Introduction
Diabetic nephrology (DN), one of the major complications in patients with type 1 and/or type 2 diabetes, is the leading cause of end-stage renal disease (ESRD) globally [
1]. Hyperglycemia-induced renal fibrosis, characterized by excessive deposition of extracellular matrix (ECM) and progressive mesangial expansion, plays a critical role in the progression of DN to ESRD [
2]. Unfortunately, there are currently no effective therapies for the treatment of diabetic renal fibrosis.
High glucose-induced mesangial ECM production has been implicated in the pathogenesis of DN [
3]. The ECM mainly consists of fibronectin (FN), collagens, laminin, and proteoglycans. Among them, FN is one of the first ECM proteins to increase at the early stage of DN [
4]. Enhanced FN assembly promotes dysregulated ECM accumulation in DN [
3]. Although the mechanism of FN overexpression is not completely understood, the transforming growth factor-beta1 (TGF-β1) has been suggested to play a crucial role [
5]. TGF-β1 is also the most important inducer of epithelia-to-mesenchymal transition (EMT) in fibrosis [
6]. Nevertheless, massive deposition of FN and excessive secretion of TGF-β1 are two critical indicators of diabetic renal fibrosis.
Advanced glycation end products (AGEs) are a group of heterogeneous compounds formed from nonenzymatic modification of proteins and lipids by sugars under hyperglycemic conditions, and have been implicated in the pathogenesis of DN [
7]. AGEs deposit in the mesangium and basement membranes, and directly disrupt matrix-matrix and matrix-cell interactions. AGEs enhance the expression of FN and TGF-β1, and eventually promote the development of DN [
8]. AGEs-mediated generation of ROS by activating NADPH oxidase has been suggested to contribute to the overexpression of FN and TGF-β1 [
9,
10]. However, it should be noted that the mechanisms for the effects of AGEs on FN and TGF-β1 remain elusive.
Pentosan polysulphate sodium (PPS) is a nonselective anti-inflammatory agent approved by the FDA as the only oral medication for the treatment of interstitial cystitis [
11]. PPS has been shown to improve renal function and fibrosis in 5/6 nephrectomized rats [
12] and ischemia/reperfusion-injured rats [
13]. However, whether PPS protects against diabetic renal fibrosis and the underlying mechanism by which PPS protects against renal injury remain unknown. MicroRNAs (miRNAs or miRs) are small endogenous non-coding RNAs (~ 17-23 nucleotides in length) that induce the mRNA degradation of their target genes by binding to the 3′ non-coding region (3′-UTR) of mRNAs [
14]. Studies suggest that miRNAs are involved in the pathogenesis and development of DN [
15]. The present study aimed to investigate whether PPS protects against diabetic renal fibrosis in mouse mesangial SV40 MES13 cells, and whether miRNAs play a role in PPS-mediated protection.
Materials and methods
Reagents
Dulbecco’s Modified Eagle’s Medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (CA, USA). Penicillin/Streptomycin, phosphate-buffered saline (PBS), Lipofectamine 2000 (Lipo2000) were purchased from Invitrogen (CA, USA). All other chemicals were purchased from Sigma-Aldrich Co. (St. Louis, MO).
Cell culture
Mouse mesangial cells (SV40-MES13) were obtained from the National Infrastructure of Cell Line Resource (Shanghai, China). Cells were grown in DMEM supplemented with 10% FBS and 100 U penicillin/streptomycin under a humidified atmosphere of 5% CO2 at 37 °C. The preparation and dosage of AGEs were referred to previous literature [
16]. The dosage of PPS was selected according to previous in vitro studies [
17,
18].
Cell viability assay
The viability of SV40 MES13 cells was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) kit (Biosharp, Hefei, China). Briefly, cells were seeded at a density of 2 × 104 cells/mL in 96-well culture plates, and allowed to grow overnight. Cells were incubated in the presence or absence of the test articles for indicted time. After the treatment, 10 μl of MTT reagent was added to each well and incubated at 37 °C for 4 h. The culture media with MTT reagent were then removed, and the formation of formazan crystals were dissolved with 100 μl of detergent reagent. The absorbance of each well was determined using a Tecan Infinite M200 Microplate Reader (Tecan, Männedorf, Zürich, Switzerland) at 540 nm.
Apoptosis assay
Cells were trypsinized, collected, and washed three times with PBS. The cells were then fixed in 1 mL of 70% ice-cold ethanol overnight at 4 °C. After two washes with PBS and centrifugation for 10 min at 1000 rpm, the supernatant was discarded. Cells were incubated with Annexin V-FITC (5 μl) and PI (5 μl) at room temperature for 30 min in the dark. A cytometric analysis was performed with a flow cytometer (BD Biosciences, San Jose, CA, USA) to measure the apoptosis rates by detecting the relative amount of Annexin V-FITC positive and PI negative cells. Each assay was performed in triplicate.
Western blot and ELISA analysis
Cells were lysed with RIPA buffer containing protease and phosphatase inhibitors, and the protein concentrations were quantified with the bicinchoninic acid protein assay method. Proteins were separated on 10–15% SDS-PAGE and electroblotted to polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA). Subsequently, the PVDF membranes were blocked and incubated overnight at 4 °C with primary antibodies against FN (1:1000, ab268020, Abcam, Cambridge, MA, USA), TGF-β1 (1:1000, CST3709, Cell Signaling Technology, Inc., Danvers, MA, USA), PIK3CA (1:1000, CST4255S, Cell Signaling Technology, Inc., Danvers, MA, USA), p-PI3K (1:1000, bioworld, AP0152), AKT (1:1000, CST2920, Cell Signaling Technology, Inc., Danvers, MA, USA), p-AKT (1:1000, CST4060, Cell Signaling Technology, Inc., Danvers, MA, USA) and GAPDH (1:5000, ab8245, Abcam, Cambridge, MA, USA). Next, membranes were incubated with the secondary antibody (1:5000) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) at room temperature for 1 h. The blots were then visualized using a western blot analysis detection system (ECL Plus; GE Healthcare, Princeton, NJ, USA). Interleukin-6 (IL-6) and Tumor necrosis factor alpha (TNFα) in cell lysates were measured using ELISA assays (Cat. No.: CSB-E04639m and CSB-E04741m, Cusabio, Wuhan, China) according to the manufacturer’s instruction.
miRNA deep sequencing, KEGG enrichment analysis, and interaction analysis of miRNA-mRNA
Total RNA was extracted using TRIzol reagent (Invitrogen, Waltham, MA, USA), and RNA concentrations were determined using a NanoDropTM 2000 (Thermo, MA, US). The integrity of RNA was determined using RNA 6000 Pico kit (Agilent Technologies, Foster City, CA, USA). The miRNA library and deep sequencing were constructed by Forevergen Biosciences Center (Guangzhou, China). miRNAs with |fold changes| ≥ 0.67 and Q-value ≤0.001 were considered significantly differential expression (DE). For more accurate prediction of target genes by DE miRNAs, RNAhybrid and miRanda 3.3a were used to identify the miRNA binding sites. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were used to the bioinformatic functions of target gene candidates of differentially expressed miRNAs with DAVID 6.7 software (
http://david.abcc.ncifcrf.gov/home.jsp). ACGT101-CORR 1.1 was used to construct the miRNA-mRNA regulatory network for DE miRNAs involved in the PI3K/AKT pathway. The sequencing raw data are available from the NCBI SRA database (accession number: PRJNA769525).
qRT-PCR (real-time polymerase chain reaction) analysis of miRNAs
Total RNA was extracted using TRIzol reagent (Invitrogen, Waltham, MA, USA), and RNA concentrations were determined using a NanoDropTM 2000 (Thermo, MA, US). qRT-PCR for miRNA was performed using the Stem-Loop miRNA qRT-PCR Primer Set (Forevergen, Guangzhou, China). Data analysis was performed using the 2−∆∆Ct method, and normalized to the expression of U6. All the specific primers were as below.
mmu-miR-19b-3p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGTT.
mmu-miR-19b-3p-F:
ACGTCTGTGCAAATCCATGCAA.
mmu-miR-466a-3p-RT:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTAT.
mmu-miR-466a-3p-F:
ATCGCTATACATACACGCACAC.
mmu-miR-223-3p-RT:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGGGT.
mmu-miR-223-3p-F:
ATTCGTGCTGTCAGTTTGTCAA.
mmu-miR-142a-3p-RT:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCATA.
mmu-miR-142a-3p-F:
ACCTGACTTGTAGTGTTTCCTA.
mmu-miR-19a-3p-RT:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACtcagtt.
mmu-miR-19a-3p-F:
TGTGCAAATCTATGCAA.
Universe-R 102:
GTGCAGGGTCCGAGGT.
U6-F:
CTCGCTTCGGCAGCACA.
U6-R 142:
AACGCTTCACGAATTTGCGT.
U6-RT:
AACGCTTCACGAATTTGCGT.
Transfection of miRNAs
The miRNA mimics or inhibitors were purchased from Guangzhou RiboBio (RiboBio, Guangzhou, People’s Republic of China) and transfected into cells using Lipofectamine 2000 (Thermo Fisher Scientific), as recommended by the manufacturer. The cells were transfected with miRNA mimics or inhibitors at a concentration of 100 nM.
Dual-luciferase assay
Luciferase reporter plasmids containing wild-type (Wt) or mutant (Mut) PIK3CA 3′-UTR sequences (pmirGLO-PIK3CA-Wt or pmirGLO-PIK3CA-Mut) were purchased from Forevergen Biosciences Center (Guangzhou, China). The inserted sequence for pmirGLO-PIK3CA-Wt was 5′-AAGCCGCGAGCCTCCTTGCACAAAATTGATAGGTTTTTTTTTGTGTGTATGTGTGTGTTTGTGTGTGTGTATGTTTAACATTAGTCCATCAGTTGCCGTA-3′. The inserted sequence for pmirGLO-PIK3CA-Mut was 5′- AAGCCGCGAGCCTCCTTGCACAAAATTGATAGGTTTTTTTTTTGTGTATTGGTGGTGTTTGTGTGTGTGTATGTTTAACATTAGTCCATCAGTTGCCGTA − 3′. The plasmids were co-transfected with mmu-miR-466a-3p mimic or mmu-miR-466a-3p inhibitor, respectively, into HEK293T cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The concentrations of plasmids and miRNA mimics were 5 ng/mL and 100 nM, respectively. Cells were harvested at 24 h post-transfection for dual-luciferase activity using the Dual-Glo luciferase assay kit (Promega Corporation, Madison, WI, USA), according to the manufacturer’s instructions.
Statistical analysis
All experiments were repeated at least three times. The statistical analysis was performed using SPSS19.0 statistical software. Data are presented as mean ± SEM. Student’s t-test (unpaired, two-tailed) analyses were applied to evaluate the differences between two groups. ANOVA was applied to calculate the differences among various groups. P < 0.05 was considered statistically significant.
Discussion
PPS is a mixture of sulphated polyanions that have been widely used for the treatment of interstitial cystitis, an inflammatory-like disease. Studies suggests a protective effect of PPS on renal function in various models, but it remains unknown whether PPS protects against AGEs-induced DN. In the present study, we showed that AGEs were able to inhibit proliferation and promote apoptosis of SV40 RES13 cells, which was associated with elevated fibrosis (TGF-β1 and FN) and inflammation (IL-6 and TNFα) biomarkers. TGF-β1 is a central mediator of tubulointerstitial fibrosis by inducing the occurrence of EMT and fibrogenesis [
19]. Our results showed that AGEs-treated SV40 RES13 cells could be used as in vitro model of renal fibrosis. More importantly, we showed that PPS almost completely reversed AGEs-induced biomarkers of fibrosis and inflammation in SV40 RES13 cells.
Several mechanisms have been proposed for the protective effect of PPS on renal function. Wu et al. reported that PPS inhibits NF-kB and inflammatory responses in mice with severe diabetic nephropathy [
18]. Chen et al. demonstrated that PPS inhibits high glucose-induced activation of p38 MAPK pathway in human renal proximal tubular epithelial cells (HK-2) [
20]. To best of our knowledge, we reported here for the first time that miRNAs play a crucial role in PPS-mediated protective effects on renal function. Several miRNAs have been associated with the development and progression of DN [
15,
21,
22]. The present study showed that PPS markedly altered the miRNA expression profile in AGEs-treated SV40 RES13 cells. Notably, PI3K/AKT signalling and MAPK signalling were among top 5 most significantly enriched pathways targeted by PPS-related differentially expressed miRNAs. Importantly, both PI3K/AKT and MAPK pathways have been shown to be involved in the mechanisms of fibrosis, and have been suggested to be potential targets for antifibrosis therapy [
23‐
25].
The present study identified the protective effect of miR-466a-3p on AGEs-induced toxicity in SV40 RES13 cells. miR-466a-3p was shown to negatively target the mRNA of PIK3CA, which codes for the p110α isoform of class-IA PI3K. The inhibitor of miR-466a-3p almost completely reversed the effect of PPS on AGEs-induced activation of PI3K/AKT pathway as well as overexpression of FN, TGF-β1, IL-6 and TNFα. This suggests that miR-466a-3p-PI3K/AKT axis mediates the protective effect of PPS on renal function. Future studies are needed to further elucidate the role of miR-466a-3p in cell proliferation, apoptosis, and extracellular matrix in mesangial cells.
Although AGEs have been implicated in the pathogenesis of diabetic DN, the mechanism by which it enhances FN and TGF-β1 is not completely clear [
9]. AGEs-induced ROS could increase cytokines and growth factors, and thus lead to overexpression of FN and TGF-β1 in diabetic renal fibrosis [
10]. It should be noted that the ROS induced by AGEs could further stimulate the formation of new AGEs, resulting in a positive feedback loop [
9,
26]. The present study revealed that AGEs markedly activated the PI3K/AKT pathway in SV40 RES13 cells, and inhibition of this pathway by PPS almost completely reversed the toxicity of AGEs.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.