Introduction
Glioblastoma multiforme (GBM) is an aggressive type of brain cancer that resists treatment. Recently, it has been established that in many types of cancer the bulk of cells that make up a tumor are derived from a small population of CSC, also known as tumor initiating cells. CSC are distinguished from the bulk of the population of tumor cells by their ability to successfully seed new tumors when implanted in low numbers into experimental animals. Such cells are proposed to persist in recurrent GBM and to have enhanced resistance to chemotherapy and radiation-induced apoptosis[
1].
The Notch pathway plays an important role in cellular processes during embryonic and postnatal development, including stem cells renewal, cell fate determination and apoptosis. A role for Notch signaling in the maintenance of cancer stem cells has been described in preclinical models and recently in clinical studies[
2‐
4]. Increasing evidence demonstrates a deregulated expression of Notch receptors and Notch ligands in GBM, and their knockout inhibit gliomas proliferation and survival. Therefore this pathway could be considered as a therapeutic target for cancer therapy[
5,
6]. Notch receptor is synthesized as an inactive 300 kDa precursor protein, which is proteolytically cleaved by a furin-like convertase before it inserts as a non-covalently bound heterodimer in the plasma membrane There are four Notch receptors (Notch1, 2, 3 and 4) and five ligands of the DSL (Delta and Serrate Ligands) family, which includes Delta-like ligands (DLL) 1, 2, 3, and Serrate/Jagged (JAG) 1 and 2. Members of both the Notch receptor and DSL ligand families are, for the most part, type I single-pass integral membrane proteins. Signaling is initiated by binding of a Notch ligand expressed on one cell to a Notch receptor on an adjacent cell. Upon ligand binding to the receptor, Notch is sequentially cleaved by ADAM10/TACE (a disintegrin and metalloproteinase) and by a presenilin-dependent γ-secretase protease complex which consists of presenilin 1 (PSEN1) or PSEN2, Nicastrin, PEN2 and APH1[
7]. This process results in the release in the cytoplasm of a soluble fragment consisting of the entire intracellular domain, termed Notch intracellular domain (NICD). After translocation to the nucleus, NICD binds to transcription factor CSL, and converts a large co-repressor in an active transcriptional complex that activates the transcription of Notch target genes. These include genes encoding Hairy Enhancer of Split (HES1), HES-related proteins (HEY), p21
waf1, Cyclin D1 and 3, c-myc, and HER2[
8‐
11].
A number of genetic alterations are responsible for the malignancy of GBM, often mutations leading to the hyperactivation of receptor tyrosine kinases (RTK). A combination of proteomic and genomic analyses of 243 GBM from The Cancer Genome Atlas (TCGA), subdivides these tumors into three subclasses based on the pattern of expression and genetic alterations: classical/EGFR+, proneural/PDGFR + and mesenchymal/NF1+ classes[
12]. Le Mercier et al.[
13], report that the addition of temozolomide to conventional radiotherapy significantly improved the survival of patients belonging to the classical subtype, but it did not affect the survival of patients belonging to the proneural subtype, suggesting the importance to clinically subdividing patients in order to devise the best targeted therapy. EGFR is overexpressed in almost 40-50% of GBM and contributes to uncontrolled proliferation and survival of glioma cells[
14]. A well-documented alteration in GBM is the amplification and activating mutation of EGFR variant III (EGFRvIII). EGFRvIII has an overall prevalence of almost 60% in patients whose tumors show amplification of wild type (wt) EGFR[
15,
16]. Enhanced activation of RTK leads to the activation of intracellular signaling pathways such as the Raf/MEK/Erk and the PI3K/Akt pathways, which are ultimately responsible for the malignant phenotype of glioma cells[
17].
Another subset of gliomas, the PDGFR subclass account for 25-30% of GBM, and is characterized by dysregulation of PDGFR activity, which in some cases is due to amplification and rearrangements of the PDGFRα gene locus, and in others to overexpression of the PDGF ligands[
12,
18,
19]. PDGFR is a transmembrane receptor with 5 immunoglobulin-like repeats in its extracellular domain and a tyrosine kinase in its intracellular domain. There are four PDGF ligands (PDGF-A, PDGF-B, PDGF-C and PDGF-D) that dimerize and bind to PDGF receptors, PDGFRα and PDGFRβ[
20]. PDGF-A, PDGF-B, and PDGF-C bind to PDGFRα; PDGF-B and PDGF-D bind to PDGFRβ. The binding of a ligand to the receptor induces its autophosphorylation and activation of pivotal intracellular signals (MAP kinase, PI3K/Akt, JAK/STAT and PLC-PKC), which results in proliferation, survival, migration and oncogenesis[
21]. Recently, Kim et al.[
22] report that genetic or pharmacological targeting of PDGFRβ in selected CD133 positive GBM CSC (but not PDGFRα), attenuated self-renewal, survival, tumor growth and invasion. Therefore, development of specific therapies using tyrosine kinase inhibitors (TKI) targeted toward CSC holds promise, but cancer cells may acquire resistance to TKI. In fact, it has been reported that EGFR-mutant glioblastomas may evade EGFR TKI by transcriptionally de-repressing PDGFRβ[
23].
The current study aims to devise strategies to selectively target pivotal plasma membrane receptors relevant to maintenance of either core tumor- (c-CSC) or peritumor tissue (p-CSC)-derived GBM cancer stem cells. We investigated the biological effects on these classes of CSC mediated by TKI targeting individually Notch1, EGFR and PDGFR signaling respectively. Combination therapy with EGFR and Notch inhibitors provided more significant therapeutic effects than single therapy alone, promoting in some cases more apoptosis in c-CSC than p-CSC. The combination of EGFR and PDGFR inhibitors sensitizes either the most resistant GBM p-CSC or c-CSC to apoptosis. This finding is highly relevant because the peripheral area of the tumor is the site of recurrent GBM in 90% of cases. The in vitro pharmacological studies on CSC are a such compelling model as they hold the potential to develop new therapeutic strategies before employing them in clinical trials.
Discussion
In recent years, aberrant RTK expression has gained much attention in cancer stem cells biology. Several TKI and blocking antibodies anti-EGFR have been tested and others are currently in 30 ongoing clinical studies for GBM treatment, according to the website of
clinicaltrial.gov (United States National Institutes of Health). Despite the seemingly critical role of EGFR signaling in GBM, only 10 to 20 percent of patients have shown a modest improvement by EGFR kinase inhibitors[
30,
31]. These initials clinical results have demonstrated the need to understand GBM’s resistance mechanisms to EGFR inhibition as well as to other inhibitors in order to develop more effective therapies[
32]. A sub-population of CD133 positive cancer stem cells with higher Notch activity has been identified in GBM[
33]. Notch inhibition by γ-secretase inhibitors depleted CD133+ glioblastoma cells, making these compounds potential chemotherapeutic agents to target high-grade gliomas. A terminated phase I pharmacological study with MK-0752 (a gamma-secretase inhibitor developed by Merck), demonstrated clinical benefits in patients with advanced solid tumors, including GBM, and now combination trials are ongoing to maximize the therapeutics benefit with this novel agent[
34].
PDGFRα is another critical gene in glioma biology, as it is the second most frequently mutated TRK in GBM, following EGFR. Similar to EGFR, PDGFRα has been shown to be overexpressed, amplified, mutated and rearranged in GBM. PDGFRα gene amplification could be used as a potential prognostic biomarker and therapeutic target in GBM[
35]. A phase II study with a monoclonal antibody anti-PDGFRα is under investigation in recurrent GBM.
In the current study we assessed the effects of Notch1, EGFR and PDGFR inhibitors as a means of investigating GBM CSC responses to disruption of specific intracellular signaling relevant to GBM CSC maintenance. We identified, in some cases, a heterogeneous expression of NOTCH1 gene, in particular we reported sustained levels of expression in p-CSC3 and p-CSC4 with respect to relative counterparts c-CSC. In three cases deeply investigated, c-CSC pools were impaired in cell growth by GSI-X, while the relative p-CSC pools resisted treatment or delayed the inhibitory effects. The Notch1 pathway was investigated in more detail in three cases and surprisingly we found that Notch1 target Hes1 protein was not down modulated by Notch inhibition. This finding may be explained by the results of Wall et al.[
28], who demonstrated that sonic hedgehog (shh)-driven stabilization of Hes1 was independent of Notch signaling and required the Shh effector Gli2. Moreover, a physiological crosstalk has been provided between Notch-Hes1 and JAK-STAT pathways in the developing central nervous system, as Hes proteins (Hes1 and Hes5) bind to STAT3 directly, thereby suggesting that Hes proteins may function as non-scaffold proteins that allow JAK2 to phosphorylate STAT3[
36]. More recently, other authors report that STAT3 and NF-κB signaling regulates the Notch pathway in glioblastoma cancer stem cells[
37]. It is possible that as a consequence of this complex interactions, Notch pathway would be partially hampered by GSI-X treatment, as we detected uncertain down modulation of the cell cycle progression protein CycD1 in c-CSC2 (but not of p27), and of the anti-apoptotic protein survivin in c-CSC3 (but not of Bcl2). Based on the above results only a small fraction of cell death was monitored in GSI-treated c-CSC.
A study on 196 cases of GBM from the TCGA consortium, reports that the expression of Notch signaling components was enriched in the classical/proliferative GBM subtype characterized by EGFR+/PDGFRA- and in the proneural subtype, characterized by PDGFRA+/IDH1+[
38], indeed we did find these correlations in our GBM CSC. Accordingly to the literature, fifty percent of GBM CSC examined in the current study had shown overexpression of EGFR, which resulted independently from Notch1 activation, despite other laboratories’ reports that Notch and EGFR signaling pathways converge to regulate the same gene targets. Purow et al.[
39], report that Notch1 regulates transcription of EGFR through p53 and Xu et al.[
40], stated that knockdown of Notch1 expression by siRNA downregulated the expression of EGFR and the important components of its downstream pathways, including PI3K/Akt, K-Ras, Cyclin D1 and MMP9.
The high EGFR expression in GBM CSC prompted us to explore EGFR signaling as a therapeutic approach and afterwards we decided on combinatorial therapy anti-Notch and anti-EGFR. Our and other laboratories have reported that a specific inhibitor for EGFR efficiently blocked EGF-induced activation of MMP9 and reduced cancer invasiveness[
40]. The inhibitory effects of AG1478 on CSC invasive ability would impact consequently also STAT3 signaling[
41], as reported in the current study except for p-CSC1 and p-CSC3, for whose we did not observed any modulation of phosphorylation on Y705-STAT3 following AG1478 treatment. STAT3 signaling is also involved in GBM invasion promotive effect of IL-6[
42]. The combination of AG1478 and GSI-X exceeded the effects of monotherapy as reported in Western blots, flow cytometry and cell invasion assays. The uncertain effects mediated by Notch inhibition alone were clearly overridden by combining AG1478, which produced: i) apoptosis, ii) switch-off of p-Akt1 and p-Erk1/2 expression, and iii) reduction of CycD1 and Survivin, except in the most resistant p-CSC3 and the arrested CSC1. These effects mirrored a marked reduction of CSC invasive ability with MMP9 protein down modulation as observed in most of the cases except for p-CSC3.
EGFR has been the focus of many brain tumor studies and it is noteworthy that expression of wild-type or constitutively active mutant EGFR is rarely oncogenic as a single lesion, whereas expression of PDGFR ligands can induce tumors as a single driving event[
43,
18]. PDGFs and PDGFRs deregulated expression are found even in low-grade gliomas[
43‐
45], suggesting that this pathway is possibly an early oncogenic event, in contrast to EGFR which is much more commonly found in high-grade gliomas[
46]. Here we report for the first time the inherent overexpression of PDGFRα in GBM p-CSC with respect to c-CSC in all six patient samples examined, suggesting the dominance of its signal in proliferation and maintenance of GBM and in particular of peritumor tissue-derived CSC. Recently, it has been reported that tyrosine-protein phosphatase non-receptor type 11 (SHP-2) and PI3K mediate PDGFRα-promoted glioma tumor growth and invasion[
47]. Based on our results and those of other authors, we hypothesize that the combinations of abnormal expression and activation of growth factor receptors such as: EGFR, PDGFRα, PDGFRβ and Notch1 in GBM CSC or -derived cell lines may influence cell response to targeted therapies, thereby limiting the efficacy of single anti-EGFR or anti-PDGFR or anti-Notch1 therapies as we have seen in this study[
48,
49].
To demonstrate that PDGFRα was relevant to GBM CSC maintenance, we tested a potent PDGFRα signaling inhibitor Crenolanib in the most studied cases (cases 1-3). A significant reduction of cell growth of either c-CSC or p-CSC was reported, with remarkable effects on the 2
nd day of treatment on p-CSC3. The combination therapy with AG1478 enhanced apoptosis induced by CR alone, supporting the hypothesis that targeting more RTKs would probably weaken the tumor growth. It is important to note the up regulation of PDGFRα protein observed in some cases in response to EGFR inhibition, which suggests its role in mediating AG1478 resistance in GBM. Recently, it has been reported that this event is emerging as a frequent, non-genetic mechanism of targeted cancer drug resistance, as reported in GBM CSC, colorectal cancer cells and in non-small cell lung cancer[
23]. In addition, genetic knockdown of PDGFRα in p-CSC2 caused slowdown of cell growth rate and exogenous PDGFAA stimulation of starved GBM CSC promoted p-Erk1/2 and p-Akt1 activation in p-CSC, confirming the concept that PDGFRα activation provided survival signals in p-CSC
vs. c-CSC.
Material and methods
Ethical statement
Procedures for collection of adult human GBM CSC were approved by the Ethical Committee of the Catholic University of Rome as reported previously[
24]. Informed consent was obtained and all patients were fully aware of the aims and scope of this work. The ethical principles of the declaration of Helsinki were strictly followed.
Cell culture and treatment of human Glioblastoma cancer stem cells
We have used the same clinical materials reported in our previous papers[
24,
25]. In brief, the CSC cells were retrieved from adult patients affected by GBM and undergoing craniotomy at the Institute of Neurosurgery, Catholic University-School of Medicine of Rome, Italy. Dissociated cells were cultured in the presence of human recombinant EGF (20 ng/ml; PeproTech, Rocky Hill, NJ), human recombinant bFGF (10 ng/ml; PeproTech), in DMEM/F12 (1:1) serum-free medium (Invitrogen, Carlsband, CA) containing L glutamine 2 mM, glucose 0.6%, putrescine 9.6 ug/ml, progesterone 0.025 mg/ml, sodium selenite 5.2 ng/ml, insulin 0.025 mg/ml, apo-transferrin sodium salt 0.1 mg/ml, sodium bicarbonate 3 mM, Hepes 5 mM, BSA 4 mg/ml, heparin 4 ug/ml (all purchased by Sigma-Aldrich). Floating neurospheres were dissociated with Accutase at 37°C (Merck-Millipore). In some cases, neurospheres were passaged up to passage P60 and the experiments were performed between P14 and P60. Cell starvation was planned for 2 days in Stem Medium w/o EGF and bFGF. Subsequently, PDGF-AA was added (40 ng/ml, Peprotech) for different time points (5′, 10′, 30′, 120′ and 24 hours). Cells treatments were performed with GSI-X (also named L-685,458, Calbiochem), AG1478 (Calbiochem) and Crenolanib (CP-8685596, Selleckchem).
ShRNA, transfection and lentivirus production
The experiments on RNA interference were performed using Mission Lentivirus-based shRNA for PDGFRα (NM_006206-Sigma-Adrich). We amplified three DNA clones (clones numbers: TRCN0000195132, TRCN0000196272, TRCN0000196928) and pLKO.1-puro, as a control for infection. We selected puromycin resistant p-CSC2 expressing three different shRNA sequences, but only two were able to donwmodulate PDGFRα (TRCN0000195132 and TRCN0000196928). Human embryonic kidney (HEK)-293 T cells in log-phase growth were transiently transfected using standard LipofectAmine reagent (Invitrogen), with lentivirus-based shRNA (and with pLKO.1 as control) plus helper plasmids (Invitrogen Packging Plasmids, Carlsbard, CA). Media containing the virions were harvested two days after cell transfection and transferred directly onto p-CSC2. Lentiviral infection was performed in the presence of polybrene solution at 8 μg/ml (Sigma-Aldrich) and the antibiotic puromycin (Euroclone) was added to the cells at 1 μg/ml for a week to select CSC expressing shRNA sequences.
Western blots
GBM CSC seeded as single cells (1 × 106/dish) were left for 1 day in proliferation medium before treating them for 1-2 days with the inhibitors, either singly or in combination. Afterwards, cells were collected and washed with PBS plus proteases inhibitors before protein extraction in 100-200 μl of lysis buffer (1% NP-40, 0.01% SDS, 20 mM Tris–HCl pH 7.4, 300 mM NaCl, 1 mM EDTA, 1 mM Na3VO4 and protease inhibitors cocktail - from Sigma–Aldrich). Then, cells were sonicated with two pulses of 5 sec at 50% of amplitude (Sonics and Materials, Newtown, CT). Equal amounts (30 μg/lane) of total protein extracts, determined by Bio-Rad protein Assay (Bio-Rad, Munchen, Germany), were loaded on NuPAGEBis-Tris gels (Invitrogen), and transferred on Hybond-P Extra membrane (Amersham Biosciences, GE Healthcare Life Science-Buckinghamshire, UK). Filters were immunoblotted using the following primary antibodies: rabbit anti-NICD1, rabbit anti-HES1, rabbit anti-DLL1, rabbit anti-EGFR, rabbit anti-pY1068-EGFR, rabbit anti-PDGFRα, rabbit anti-PDGFRβ, rabbit anti-T202/Y204-ERK1/2 and anti-ERK1/2, rabbit anti-Y705-STAT3 and rabbit anti-STAT3 and anti-Caspase3, (all purchased from Cell Signaling, MA-USA), mouse anti-S473-AKT1 and rabbit anti-AKT1 (Calbiochem), rabbit anti-BCL2 (Millipore), rabbit anti-survivin and anti-MMP9 (Abcam), rabbit anti-Cyclin D1 and anti-p27 (Santa Cruz-USA), mouse anti-β-actin and anti-GAPDH (SIGMA). After three washing with TBS-Tween buffer, immuno-reactive proteins were detected using rabbit anti-mouse, donkey-anti-rabbit and donkey anti-goat horseradish peroxidase-conjugated secondary antibodies directed to the appropriate primary antibodies (Jackson Immunoresearch Laboratories, West Grove, PA). The proteins were then visualized using the chemiluminescence system (Millipore). Gels and Images acquisition was done by HP Photosmart Essential Ver. 1.12 and Adobe Photoshop CS5 respectively. The densitometric analysis of protein bands normalized against to β-actin protein levels were performed from three independent experiments using the ImageJ software (NIH, USA).
Cell proliferation assays
For cell proliferation assay, neurospheres were dissociated into single cells and 1 × 104 cells/well were plated in triplicate on 60 mm plates. Cells were harvested and counted at different time points (3, 5, 7 days in vitro) in growth medium, considering the starting time as the day after plating. For pharmacological studies we used the CellTiter 96 Aqueous One Solution Reagent (Promega), a cell proliferation colorimetric assay containing a novel tetrazolium compound MTS. Briefly, 2 × 104 cells/well were plated in triplicate for each group on 12-well plates and the drugs or DMSO-vehicle were added the day after plating. Before harvesting cells, they were incubated with 100 μl/ml of MTS at 37°C for approximately 1 hour. The metabolically active cells reduced MTS into a soluble formazan product, whose absorbance was measured at 490 nm in a plate reader (Bio-Rad). These experiments were performed three times and each time in triplicate.The absorbance values of the collected samples were subtracted from the background absorbance of medium-only control and expressed as % of control and calculated as mean average ± SD (n = 3).
RT-PCR and custom RT-PCR array
Total RNA was extracted using Triazol and by RNeasy mini kit (Qiagen, USA). cDNAs were obtained using QuantiTect Reverse Transcription kit (Qiagen, USA). Real time reverse transcriptase PCR (RT-PCR) was carried out in triplicate using SYBR Hi-ROX kit (Bioline, UK). RT-PCR and a custom RT-PCR array (Microfluidic Card, Applied Biosystems, CA) were performed with a 7900HT instrument equipped with SDS2.2 software (Applied Biosystems, CA). The PCR primers used for RT-PCR were the following: (Forward) hTBP: GAACATCATGGATCAGAACAACA, (Reverse) hTBP: ATAGGGATTCCGGGAGTCAT; (Forward) hGAPDHAGCCACATCGCTCAGACA; (Reverse) hGAPDH: GCCCAATACGACCAAATCC, as internal controls. (Forward) hEGFRvIII: GGCTCTGGAGGAAAAGAAAGGTAAT; (Reverse) hEGFRvIII: TCCTCCATCTCATAGCTGTCG; (Forward) hEGFR: GCCTTGACTGAGGAACAGCA; (Reverse) hEGFR: TTTGGGAACGGACTGGTTTA; (Forward) hNOTCH1: CGCACAAGGTGTCTTCCAG; (Reverse) hNOTCH1: CGGCGTGTGAGTTGATGA. Relative levels of expression were obtained by normalization with respect to selected housekeeper genes (GAPDH, TBP) by using the ∆Ct method following manufacturer’s guide.
Cell invasion assay
For an invasion assay, 1 × 105 cells were resuspended in 0.3 ml of Stem Medium with inhibitors or DMSO-vehicle and placed in triplicate into the top chamber of matrigel-coated transwell insert (Millipore). The bottom wells contained 0.4 ml of Stem Medium with EGF and bFGF, or without these media as controls for the experiment. After 72 h, cells on the top surface of the filter were removed with a cottonswab. Thereafter, the filters were fixed and stained with crystal violet and subsequently washed to collect the staining solution. OD values, proportional to the number of cells, were measured on a plate reader with a 550 nm filter (Bio-Rad). These experiments were performed three times and each time in triplicate. The absorbance values were calculated as mean ± SD (n = 3). These experiments were repeated three times and each time in triplicate.
FACS analysis
Cells were fixed with 0.5 ml of cold Methanol/Acetone Solution (1:5) and left at 4°C for at least 1 hour, then centrifuged at 950 RPM for 5 minutes. The cell pellet was resuspended in 100 μl of PBS, 375 ul of Rnase A (100 μg/ml) and 25 μl of Propidium Iodide (1 mg/ml). Cells were incubated at room temperature for 15 minutes and left in the dark at 4°C until FACS analysis. Samples were acquired on FacsCalibur (BD Becton Dickinson) at 488 nm. The acquired FACS data were analyzed by ModFit LT software (Verity Software House, Inc.) to determine the percentage of cells sub G1, G1, S and G2/M phases. These experiments were performed twice for each sample.
Statistical analysis
Statistical analysis was performed with Prism5 (GraphPad) and Microsoft Office Excel 2007. All data shown are representative of results obtained from experiments conducted two or three times as specified in the specific sections. The results were analyzed by either One-way Anova and Newman-Keuls post-tests or Two-way ANOVA and Bonferroni’s post tests. Data are expressed as mean ± standard deviation (SD) and P values ≤0.05 (*), ≤0.01 (**), ≤0.001 (***) were considered statistically significant. To evaluate the synergistic effect of the combination of two drugs on cell growth we referred to Lama et al.[
50].
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
CC contributed to conception, experimental design and execution of MTS assays and Western blots; GM and AM contribute to Grant Development; ALV contributed to isolation of GBM CSC; AM and GM performed acquisition of data (managed patients, provided facilities); EP performed the invasion assay; MZ and PP performed the cell cycle analysis; PC performed the cell proliferation assay; CC and AF performed analysis and interpretation of data; HESM helped to write and revise the draft; CC and AM performed the study supervision. All authors read and approved the final manuscript.