PCAF-mediated acetylation of Lin28B increases let-7 biogenesis in lung adenocarcinoma H1299 cells

HEK293T, HCT116, MCF7, HeLa, HepG2, and H1299 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS, HyClone) at 37 °C in 5% CO₂ atmosphere. The HEK293T cells, MCF7, and H1299 cells were stored in our Lab. The HeLa (Cat. #3111C0001CCC000011) and HepG2 (Cat. #3111C0001CCC000035) cell lines were purchased from Chinese National Infrastructure of Cell Line Resource (Beijing, China). HCT116 cell line was a gift from Dr. Depei Liu (Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, Cat.# 3111C0001CCC000158). Before the experiments, the two cell lines were authenticated on cell micrograph compared to the cell lines on ATCC. HEK293T cells showed 90% transfect efficiency with GFP-tag plasmid. H1299 cells showed the lack of p53 protein expression by western blot assay. Mycoplasma contamination was detected by the EZ-PCR Mycoplasma Test Kit (Cat. #20–700-20), a PCR-based mycoplasma test kit, in cell cultures before the experiment. The kit includes a unique reaction mix that contains all the ingredients required for PCR: nucleotides, primers, Taq Polymerase and magnesium. After performing agarose gel electrophoresis, positive samples will yield a 270 bp fragment, but HEK293T and H1299 cell lines not.

We established two stably transfected clones of H1299 cells, in which Lin28B was knocked down by co-transduction of the cells with lentivirus encoding each of the shRNA specific for Lin28B, designated shLin28B-1, shLin28B-2, and shLuc was as a negative control. The shLin28B-1, shLin28B-2, or shLuc were cloned into the pLKO.1 vector. The shRNA sequences were as follows: shLin28B-1: GCAGGCATAATAAGCAAGTTA; shLin28B-2: GCCTTGAGTCAATACGGGTAA; shLuc: CGCTGAGTACTTCGAAATGTC.

Antibodies against β-actin (sc-47778), GAPDH (sc-166545), Myc (sc-789), Lamin B (sc-6216) and PCAF (sc-13,124) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies to FLAG (F3165) and M2 (F2426) were purchased from Sigma (St. Louis, MO). Antibodies to Lin28B (4196) and acetyl lysine (9441) were purchased from Cell Signaling Technology (Beverly, MA).

The FLAG-tagged and GFP-tagged Lin28B eukaryotic expression plasmids and GST-tagged Lin28B prokaryotic expression plasmids were constructed by cloning Lin28B into the pcDNA6-FLAG, pEGFP-C1-GFP and pGEX-4 T-1 vectors, respectively, using a PCR product from a cDNA library derived from HEK293T cells. pCX-FLAG-PCAF, pGEX-PCAF-HAT and pCX-FLAG-PCAF-∆HAT were as previously described [16]. Truncated fragments of Lin28B were cloned using the PCR product of full-length GFP-tagged Lin28B. FLAG-Lin28B-∆CSD was constructed by deleting the CSD. Myc-tagged PCAF was cloned from FLAG-tagged PCAF into the pCMV-3tag7-Myc vector. The eukaryotic expression plasmid of PCAF containing the Cys574Ser mutation was generated by site-directed mutagenesis of Myc-PCAF. The cells were transfected with Vigofect reagent (Vigorous Biotech, Beijing, China) according to the manufacturer’s instructions. Assays were performed 3 times each in triplicate, and all results are shown as the mean ± SD.

Cells were cultured on glass cover slips and fixed in 4% paraformaldehyde at room temperature for 10 min, washed three times with PBS for 15 min, permeabilized with 0.25% Triton X-100 in PBS for 15 min at room temperature, washed three times as described above and blocked with 1% BSA blocking solution at 37 °C for 1 h. The cells were incubated with primary anti-Lin28B antibody and anti-PCAF antibody at 1:50 dilution, anti-Myc antibody at 1:100 dilution and anti-FLAG antibody at 1:500 dilution at 4 °C overnight and washed three times with PBS. After washing, the cells were incubated with FITC- or TRITC-conjugated secondary antibodies at a dilution of 1:200 at 37 °C for 1 h and then washed three times with PBS. The coverslips were stained with DAPI, mounted and examined with a laser scanning confocal microscope.

Transiently transfected HEK293T cells were homogenized in lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM EDTA, 2 mM EGTA, 1% Triton X-100, 50 mM NaF, 5 mM Sodiun Pyrophosphate, 50 mM Sodium β-glycerophosphate, 1 mM NaVO₃, 1 mM DTT, 1 mM PMSF, 10 μg/ml leupeptin and 10 μg/ml aprotinin). Cell lysates were rotated at 4 °C for 30 min and centrifuged at 12,000 rpm for 15 min to remove insoluble material and incubated with anti-GFP beads or anti-FLAG M2 beads at 4 °C overnight. The collected beads were then washed three times and boiled in SDS gel-loading buffer for western blot analysis.

RT-qPCR assays were carried out as described previously [26, 27]. Specific primers for Lin28B (forward: AGCCCCTTGGATATTCCAGTC and reverse: AATGTGAATTCCACTGGTTCTCCT). The relative expression of let-7a-1 and let-7g was normalized to that of U6 snRNA using the comparative CT method according to the manufacturer’s instructions (Bio-Rad CFX Connect Real-Time System). The primer sequences used for let-7 are listed below (F: forward; R: reverse; RT: reverse transcription). Mature let-7a-1 (RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT, F: GCCGCTGAGGTAGTAGGTTGTA and R: GTGCAGGGTCCGAGGT), mature let-7g (RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTGACA, F: GCCGCTGAGGTAGTAGTTTGT and R: GTGCAGGGTCCGAGGT), mature mir-16-1 (RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAA.

F: GCCGCTAGCAGCACGTAAATAT and R: GTGCAGGGTCCGAGGT) and U6 (RT: AAAATATGGAACGCTTCACGAATTTG, F: CTCGCTTCGGCAGCACA and R AACGCTTCACGAATTTGCGT) were used. The experiments were repeated at least three times with statistical analysis for individual experimental groups. All values were expressed as the mean ± SD.

In vitro acetyltransferase assays were performed as previously described and detected by using western blotting with anti-acetyl lysine antibody [26]. Briefly, recombinant GST-Lin28B and GST-PCAF-HAT2 proteins were expressed in E. coli BL21 and purified using glutathione beads (Amersham Biosciences). For in vitro acetyltransferase assays, 1 μg of GST-PCAF-HAT2 and 5 μg of GST or GST-Lin28B were incubated in 25 μl of acetyltransferase assay buffer (50 mM Tris, pH 8, 10% glycerol, 10 mM butyric acid, 0.1 mM EDTA, 1 mM DTT, and 1 mM PMSF) with 20 μM acetyl CoA at 30 °C for 1 h. The reaction products were separated via 15% SDS-PAGE and analyzed by western blotting with anti-acetyl lysine antibody.

The cell fractions were prepared as previously described [28], and the prepared cell fractions were separated with 10% SDS-PAGE and detected by western blotting.

Consistent with the literature [8], Lin28B is mainly found to be distributed in the nucleus (Fig. 1a), where it abrogates the expression of let-7 miRNA. To explore the functions of Lin28B in cancer cells, we first established two stably transfected clones of H1299 cells, in which Lin28B was knocked down by co-transduction of the cells with lentivirus encoding each of the shRNA specific for Lin28B, designated sh-Lin28B-1 and sh-Lin28–2. We found that the expression of the Lin28B protein (Fig. 1b) and its mRNA (Fig. 1c) was lower in the Lin28B-knockdown cells (Lin28B-K/D) than in cells mock transduced with shRNA against luciferase (sh-Luc). We then determined the expression of let-7 in H1299 cells and their Lin28B-K/D counterparts and found that knockdown of Lin28B enhanced the biogenesis of let-7 family members detected (let-7a-1, b, c, d, e, f, and g). The results of two representatives of let-7 miRNAs were shown in Fig. 1d, the let-7a-1 was increased and let-7g was drastically induced in Lin28B-K/D cells relative to their basal levels in the wild-type H1299 cells but mir-16-1 was not induced at all.

In mammalian cells, PCAF acetylates numerous proteins with multiple roles in the normal growth and function of cells, and it is also associated with the occurrence of cancer [21‐23]. Previously we reported that PCAF directly interacted with and acetylated Lin28A, the paralog of Lin28B [26]. To identify whether PCAF isassociated with Lin28Bwe assessed the interaction between PCAF and Lin28B by co-IP assay. Anti-GFP antibody was applied to co-immunoprecipitate GFP-tagged Lin28B with ectopic FLAG-PCAF in HEK293T cells (Fig. 2a). In addition, in vitro GST-pulldown assays indicated that FLAG-PCAF was pulled-down by GST-Lin28B in the HEK293T cell lysates (Fig. 2b). These results demonstrated an interaction between Lin28B and PCAF. To further identify the binding domain of Lin28B that interacts with PCAF, the coding region of the Lin28B gene was truncated; the representative protein fragments are shown in Fig. 2c. The co-IP assay revealed that the CSD of Lin28 (Fig. 2d, L1 & L4) was essential in mediating the interaction between Lin28B and PCAF. Similar results from in vitro GST-pulldown assays also indicated that the CSD of Lin28B mediated its binding with PCAF (Fig. 2e). Additionally, endogenous Lin28B- and PCAF-expressing H1299 cells were cultured on glass cover slips and treated with antibodies for immunofluorescence staining. Our results showed that Lin28B and PCAF co-localized in the nucleus of H1299 cells (Fig. 2f).

To explore whether Lin28B is acetylated by PCAF, an in vitro acetyltransferase assay was performed, as previously reported [26]. Using anti-acetyl lysine (AcK) antibody, we found that GST-Lin28B was acetylated only in the presence of the purified GST-fused HAT2-domain of PCAF (GST-PCAF-HAT), whereas PCAF was auto-acetylated (Fig. 3a). The expression constructs for FLAG-Lin28B were co-transfected into HEK293T cells with either Myc-PCAF or HAT-domain-deleted Myc-PCAF (Myc-PCAF-∆HAT). Ectopically expressed Lin28B was acetylated by Myc-tagged PCAF in the cells, whereas no acetylation of Lin28B was observed with the HAT-domain-deleted PCAF (Fig. 3b). To explore the functional role of PCAF compared with its HAT-domain-deleted counterpart in non-modified H1299 cells, RT-qPCR analysis was performed, and elevated expression levels of the let-7a-1 and let-7g miRNAs were found in the presence of PCAF but not the HAT-domain-deleted PCAF, whereas mir-16-1 was not induced by PCAF transfection (Fig. 3c). These results suggested that the acetylation of Lin28B by PCAF is a critical event that abrogates the inhibitory effect of native Lin28B on the biogenesis of let-7a-1 and let-7g miRNAs in H1299 cells.

We have previously reported that the protein stability of Lin28A, the paralog of Lin28B, decreases when it is acetylated by PCAF [26]; however, no apparent change was observed in the protein level of Lin28B in the cells transfected with PCAF (data not shown). Co-IP assays showed that PCAF-ΔHAT still interacted with Lin28B in cells (Fig. 3d).

To reveal the mechanism underlying the PCAF-mediated acetylation of Lin28B and its effect on the biogenesis of let-7, we first determined the expression of Lin28B in different cell types and detected it in three cell lines, H1299, HepG2, and HEK293T, but it was not detectable in other cell lines including HCT116, MCF7, and HeLa cells (Fig. 3e). However, unlike HEK293T cells, Lin28B was mainly distributed in the nucleus of H1299 cells (last group of cells in Fig. 3e). Furthermore, as compared with localization of Lin28A mostly in the cytoplasm but not in the nucleus [8, 26], Lin28B was mainly located in nucleus in these cells, and acetylation of Lin28B by ectopic PCAF enabled its translocation from the nucleus to the cytoplasm of H1299 cells, as shown by the results of immunofluorescence assays (Fig. 3f) and western blot assays on nuclear/cytoplasmic extracts (Fig. 3g). The distribution of endogenous Lin28B detected by anti-Lin28B is similar with that of ectopic Lin28B staining with anti-FLAG in H1299 cells (Fig. 2f vs Fig. 3f), which is confirmed with results of western blot for the fractions of nuclear/cytoplasmic (Fig. 1a vs the first two lines of Fig. 3g). To analyze the effects of PCAF activity on Lin28B, we used a Cys574 mutant of PCAF (M-PCAF) and Lin28B-ΔCSD and detected the cytoplasmic distribution of Lin28B in H1299 cells. The results showed that M-PCAF did not increase the cytoplasmic distribution of Lin28B and that the CSD-deleted Lin28B was mainly distributed in the cytoplasm and was not affected by M-PCAF (Fig. 3h). These findings indicated that the acetylation of Lin28B was induced by PCAF, which removed the inhibition on let-7 biogenesis in H1299 cells, as schematically shown in Fig. 3i.