Background
Hepatocellular carcinoma (HCC) is the third leading cause of cancer deaths worldwide, with the incidence on the rise [
1]. The survival of HCC patients after resection remains poor, mainly attributing to frequent metastases and recurrence [
2]. Recently, plenty of researches have performed to explore mechanisms underlying the initiation, propagation and development of HCC [
3],[
4]. However, the complexity of HCC need further hypothesis-drove researches to be exerted. Dysfunction of the cellular transport machinery is commonly observed in multiple cancers including HCC [
5]. Although some molecules are able to diffuse through the large Nucleus Pore Complexes (NPCs) in the nucleus membrane, factors larger than 45 kDa including that associated with malignant diseases need to be mediated by karyopherin to import into the nucleus [
6]. Karyopherin alpha 2 (KPNA2) is one of karyopherin a family, and could form heterodimer with Karyopherin 1 to promote nucleus protein import as an adapter protein [
7]. Recent studies have illustrated that KPNA2 might be a critical oncogene and a potential prognostic biomarker in malignant diseases including HCC [
8]–[
11]. Furthermore, KPNA2 knock-down could significantly inhibit HCC proliferation [
12]. But till now, the mechanistic evidence of KPNA2 in HCC was obscure and deserved to be explored.
Transcriptional factors are widely involved in cancers and are bound to be enriched in nucleus. It raised the hypothesis that KPNA2 might affect cancer cells through the translocation of cancer-associated transcriptional factors. Previous report has indicated the direct association of KPNA2 with a zinc-finger transcription factors pleomorphic adenoma gene 1 (PLAG1) by the yeast two-hybrid system [
13], suggesting PLAG1 might be one of critical mediators of KPNA2 effects in malignant diseases. PLAG1 was identified as a candidate oncogene in various malignant cancers. Recent report illustrated the over-expression of PLAG1 in hepatoblastoma, suggesting a potential role of PLAG1 in liver malignant disease [
14]. Besides, insulin-like growth factor 2 (IGF-II), cellular retinoic acid binding protein (CRABP2) and cytokine receptor-like factor 1 (CRLF1), which are confirmed targets of PLAG1, might be involved in pathological process of HCC [
15],[
16]. However, whether KPNA2 might associate with PLAG1 and assist PLAG1 nucleus import to activate downstream effectors in HCC remains unclassified. Here, we explored the functional interaction of KPNA2 with PLAG1 and the clinical significance of the mechanism in HCC.
Methods
Clinical specimens and follow-up
The study protocol was approved by the clinical research ethics committee of Second Military Medical University (Shanghai, China). Written informed consent was obtained from all patients according to the policies of the committee. Information that could identify the patients was not included in this article.
The tissue microarray (TMA) were constructed as described previously [
17]. Tumoral and corresponding non-tumoral tissues are separately deposed in different slices. A HCC cohort with 314 patients was used for immunohistochemical staining in TMA. All those HCC patients received curative hepatectomy at Eastern Hepatobiliary Surgery Hospital between July 5, 2003 and June 30, 2006. All HCC specimens were obtained immediately after hepatectomy and tissues were then fixed in 10% buffered formalin and embedded in paraffin.
The preoperative diagnosis and surgical procedure of HCC patients was carried out as described previously [
18]. The clinical characteristics of HCC cohort are listed in Table. The differentiation of HCC was defined according to the criteria proposed by Edmondson and Steiner. Micro-metastases were defined as tumors adjacent to the border of the main tumor and were only observed under the microscope.
All prognostic information of HCC patients were checked by phone every 2-3 months during the first 2 years and every 3-6 months thereafter until follow-up ended on October 28, 2010. Two physicians who were unaware of the study performed follow-up examinations. Serum AFP levels and abdominal ultrasound examinations were performed for every month during the first year after surgery and every 3-6 months thereafter. A computed tomography and/or magnetic resonance imaging examination was performed every 3-6 months or when a recurrence were suspected. A diagnosis of recurrence was based on preoperative diagnosis criteria. Once recurrence was confirmed, further treatment was implemented depending on the tumor’s diameter, number, location, and vessel invasion as well as the liver function and performance status.
Cell lines
The Huh7 and SMMC-7721 cells were cultured at 37°C in an atmosphere containing 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM) or Modified Eagle’s Medium (MEM) supplemented with 10% fetal bovine serum.
Total RNA were extracted using Trizol reagent (Takara, Dalian, China) according to the manufacturer’s instructions. The quality of the total RNA was assessed by a Nanodrop 2000 and agarose gel electrophoresis. First-strand cDNA was synthesized from 1-2 μg of total RNA using random primers and the M-MLV Reverse Transcriptase (Invitrogen, CA).
Real-time PCR was performed using a StepOne Plus system (Applied Biosystems, Foster City, CA) with ACTB as endogenous control. The relative mRNA levels were calculated based on the Ct values and normalized using the ACTB expression. The sequences of primers are listed as: ACTB, Forward: AGTTGCGTTACACCCTTTCTTG, Reverse: GCTGTCACCTTCACCGTTCC; KPNA2, Forward: TGATGGTCCAAATGAACGAAT, Reverse: CTGGGAAAGACGGCGAGTG; CRLF1, Forward: TGGCTCTCTTTACGCCCTATTGA, Reverse: TGGCTTGAAAGAGGAAATCCTT; CRABP2, Forward: TGGGGGTGAATGTGATGCTG, Reverse: ACGGTGGTGGAGGTTTTGAT; IGF-II, Forward: AACTGGCCATCCGAAAATAGC, Reverse: TTTGCATGGATTTTGGTTTTCAT.
Protein preparation and Western Blot analysis
Total proteins were extracted using RIPA Lysis Buffer and PMSF (Beyotime Co., China) according to the manufacturer’s instructions. Nucleus proteins were prepared using Cytoplasmic and Nucleus Protein Extraction Kit (Fermentas). Antibody dilutions were 1:2000 for KPNA2 (BD, USA), 1:200 for PLAG1 (Biossy, USA), 1:1000 for Lamin B (Santa Cruz) and 1:5000 for ACTB (Sigma-Aldrich, USA), respectively. Antibody binding was detected using an Odyssey infrared scanner (Li-Cor Biosciences Inc).
Construction of in vitro gain or loss-of-function models
Expression vector encoding the human KPNA2 genes were purchased from Fulen Gen Company (Guangzhou, China). SiRNAs targeting to KPNA2 and PLAG1 were synthesized by GenePharma Company (Shanghai, China). The sequences of siRNAs were disclosed as: KPNA2-Si144: sense, 5’-ACGAAUUGGCAUGGUGGUGAATT-3’, and antisense, 5’-TTUGCUUAACCGUACCACCACUU-3’; KPNA2-Si467: sense, 5’-CCGGGUGUUGAUUCCGAATT-3’, and antisense, 5’-TTGGCCCACAACUAAGGCUU-3’; PLAG1-Si: sense, 5’-GCACAUGGCUACUCAUUCUTT-3’, and antisense, 5’-TTCGUGUACCGAUGAGUAAGA-3’.
KPNA2 expression vectors and siRNAs were transfected into HCC cells by Lipo2000 reagent (Life Technologies, USA) according to the manufacturer’s instructions. The expression of KPNA2 or PLAG1 in the transfected cells was examined by RT-PCR and Western Blot after 48 h. Cells transfected with empty vector or a scrambled siRNA were used as negative controls. We acquired cell clones with KPNA2 over-expression using puromycin.
Cell proliferation assay
Approximately 2 × 103 HCC cells were plated in 96-well plates. Cell proliferation was assessed using the Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s protocol. All of the experiments were performed in triplicate. The cell proliferation curves were plotted using the absorbance at each time point.
Transwell assay
The 24-well Boyden chamber with 8-μm pore size polycarbonate membrane (Corning, NY) was used to analyze the migration of tumor cells. Approximately 1 × 104 HCC cells were plated into chamber. HCC cells were plated into chamber 36 h after siRNA transfection (for both KPNA2 and PLAG1). About 24 hours later, the non-migrating cells on the upper chambers were removed using a cotton swab and migratory cells were stained. Cell number were plotted as the average number of migrated cells from 5 random microscopic fields.
Co-immunoprecipitation (Co-IP)
Cell lysates were prepared from SMMC7721 and Huh7 cells without any KPNA2 manipulation. KPNA2 polyclonal antibody described above was diluted 1:1000. Co-immunoprecipitation was performed according to manufacture of Pierce Classic IP Kit (USA). Briefly, the protein extracts were incubated with either a specific primary antibody or a IgG control antibody overnight at 4°C. Five percent of whole cell lysates was saved as input controls. Immune complexes were collected on Protein A agarose. After washing three times with 0.7 ml of protein lysis buffer, the precipitates were boiled and analyzed using SDS/PAGE (10–12% gel) followed by western blotting to analyze the protein.
Immunocytochemistry
Huh7 Cells with KPNA2 over-expression and negative controls (1:2) were plated into chamber. After 36 h, cells were fixed with 1% paraformaldehyde for 5 min at room temperature. For immunostaining, PLAG1 antibody (Aogma, USA), KPNA2 antibody (BD Biosciences), DAPI (Invitrogen, USA) and cross-adsorbed secondary antibodies were used. Fluorescence was detected using a Zeiss LSM 510.
Immunohistochemical analysis
The immunohistochemical staining was performed on the TMA using a two-step immunoperoxidase technique. The KPNA2 polyclonal antibody (BD, USA) diluted 1:1000 and PLAG1 polyclonal antibody (Biossy, USA) diluted 1:200 were used as primary antibody. Briefly, after heating the sections in 10 mmol/L citrate buffer for antigen retrieval, sections were incubated first with primary antibodies, and then with secondary antibody for an hour at room temperature. The staining was assessed by two separate investigators who were blind to the patient characteristics. The positive KPNA2 and PLAG1 staining was defined as nucleus staining in more than 5% cells [
12].
Statistical analysis
We defined the recurrence-free survival (RFS) and overall survival (OS) as the interval of tumor resection to the detection of tumor recurrence and the subject’s death of HCC. All statistical analyses were carried out using SPSS version 16.0 software. A one-way analysis of variance, the chi-square test and the two-tailed Student’s t-test were performed when appropriate. Survival curves were calculated using the Kaplan-Meier method and compared using a log-rank test. P-value less than 0.05 were considered to be statistically significant.
Discussion
The nucleus transport system circulates various signaling molecules between the cytoplasm and nucleus. Karyopherins are one group of carrier proteins involved in the selective nucleocytoplasmic transport. Accumulating evidences have identified the critical roles of karyopherins in malignant diseases and KPNA2 gains the most attention [
21]–[
23]. Previous report has measured the gene expression profiling of karyopherins in HCC and found overexpressed KPNA2 could promote the proliferation of HCC cells [
7]. Here, our results demonstrated that KPNA2 could significantly enhance the migratory ability of HCC cells. However,
in vivo evidences should be acquired to support our results in the future.
One of the prominent of the cargo proteins of KPNA2 is the transcriptional factor PLAG1, previous evidence has illustrated that pleomorphic adenoma gene 1 (PLAG1) could be identified to be associated with KPNA2
in vitro and proved that a predicted nuclear localization sequence (NLS) composed of short stretches of basic amino acids was essential for physical interaction of PLAG1 with KPNA2 [
13]. Also, researchers have illustrated that the activation of PLAG1 is considered to play important roles in the pathogenesis of various types of cancers [
24],[
25]. Recent report indicates that PLAG1 might be involved in regulatory gene work of hepatoblastoma, malignant liver tumor commonly occurred in childhood [
26], suggesting a potential role of PLAG1 in malignant liver diseases. However, the involvement of PLAG1 in the role of KPNA2 in HCC remains elusive. Collectively, we aimed to explore the association between KPNA2 and PLAG1. We found that the nucleus import of PLAG1 was aided by KPNA2 and would amplify the transcriptional activities of PLAG1 in HCC. Several genes including IGF-II, CRABP2, CRLF1, CRIP2, which are transcriptional targets of PLAG1, could be up-regulated by enhanced KPNA2. IGF-II is frequently up-regulated in HCC and was enriched in the proliferation subclass of the molecular classification of HCC [
27]. Besides, inhibition of IGF-II could impair the proliferation and invasive activities of HCC cells [
20]. Furthermore, inhibition of PLAG1 in cell clones with stable KPNA2 over-expression could abolish the up-regulation of these genes and could counteract the pro-tumoral effects of KPNA2. The result implied that downstream molecular of PLAG1 such as IGF-II might be partly responsible for the role of KPNA2 in HCC. Although we revealed PLAG1 would be a critical mediator for KPNA2, it is noteworthy that whether other transcriptional factors carried into nucleus by KPNA2 might participate in HCC regulation need to be explored.
Cancer classification using biomarkers may effectively define the risk of recurrence, which allows for the use of appropriate treatments to acquire a better prognosis. The prognosis of patients with positive KPNA2 expression could be clustered by the status of PLAG1 nucleus enrichment, validating that the biological effects of KPNA2 relied on the interaction with PLAG1. Besides, for the subgroup of patients with negative PLAG1 expression, the prognostic value of KPNA2 came to be lost, further confirming that inhibition of PLAG1 could significantly retard the role of KPNA2 in tumor growth and metastasis
in vitro as shown in Figure
2b and
2d. Combined with nucleus enrichment of PLAG1, the positive KPNA2 status would be more accurate to predict the prognosis of HCC patients after hepatectomy. Patients with co-existence of positive KPNA2 expression and positive PLAG1 expression should be closely monitored and receive appropriate adjuvant therapies. However, further investigation should be done to validate the prognostic value of KPNA2 and PLAG1 in other cohort of HCC patients, which would be promising for clinical application to reduce the false positive rate to identify and monitor patients with high recurrent risk after hepatectomy.
Conclusions
PLAG1 could be impelled into nucleus by interaction with KPNA2, adapter acting in nucleus protein import. Co-enrichment of KPNA2 and PLAG1 in nucleus is observed in clinical samples. The increment of proliferative and metastatic abilities by KPNA2 can be significantly retarded by PLAG1 inhibition. Positive expression of both PLAG1 and KPNA2 could predict prognosis of HCC patients after hepatectomy Furthermore, the positive PLAG1 expression is the only risk factor for recurrence free survival and overall survival by multivariate analyses of patients with positive KPNA2 expression, further indicating the clinical significance of PLAG1 interaction with KPNA2 and harbor great applicability to distinguish HCC patient to be closely monitored after hepatectomy.
Acknowledgement
The work were granted by Chinese Key Project for Infectious Diseases (Grant No. 2012ZX10002010, 2012ZX10002016), Science Fund for Creative Research Groups, NSFC, China (Grant No. 81221061), National Natural Science Foundation of China (Grant No. 81372207).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
ZYH, SXY, WPZ and HJ designed and supervised the experiments. ZYH, SXY and YY performed qRT-PCR, cell proliferation assay, Transwell assay and immunohistochemistry. YY and WPZ collected clinical samples and supervised clinic-pathological data. ZYH, SXY, WPZ and HJ performed statistical analysis and draft the paper. All authors have read and approved the final manuscript.