Background
Systemic juvenile idiopathic arthritis (sJIA) is a seriously rheumatic and chronic auto-inflammatory disease characterized by the dysregulated systemic inflammation (hepatosplenomegaly, serositis, lymphadenopathy, hectic quotidian fevers, typical rash, acute-phase reaction), which seriously threatens the life of children [
1]. Although the pathogenesis of sJIA remains unclear, more and more research indicated that inflammatory cytokines were involved in the regulation of systemic inflammation, local joints damage and bone erosion [
2]. It seems that the balance between pro- and anti-inflammatory cytokines may play a vital role in the pathogenesis and progression of sJIA.
Abundant evidences have suggested that pro-inflammatory cytokines, such as interleukin (IL)-6, IL-17 and tumor necrosis factor-α (TNF-α), were significantly increased in the peripheral blood of sJIA patients, which are related to the pathogenesis of sJIA [
3‐
5]. Interestingly, although IL-1β serum levels in sJIA patients were as low as those of healthy controls (HCs), neutralization of IL-1β with anti-IL-1β agents could effectively and sustainably block the inflammatory response in sJIA [
6,
7]. Accumulating clinical trials demonstrated that therapies targeting these cytokines or their receptors could partially alleviate the inflammatory symptoms and reduce disease activity in sJIA [
8‐
10]. However, the studies related to the expression and function of anti-inflammatory cytokines in sJIA remain poorly understood. IL-37, formerly named IL-1F7, downregulated the expression of pro-inflammatory cytokines in various inflammatory diseases [
11], such as ankylosing spondylitis (AS), systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), and adult-onset Still’s disease (AOSD) [
12‐
16], then relieving the inflammatory responses in sJIA.
IL-37, as a recently identified member of IL-1 family, has been shown an important anti-inflammatory cytokine in the development of many inflammatory diseases, autoimmune diseases and tumors [
11,
17]. IL-37 is widely expressed in human tissues such as thymus, lymph nodes, testis and bone marrow, and in various types of cells such as peripheral blood monocytes (PBMCs), epithelial cells and dendritic cells [
18]. The IL-37 expression level is low and IL-37 mRNA is easily degraded in healthy human tissues and cells [
17‐
19]. When it is stimulated by lipopolysaccharide (LPS) or pro-inflammatory cytokines, the expression level of IL-37 is significantly upregulated and stability of IL-37 mRNA is markedly enhanced, suggesting IL-37 might play a primary role in suppressing excessive immune response [
17]. In recent years, accumulating studies have found that IL-37 is closely related to inflammatory and autoimmune diseases, including SLE, RA, and AOSD [
13‐
16,
20‐
22]. Concomitantly, IL-37 can inhibit the production of pro-inflammatory cytokines in PBMCs from subjects with SLE, RA, AS and AOSD in vitro. As yet, only one study investigated IL-37 levels in the serum and synovial fluid of JIA patients and demonstrated the positive correlation with disease activity and markers of angiogenesis [
23]. Although the IL-37 levels and IL-37 mRNA expression have been reported to be elevated in JIA patients, especially in sJIA patients, when compared with the healthy subjects, its relationships with other disease manifestations and pro-inflammatory cytokines are still unknown. Moreover, whether IL-37 can inhibit the expression of inflammatory cytokines in PBMCs from sJIA patients to protect the development of sJIA remains to be explored.
Here, we measured the expressions of IL-37 mRNA in PBMCs and IL-37 protein in plasma of patients with sJIA and healthy controls, and analyzed the correlation of plasma IL-37 levels with disease activity, laboratory parameters and inflammatory cytokines in sJIA. In addition, we assessed the effect of IL-37 on cytokine production in PBMCs from patients with sJIA.
Methods
Patients and healthy control subjects
Forty-six sJIA patients diagnosed according to the International League Against Rheumatism classification were recruited from the Department of Rheumatology and Immunology at the Capital Institute of Pediatrics Hospital from 2016 to 2018 [
24]. Thirty age- and sex-matched healthy subjects with no history of any rheumatic, autoimmune disease were involved as healthy controls (HCs). Our study was approved by the ethics committee of the Capital Institute of Pediatrics. Written informed consent was obtained from each of the participants and their guardians.
Plasma samples of the patients with active sJIA were enrolled before any kind of nonsteroidal anti-inflammatory drug, disease-modifying anti-rheumatic drug, glucocorticoid, immune-suppressor, or biological agent treatments. All subjects were subjected to the medical histories and clinical characteristics. Clinical data from each patients were recorded (Table
1). Disease activity was measured using the Juvenile Arthritis Disease Activity Score in 27 joints (JADAS-27), which included 4 measures: physician global assessment of disease activity, parent/patient global assessment of well-being, active joint count, and erythrocyte sedimentation rate (ESR) [
25]. The JADAS-27 was calculated as the simple linear sum of the scores of its 4 components, which yields a global score of 0 (no activity)—57 (high activity).
Table 1
Clinical characteristics of sJIA patients and healthy controls
Age (years) | 7.3 ± 3.1 | 7.4 ± 3.3 | 7.4 ± 3.2 | 6.6 ± 2.8 |
Sex, no. F/M | 13/10 | 7/16 | 20/26 | 12/18 |
Disease duration (years) | 2.2 ± 0.88 | 2.0 ± 0.83 | 2.1 ± 0.86 | N/A |
JADAS-27 | 26.09 ± 7.48 | 13.94 ± 6.82 | 20.02 ± 9.37 | N/A |
ESR, mm/h | 48.69 ± 5.64 | 35.77 ± 6.89 | 41.53 ± 9.69 | N/A |
CRP, mg/L | 25.87 ± 6.17 | 21.47 ± 3.36 | 23.7 ± 4.43 | N/A |
PLT, 109/L | 361.39 ± 91.94 | 350.22 ± 90.98 | 357.98 ± 90.37 | N/A |
ALT, U/L | 20.07 ± 19.16 | 24.73 ± 20.72 | 22.41 ± 19.87 | N/A |
AST, U/L | 33.32 ± 20.00 | 36.20 ± 18.97 | 34.76 ± 19.53 | N/A |
ANA positivity (%) | 3 (13.04) | 0 (0) | 3 (6.52) | N/A |
RF positivity (%) | 0 (0) | 0 (0) | 0 (0) | N/A |
Blood collection and PBMCs isolation
Venous blood samples were collected within four hours and directly transferred into ethylene diamine tetraacetic acid (EDTA)-treated tubes. After centrifuged at 2000g for 4 min at room temperature, aliquots of the supernatant were transferred into new RNase-free tubes and stored at − 80 °C until cytokines were determined. PBMCs were isolated from sJIA patients and HCs using Lymphocyte Separation Medium (MP Biomedicals, USA) under sterile conditions for cell culture or frozen at − 80 °C untile RNA extraction.
Expression and purification of recombinant human IL-37 (rhIL-37) protein
Human IL-37 gene, amplified from cDNA of PBMCs using the primer pair 5′-CGGGATCCATGGTTCACACAAGTCCA-3′ and 5′-CCCAAGCTTCTAATCGCTGACCTCACT-3′, were cloned into pET21a vector and expressed in E. coli BL21 (DE3) cells. Protein expression was induced by 0.4 mM isopropyl β-D-thiogalactopyranoside in lysogeny broth (LB) medium and cells were cultured for an additional 6 h at 37 °C. Cells were then harvested by centrifugation and resuspended in lysis buffer (NaCl–Tris–HCl), sonicated in an ice bath, centrifuged at 20,000g for 30 min. The soluble fraction was loaded to His Trap HP, 1 ml column (GE) pre-equilibrated with lysis buffer and the proteins were eluted with different concentrations of imidazole buffer. Target protein was examined by SDS-PAGE electrophoresis and dialyzed in PBS at 4 °C for overnight. The concentrations were detected by Brandford methods, and the recombinant protein was stored at − 80 °C.
Cell culture and rhIL-37 treatment
PBMCs were cultured in RPMI 1640 (Gibco, Thermo Fisher Scientific, USA) with 10% fetal calf serum (Gibco, Thermo Fisher Scientific, USA), 100 μg/ml streptomycin (Beyotime, China) and 100 IU/ml penicillin, and in a humidified atmosphere of 5% CO2 at 37 °C. Cells were cultured at 1.5 × 106 cells/ml in 48-well plates in the absence or presence of rhIL-37 at various concentrations. After 6 h, one group of the cells were incubated further with 1 μg/ml LPS (Sigma-Aldrich, USA) for 6 h, and then total RNAs were extracted and cytokine transcriptions were analyzed by RT-PCR. Another group of the cells were incubated further with 1 μg/ml LPS after 24 h. 6 h later, culture supernatants were harvested and frozen at − 80 °C for cytokine analysis by ELISA.
RNA extraction and RT-PCR
RNA samples were extracted from PBMCs by Trizol regent (Invitrogen, USA), according to the manufacturer’s instructions. cDNAs were obtained using the RT System A3500 Kit (Promega, USA). The primer sequences were summarized in Table
2. RT-PCR amplification reactions were performed using the SYBR Green Real-Time PCR assay and operated by the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). PCR products were amplified in duplicate in a total volume of 20 μl, verified by melting curve analysis. Relative mRNAs levels of target genes were calculated with normalization to β-actin values using the 2
−ΔΔct method.
Table 2
List of the sequence of human gene primers
IL-37 | AGTGCTGCTTAGAAGACCCGG | AGAGTCCAGGACCAGTACTTTGTGA |
TNF-α | ACCTCTCTCTAATCAGCCCTCT | GGGTTTGCTACAACATGGGCTA |
IL-1β | CCACAGACCTTCCAGGAGAAT | GTGCACATAAGCCTCGTTATCC |
IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
IL-17 | ACCTCATTGGTGTCACTGCTAC | GTTCAGGTTGACCATCACAGTC |
β-actin | CCTGACTGACTACCTCATGAAG | GACGTAGCACAGCTTCTCCTTA |
Cytokine assessment
IL-37 protein levels were quantified using ELISA reagent kits purchased from AdipoGen Life Sciences (San Diego, CA, USA). The following cytokines IL-1β, IL-6, TNF-α, IFN-γ and GM-CSF in plasma were measured using the Milliplex MAP Human High Sensitivity T Cell Panel Premixed 13-plex kit (Cat. No. HSTCMAG28SPMX13, EMD Millipore, Billerica, MA 01821, USA), and then detected using Luminex Xmap multiplex technology. Plasma IL-17 levels and cell culture supernatants IL-1β, IL-6, TNF-α, and IL-17 levels were determined using the Proteintech ELISA kits (San Diego, CA, USA).
Statistical analysis
Statistical analyses were analyzed using Graphpad Prism V.5.00 software (GraphPad Software, San Diego CA, USA). All descriptive variables were expressed as mean (±SEM) or median (range). Comparisons between 2 groups were performed by the Student’s t test or Mann–Whitney U-test for nonparametric data. Spearman correlation test was used to evaluate the associations between plasma IL-37 levels and different variables. The P values < 0.05 were considered statistically significant.
Discussion
sJIA is one of the most perplexing rheumatic and chronic disease in children, presenting distinct disease symptoms compared to other subtypes of JIA [
27]. The interesting feature of sJIA is the manifestation of systemic inflammatory in combination with chronic arthritis. The pathogenesis of its inflammatory response is related to a number of regulatory events, ranging from excessive activation of the immune system and inappropriately high levels of pro-inflammatory cytokines [
1,
3,
28]. However, current research into the functions of anti-inflammatory cytokines in sJIA remains limited. IL-37 has been found as a natural inhibitor of inflammation and plays an important regulatory role in immune response by suppressing excessive inflammation [
18,
26]. Studies have confirmed that IL-37 can attenuate inflammation in chronic inflammatory diseases, such as SLE, RA, AS and ASOD [
12,
13,
16,
29]. Based on the above findings, we are eager to know whether and how IL-37 regulates inflammation induced by inflammatory cytokines in sJIA.
Recent data indicated that IL-37 expression was significantly elevated in plasma, PBMCs and synovial fluid (SF) in JIA patients [
23]. Consistent with the findings, our results also revealed that plasma IL-37 levels were higher in sJIA patients compared with HCs. Moreover, we further investigated that plasma IL-37 levels were significantly elevated in patients with active disease than in patients with inactive disease and in HCs. The results suggest that IL-37 expression level is closely related to the internal inflammatory state. We also found that the mRNA level of IL-37 in PBMCs from patients with active sJIA was much higher than that from those with inactive sJIA and HCs, suggesting that an elevated level of inflammation may promote the expression of IL-37 mRNA in PBMCs to alleviate inflammatory response. In view of the constitutively low expression of IL-37 in non-inflammatory or mild inflammatory state, we speculated that IL-37 may primarily restrain excessive inflammation under severe inflammatory conditions.
The monitoring of sJIA disease activity is traditionally based on clinical observations and laboratory features, such as JADAS-27, CRP, ESR, PLT and so on [
23,
30,
31]. We further analyzed the relationship between IL-37 expression and several laboratory values. We observed the positively correlation between the levels of IL-37 and several useful markers of the disease activity, including JADAS-27, CRP and ESR, but it lacked association with other laboratory values, including PLT, AST and ALT. As we known, JADAS is a valid instrument for the assessment of disease activity in JIA, and CRP concentrations and ESR values are also reliable biochemical indicators of the active sJIA [
25,
32,
33]. Taken together, our findings implied that the expression of IL-37 is positively correlated with the disease activity of sJIA and may be a potential biomarker of active disease.
Previous studies have demonstrated that pro-inflammatory cytokines IL-1β, IL-6, TNF-α and IFN-γ markedly increased in sJIA patients and were closely related to the inflammation of sJIA [
3,
28]. Clinical trials showed that antibodies of these pro-inflammatory cytokines could effectively alleviate the disease severity in patients with sJIA [
7,
34‐
36]. Therefore, blocking these cytokines expression is a promising strategy for the development of novel anti-sJIA therapies. In accordance with previous data, we observed the higher plasma levels of these cytokines as well as IL-37 in sJIA patients than in HCs. We also found that the plasma levels of IL-37 were positively correlated with major pro-inflammatory cytokines TNF-α and IL-6 in patients with sJIA. Previous studies reported that IL-37 could be effectively induced synthesis by TNF-α in intestinal epithelial cells and PBMCs from healthy controls [
37]. In addition, TNF-α also promoted the production of pro-inflammatory cytokines, such as IL-6, which in turn synergized with TNF-α to boost the inflammatory response [
38]. Together with these data, we supposed that the uncontrolled inflammation might be due to the inadequate anti-inflammatory cytokines to completely neutralize excessive pro-inflammatory cytokines in the development of sJIA.
Recent studies have revealed that sJIA pathogenesis likely follows a biphasic course [
39]. Pro-inflammatory cytokines driving the systemic disease by an innate immune response is the initial phase. Some inflammatory mediators dominating chronic arthritis by adaptive immune response is the second phase. Interestingly, our Spearman’s correlation analysis showed that plasma IL-37 levels were positively correlated with the inflammatory cytokine IL-17, and negatively correlated with the inflammatory mediator GM-CSF. IL-17 and GM-CSF are signature cytokines of Th17 cells, which have demonstrated major enrichment in the inflamed joints of children with JIA and correlated with the severity of disease [
39,
40]. IL-17 drives chronic arthritis by triggering expressions of cytokines IL-1β and IL-6 and contributes to the balance of Th1/Th2 cells [
41]. Kessel et al. found that pro-inflammatory cytokine environments can drive IL-17 overexpression by γ/δ T Cells in sJIA [
39,
40]. Especially, Liang Ye et al. have demonstrated IL-37 inhibits IL-17 and IL-17—triggering cytokines production in RA patients [
29]. GM-CSF is a potent inflammatory mediator that is responsible for recruitment and activation of immune cells. GM-CSF combined with Th2-secreted cytokine IL-4 can inhibit constitutive IL-37 expression [
18]. Thus, it is reasonable to observe the negative correlation between plasma IL-37 levels and GM-CSF levels in sJIA patients. Recent study has reported that GM-CSF–expressing T cells were enriched in the joints of sJIA patients, highlighting the potential role of Th17-related cytokines in the pathology of sJIA [
40]. As mentioned above, we speculate that IL-37 might not only participate in limiting excessive inflammation in innate immune response but also involve in chronic anti-inflammatory process by adaptive immunity in the development of sJIA.
The cumulative evidence suggested that IL-37 can suppress inflammatory response, possibly by reducing the production of pro-inflammatory cytokines induced by Toll-like receptor (TLR) agonists in several autoimmune and inflammatory diseases [
18,
26]. In vivo experiments found that silencing endogenous IL-37 with small interfering RNAs in PBMCs dramatically upregulated the secretions of IL-1β, IL-6, and TNF-α after LPS treatment [
18]. Additionally, in vitro experiments revealed that recombinant IL-37 proteins effectively inhibit the production of IL-1β, IL-6, and TNF-α in PBMCs from SLE, AS and AOSD patients [
12,
13,
16]. An interesting question that emerges from these findings is “What is the function of IL-37 expression in the process of sJIA inflammatory response?” To answer this question, the rhIL-37 protein was used to stimulate PBMCs from patients with sJIA and healthy controls. Our study is the first to show that rhIL-37 could downregulate expressions of the critical pro-inflammatory cytokines TNF-α, IL-6, and IL-17 after LPS stimulation in PBMCs of sJIA patients, which have no effect on the productions of the pro-inflammatory cytokines in PBMCs of healthy controls. It was shown recently that pro-inflammatory cytokines TNF-α, IL-6, and IL-17 can induce the high expression of IL-37 [
18]. Based on these information, it is plausible to suggest that the increased IL-37 production induced by the high expressions of pro-inflammatory cytokines in sJIA could in turn repress their excessive production through a feedback regulatory loop only in the inflammatory phase.
Authors’ contributions
MK diagnosed and collected the patients; MF, HY, FH and ZX participated in design of the study, carried out experiments and data analysis; ZL contributed to experimental design; MF wrote the manuscript; JW and HY designed and supervised the work. All authors read and approved the final manuscript.