTGGT |
CCR9 | CACTGTCCTGACCGTCTTTGTCT | CTTCAAGCTTCCCTCTCTCCTTG |
OPRM1 | ACTGATCGACTTGTCCCACTTAGATGGC | ACTGACTGACTGACCATGGGTCGGACAGGT |
MTNR1A | GGTGTATCGGAACAAGAAGCTC | ACTGACTTGGCAGTGCAGATA |
NPBWR1 | CCGGGATCCACCATGGACAACGCCTCGTTCTCG | CTAGTCTAGATCAGGCTGCCGCGCGGCAAGT |
RXFP3 | GGCAAGGCCATGTGTAAGATC | CGTTGAACTTGATGAGGATGCTCCAG |
KRT1 | GTAAAACGACGGCCAG | CAGGAAACAGCTATGAC |
SSTR4 | CCAGATGAAGACGGCTACCACC | CACGTAGAAAGGCATCCAGCAGAG |
VEGF | TCACAGGTACAGGGATGAGGACAC | CAAAGCACAGCAATGTCCTGAAG |
CyclinD1 | ACCTGAGGAGCCCCAACAA | TCTGCTCCTGGCAGGCC |
ki67 | CCATATGCCTGTGGAGTGGAA | CCACCCTTAGCGTGCTCTTGA |
Caspase-3 | CTTCAGTGGTGGACATGACG | TCAACAATTTGAGGCTGCTG |
Caspase-9 | AGCCAGATGCTGTCCCATAC | CAGGAACCGCTCTTCTTGTC |
XIAP | GAAGACCCTTGGGAACAACA | CGCCTTAGCTGCTCTTCAGT |
GAPDH | CGGAGTCAACGGATTTGGTCGTAT | AGCCTTCTCCATGGTGGTGAAGAC |
Quantitative real-time PCR (qPCR)
The expressions were conducted in the ABI 7500 real-time quantitative PCR system (Life Technologies, Grand Island, NY) with the following conditions: 95 °C for 5 min, 40 cycles of 95 °C for 15 s, 56 °C for 30 s. The specific primers were list in Table
2. GAPDH served as an internal reference gene and the data analysis were conducted with the 2
-ΔΔCt method.
Western blot
Renal tissues were washed by PBS and lysed in lysis buffer (Beyotime, Shanghai, China). Then the lysates were incubated on ice for 30 min and oscillated for 30 s. After centrifugation at 10,000 g for 30 min at 4 °C, the supernatant was collected to measure the protein concentrations by BCA kit (Solarbio, Beijing, China). The proteins separated by the SDS-PAGE were transferred onto polyvinylidene difluoride membranes (GE Healthcare, Little Chalfont, UK). Then the membranes were incubated overnight at 4 °C 1 h after blocking with primary antibodies as follows: KNG1 (1:500, Abnova, Jhongli, Taiwan), caspase-3 (1:500, Abcam), caspase-9 (1:500, Abcam), CyclinD1 (1:1000, Abcam), ki67 (1:1000, Abcam), X-linked inhibitor of apoptosis (XIAP) (1:1000, Cell Signaling Technology, Beverly, MA), VEGF (1:1000, Cell Signaling Technology), PI3K (1:1000, Cell Signaling Technology), P-PI3K (1:1000, Cell Signaling Technology), Akt (1:1000, Cell Signaling Technology), p-Akt (1:1000, Cell Signaling Technology) and GAPDH (1:10000, Cell Signaling Technology). Then the membranes were probed with the anti-rabbit IgG (1:50000, Cell Signaling Technology). The bands were determined by a Molecular Imager VersaDoc MP 5000 System (Bio-Rad, Hercules, CA). The densitometry was determined with a Quantity One (Bio-Rad).
Nude mouse xenograft studies
The study was approved by the Institutional Animal Care and Use Committee of The Second Affiliated Hospital of Zhejiang University School of Medicine. The male nude mice (average weight 30 g; 5-week-old) were obtained from Experimental Animal Laboratories, Shanghai, China). The mice were cultivated in a specific pathogen-free room at 25 °C under a 12-h light/dark cycle with free access to food and water. Then mice werer injected subcutaneously with transfected U87-MG and SHG-44 cells at a density of 1 × 106 and the size and volume (mm3, = length × width × height × 0.5236) of tumor were calculated. All mice were sacrificed after implantation, the tumor tissues were blocked in paraffin for further analysis.
Immunohistochemistry (IHC)
Immunohistochemistry was performed with anti-KNG1 (1:200, Abnova), anti-VEGF (1:200, Cell Signaling Technology) and anti-XIAP (1:200, Cell Signaling Technology) antibodies. In brief, tissue sections were dewaxed and washed with ethanol (Sigma-Aldrich), followed by incubation with 10% normal goat serum (Vector Laboratories, Burlingame, CA, USA). Then the sections were incubated with the primary antibodies overnight at 4 °C and hybridized with secondary antibody (Vector Laboratories) for 1 h at room temperature. After incubation with Vectastain Elite avidin-biotin complex reagent (Vector Laboratories) for 0.5 h, the diaminobenzidine (DAB kit; Vector Laboratories) was added and stained with hematoxylin (Sigma-Aldrich).
Terminal deoxynucleotidyl transfer-mediated dUTP nick end labeling (TUNEL) assay
The sections were incubated at 60 °C for 20 min and were deparaffinized in xylene twice. Then sections were washed in graded series of alcohol and rinsed with PBS. Apoptotic cells were detected according to the protocol of TUNEL kit (Roche, Mannheim, Germany). Apoptotic (TUNEL-positive) cells were quantified under × 400 magnification.
Measurement of microvessel density (MVD) by immunohistochemistry
The sections of mice were prepared for immunostaining using anti CD31 (cat. GB11063, Servicebio) according to the manufacturer’s instructions. Any brown staining endothelial cell cluster, clearly separate from adjacent microvessels and tumor cells was considered a countable microvessel. The membranous and cytoplasmic granular staining with VEGF was evaluated for all the tumor cells.
Statistical analysis
Individual chi-square test was used to analyze the relationship between KNG1 expression and clinical features. Kaplan-Meier analysis with log-rank test was used to compare patients’ survival between subgroups. The differences between two groups were analyzed by the student’s t-test or by one-way ANOVA for multiple groups. All statistical analyses were performed with SPSS 18.0 software (SPSS, Inc., Chicago, IL), and P < 0.05 was considered to be statistically significant.
Discussion
Kininogen is a forerunner of kinins from the kallikrein-kinin system, which are relevant to cardiovascular and renal function, blood pressure regulation and the physiological and pathological processes [
32,
33]. Recently, KNG1 has been demonstrated to exert an effect on carcinogenesis [
28] and its low expression in plasma of the cancer patients is revealed to promote the viability of the cancer cells [
34]. In this study, we obtained 2930 DEGs based on TCGA and finally identified KNG1 as the core gene associated with survival of glioma patients.
KNG1 plays a crucial role in carcinogenesis [
20].Low levels of KNG1 in blood samples from cancer patients may be propitious to the viability of the cancer cells [
28]. The role of KNG1 in the glioma remains unclear. In our study, 404 of 1591 down-regulated DEGs were identified by TGCA and finally the KNG1 was identified as the core gene of glioma patients. The patients with a high KNG1 expression had evidently higher survival time than those with a low KNG1 level. Meanwhile, the serum KNG1 expression was low in the glioma patients compared to the normal persons. In the current study, the KNG1 expression level was also significantly reduced in the glioma cells, especially in U87-MG and SHG-44 cells.
It is revealed that the survival, proliferation, invasion and metastasis of solid tumor cells are associated with sustained angiogenesis [
35]. KNG1 can cause apoptosis of endothelial cells and suppress angiogenesis by releasing bradykinin [
36]. In addition, malignant proliferation is one of the most significant characteristics of cancer cells. We found that KNG1 overexpression markedly inhibited the viabilities of U87-MG and SHG-44 cells in a time-dependent manner. Angiogenesis is demonstrated as a critical factor in the progression of gliomas [
37].Our data showed that the length and numbers of regenerative blood vessels of two cells were also suppressed. VEGF has been demonstrated as a potent maker of vascular permeability and gliomas growth [
38]. Moreover, VEGF is demonstrated to be related to angiogenesis in various cancers [
39]. Our results displayed that overexpression of KNG1 dramatically inhibited the VEGF expression. The results suggested that KNG1 overexpression can exert anti-angiogenesis effect in glioma cells.
Infinite proliferation and anti-apoptosis are two important malignant phenotypes of glioma. Several cancers including gliomas can develop resistance to apoptosis, so the major anti-cancer therapies are growth inhibition and induction of cell death [
40]. We found that up-regulation of the KNG1 evidently increased the apoptosis of glioma cells. Besides, overexpressing KNG1 could induce G1 phase cell cycle of glioma cells. The cyclinD1 has been reported to accelerate the G1/S-phase transition [
41]. The levels of ki67, a biological tumor marker, can indicate changes in cancer proliferation [
42]. Activation of caspase-3 is illustrated as an important biochemical marker of apoptosis [
43,
44], and caspase-9 is upstream initiator caspases [
45]. XIAP has been found to bind and directly inhibit caspase-3 and caspase-9 [
46]. In our study, the expressions of cyclinD1, ki67 and XIAP were obviously reduced by the overexpression of KNG1; while the expressions of caspase-3 and caspase-9 were increased, suggesting the up-regulation of KNG1 could exert pro-apoptotic property in glioma cells. Moreover, overexpressing KNG1 evidently inhibited the growth of tumors in nude mice. And the up-regulation of KNG1 significantly suppressed the expression of XIAP and increased the apoptosis in vivo, suggesting overexpression of KNG1 could promote the apoptosis of glioma cells.
The KEGG analysis showed that the PI3K/Akt pathway was involved in the regulation of KNG1 on the glioma cells. Indeed, the PI3K/Akt pathway has essential roles in gliomas [
47]. The p-Akt expression has been reported to be enhanced in gliomas [
48,
49]. Additionally, elevated p-Akt is illustrated to be involved in a worse prognosis of glioma tumors [
50]. Moreover, Akt can inhibit apoptosis to promote tumor proliferation [
51]. In our study, overexpressing KNG1 inhibited the activation of p-PI3K and suppressed, the phosphorylation of Akt. It was indicated that the inhibition of PI3K/Akt pathway may help protect against the glioma progression.
In brain tissues of xenograft mice, the cell apoptosis were also increased by the overexpression of KNG1. Besides, the XIAP level was also increased by the overexpression of KNG1. Moreover, the VEGF expression were decreased by the overexpression of KNG1, contributing to the reduction of tumor angiogenesis. Furthermore, the apoptosis of brain tissues from mice injected with glioma cells were induced. These results revealed that overexpression of KNG1 exerted anti-tumor effect on glioma.