Skip to main content
Erschienen in: BMC Infectious Diseases 1/2016

Open Access 01.12.2016 | Research article

PU.1 is involved in the immune response to Aspergillus fumigatus through upregulating Dectin-1 expression

verfasst von: Min Wang, Zhicheng Liu, Chenyang Liu, Ting Wu, Feng Cai, Quan Wang, Xin Su, Yi Shi

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2016

Abstract

Background

Invasive aspergillosis is a life-threatening disease, and its incidence has increased in the recent past. Dectin-1 recognizes β-glucans and mediates innate immune responses to Aspergillus fumigatus. Transcription factor PU.1 has been the focus of recent research due to its role in inflammation and infection. However, its role in Dectin-1 regulation during A. fumigatus infection remains to be elucidated.

Methods

THP-1 cells were stimulated with A. fumigatus conidia. We then used real-time RT-PCR, Western blot, and immunofluorescence assays to analyze the mRNA and protein levels and cellular distribution, respectively, of Dectin-1 and PU.1 in stimulated THP-1 cells. Additionally, we used the luciferase reporter assays, chromatin immunoprecipitation (ChIP) assays, electrophoretic mobility shift assays (EMSA), and RNA interference experiments to investigate the role of PU.1 in Dectin-1 regulation.

Results

Our results revealed that Dectin-1 mRNA and protein levels as well as the PU.1 protein level were increased in THP-1 cells stimulated with A. fumigatus conidia, while the mRNA expression level did not significantly change between the stimulated and control groups. We also observed that PU.1 translocated into the nucleus in stimulated THP-1 cells. The results of the luciferase reporter assay showed that PU.1 promoted human Dectin-1 (hDectin-1) gene activity. ChIP and EMSA indicated that PU.1 could bind with hDectin-1 gene promoter at three potential transcription factor-binding sites (TFBSs). In addition, knockdown of PU.1 significantly decreased Dectin-1 expression.

Conclusions

This study demonstrated the novel role of PU.1 in the immune response to A. fumigatus through upregulation of Dectin-1 expression and its translocation to the nucleus in A. fumigatus-stimulated THP-1 cells.

Background

Invasive aspergillosis (IA) is a life-threatening disease whose incidence is growing worldwide due to the increasing number of immunocompromised patients over the last decades [1]. Despite therapeutic advances and better diagnostic tools and criteria, IA remains difficult to diagnose and treat, and the mortality associated with this condition remains high, ranging from 60 % to 90 % [2]. Aspergillus fumigatus is a ubiquitous opportunistic fungal pathogen that accounts for more than 90 % of all cases of IA [3].
The innate immune system serves as the first line of defense against fungal infection, as it is capable of recognizing and initiating an effective response to eliminate invading A. fumigatus [4]. However, there is limited knowledge of the regulation and detailed immune mechanism involved in the defense against A. fumigatus infection. Therefore, further investigation of the mechanism would help develop effective immunoprophylaxis and to improve patient prognosis.
Pattern recognition receptors (PRRs) recognize pathogen-associated molecular patterns (PAMPs) expressed in the cell wall during fungal infection [4, 5]. C-type lectin receptors (CLRs) are a large family of receptors that bind to carbohydrates in a calcium-dependent manner. They are expressed by several cell types such as macrophages and dendritic cells (DCs), which phagocytose various glycoproteins and microbes for clearance and antigen presentation to T lymphocytes. CLRs are widely recognized to mediate innate immune responses to fungi, with Dectin-1 being the best characterized receptor in the context of fungal infections [5]. Dectin-1 initiates antifungal immunity by recognizing the β-glucan present in the cell walls of A. fumigatus [6, 7].
PU.1, a member of the E-twenty-six (ETS) family, is a transcription factor that is essential for the development of hematopoietic stem cells and regulation of the immune response [8, 9]. In addition, PU.1 participates in regulating the expression of a variety of PRRs, including toll-like receptor (TLR)-4 [10], TLR-9 [11], mannose receptor (MR) [12], a dendritic cell-specific C-type lectin (DC-SIGN) [13], and Dectin-1 [14, 15]. In a previous study, pneumocystis-infected mice exhibited reduced Dectin-1 and PU.1 expression levels decreases in alveolar macrophages (AMs) [15]. However, another study incubated human bronchial epithelial cells (HBE) with A. fumigatus and found that Dectin-1 was upregulated in these cells [16]. Despite these studies, the role of PU.1 in regulating the transcription and expression of the hDectin-1 gene during A. fumigatus infection remains unclear. Therefore, we investigated the role of PU.1 regulating Dectin-1 expression in THP-1 cells stimulated with A. fumigatus. Additionally, we characterized the transcription factor-binding sites (TFBSs) in the hDectin-1 gene promoter, indicated the regulation of hDectin-1 gene via PU.1, and further determined changes in the expression of Dectin-1 following knockdown of PU.1.

Methods

Cells, reagents, and antibodies

THP-1 (human monocytic leukemia) cells were cultured in RPMI-1640 medium (Gibco; Invitrogen, Carlsbad) and human embryonic kidney (HEK)-293 T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco). These two cell lines were gifts from Prof. Xing (Laboratory of Immunology and Virology, Nanjing University, China) [17]. Both the culture mediums were supplemented with 10 % fetal bovine serum (FBS; Hyclone, Thermo Scientific, Logan), and 1 % antibiotic-antimycotic solution (Gibco). The cells were cultured at 37 °C in an atmosphere containing 5 % CO2. Polymerase chain reaction (PCR) primers were synthesized by GenScript (Nanjing, China), while probes for EMSA were synthesized by Viagene Biotech (Ningbo, China). All the primers and probes used in this study are listed in Table 1, 2 and 3. The following antibodies were used for Western blot analysis: rabbit anti-PU.1, rabbit anti-β-tubulin (Cell Signaling Technology, Danvers); goat anti-Dectin-1 (N-16, Santa Cruz Biotechnology, Santa Cruz); mouse anti-GAPDH, mouse anti-β-actin, and rabbit anti-Histone (Abmart, Shanghai, China). Other secondary antibodies were purchased from Cell Signaling Technology. Rabbit anti-PU.1 (H-135, Santa Cruz Biotechnology) and rabbit IgG (Upstate Biotechnology, Waltham) were used in ChIP. Antibodies for Alexa Fluor-488 donkey anti-rabbit IgG and Alexa Fluor-568 donkey anti-goat IgG were purchased from Life Technologies.
Table 1
Primer sequences for real-time PCR
Primers
Sequence (5′–3′)
hDectin-1-Forward
GCAATACCAGGATAGCTGTTG
hDectin-1-Reverse
CCAAGCATAGGATTCCCAA
hPU.1- Forward
CGTGCACAGCGAGTTCGA
hPU.1-Reverse
GCTCTGGAGCTCCGTGAAGT
GAPDH- Forward
ACAGTCAGCCGCATCTTCTT
GAPDH-Reverse
ACGACCAAATCCGTTGACTC
Table 2
Primer sequences for PCR of ChIP
Primers
Sequence (5′–3′)
hDectin-1-A- Forward
CTTTTCCTTAGCAAACTCCACT
hDectin-1-A-Reverse
TCAGTAATACTATTGCAACAGGA
hDectin-1-B- Forward
CCTTCCATAAGCTGTTCCTTGCA
hDectin-1-B-Reverse
CAAGGAATCAAATCAAAGCTGACTC
hDectin-1-C- Forward
GCCTACTATATAGACTTGGAAAAG
hDectin-1-C-Reverse
CTTTGGGAATTATCAGATATTAACAC
hDectin-1-D- Forward
AGCCGAGATCGTGCCATTTGCA
hDectin-1-D-Reverse
TGCTTCTCAAAGGGCAGAGAAAGA
hDectin-1-E- Forward
GAGTCAGCTTTGATTTGATTCCTTG
hDectin-1-E-Reverse
ACTTTTCCAAGTCTATATAGTAGGC
Table 3
Probe sequences for EMSA
Probes
Sequence (5′–3′)
Biotin
Genes
Positive control
PU.1-TP CTGCCTCCTACTTCTCCTTTTCTGC
PU.1-BM GCAGAAAAGGAGAAGTAGGTGGCAG
+
CD11b
Probe A
probe1-TP TTACTTTTGGGGAAGTTGAGTTCAG probe1-BM CTGAACTCAACTTCCCCAAAAGTAA
+
Dectin-1
Probe B
probe1-BM CTGAACTCAACTTCCCCAAAAGTAA probe2-TP TGATGAAAGAGGCAGTGTAGCGTAA
+
Dectin-1
Probe C
probe3-TP GATTGAACAAGAAAATATGTACAAC probe3-BM GTTGTACATATTTTCTTGTTCAATC
+
Dectin-1
Competitor
Paired with each biotin-labeled probe
-
 

A. fumigatus strain and stimulation with conidia

A. fumigatus A1 was kindly provided by the Microbiological Laboratory of Jinling Hospital. After culture on Sabouraud dextrose agar plates for 7 days at 28 °C, conidia were harvested by washing the plates with sterile phosphate-buffered saline (PBS)-0.1 % (vol/vol) Tween 20 (PBST). The suspension was then gently filtered through a 40-μm cell strainer to separate conidia from mycelium. Then, the conidia were thoroughly washed, centrifuged, and resuspended in sterile PBST at concentrations ranging from 5.0 × 107 to 1.0 × 108 colony-forming units (CFU)/mL, and stored at 4 °C within 2 weeks for further experiments. The THP-1 cells were cultured in RPMI-1640 medium at a density of 1.0–1.5 × 106/mL, and stimulated with A. fumigatus conidia at a multiplicity of infection (MOI) of 1.

Quantitative real-time RT-PCR

The total RNA precipitated from the lysates of THP-1 cells stimulated with A. fumigatus conidia and the lysates of unstimulated THP-1 cells were used for reverse transcription (RT) with a Primescript RT reagent kit (R036A; Takara, Tokyo). The mRNA expression levels were analyzed by real-time PCR, as described previously [18]. The specificity of primers was confirmed by melting curve analysis. The relative expression values were standardized by an internal glyceraldehyde-3-phosphate dehydrogenase (GAPDH) control. The fold changes of mRNA were calculated according to the formula 2 CT of gene – ΔCT of GAPDH), where C T is the threshold cycle.

Western blot analysis

THP-1 cell lysates of the mock or A. fumigatus conidia-stimulated cells were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica), and then incubated with primary antibodies overnight. After washing the membranes, they were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 90 min at room temperature. Images were captured using Tanon Imaging System (Tanon, Shanghai, China). For the fractionation of lysates, stimulated or control cells were washed, and cytoplasmic and nuclear fractions were isolated using cytoplasmic/nuclear protein extraction kit (KeyGene Biotechnology, Nanjing, China). The fractions were processed as described above for immunoblot analysis.

Immunofluorescence microscopy

Stimulated and unstimulated THP-1 cells were washed twice with PBS at various time points, fixed with 4 % paraformaldehyde for 30 min, and permeabilized with 0.1 % Triton X-100 for 10 min, and then washed with PBS. After blocking with 5 % bovine serum albumin (BSA) in PBS for 60 min at 37 °C, the cells were incubated with both rabbit anti-PU.1 and goat anti-Dectin-1 antibodies (1:100 dilutions for both antibodies) at 4 °C overnight. The cells were washed with PBST, and then incubated with Alexa Fluor-488 donkey anti-rabbit IgG and Alexa Fluor-568 donkey anti-goat IgG (1:200 dilution for both antibodies) at 37 °C for 1 h. Then, the cells were washed and stained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI). After washing, the slides were carefully observed under a confocal microscope (Carl Zeiss Jena, Oberkochen).

Plasmid constructs and luciferase reporter assays

The 2.0-kb DNA fragment containing the Dectin-1 gene promoter was PCR amplified from human genomic DNA using the following primers: 5′-GCGGTACCGCAGATCGAGACCATTCTGGTTAACAC-3′ and 5′-GCAAGCTTGCGAAACTATGCTGTGGTAATTTT-3′. Plasmid pGL3-Decin-1 was constructed by cloning the amplified fragment into the firefly luciferase reporter vector pGL3 (Promega, Madison). The PU.1 expression plasmid pRK5-PU.1 was obtained by cloning human PU.1 cDNA into EcoRI-digested pRK5-HA (Promega) and a selection of plasmids with properly oriented inserts. HEK-293 T cells were seeded in 24-well plates in total DMEM until 50–70 % confluence was achieved. The cells were then transfected with pRK5-HA or with various amounts of pRK5-PU.1, along with pGL3-Dectin-1 or pGL3-basic, and pRL8-SV40 by using Lipofectamine 2000 (Invitrogen). The total amount of DNA was maintained at a constant level by adding empty control plasmid. At 24 h post-transfection, the cells were stimulated by 10 ng/mL of phorbol-12-myristate-13-acetate (PMA) for 12 h, and cell lysates were analyzed for the activities of firefly and Renilla luciferases (Promega) according to the manufacturer’s instructions.

Chromatin immunoprecipitation assays

ChIP assays were performed using EZ-ChIP™ kit (Upstate Biotechnology) according to the manufacturer’s instructions. In short, 1–1.5 × 107 THP-1 cells were stimulated by 10 ng/mL PMA for 2 h, cross-linked with 1 % formaldehyde, and lysed in SDS lysis buffer. The chromatin samples were sonicated at high power for 7 min (in cycles of 5-s pulses with 10-s pause) using a sonicator (Bioruptor™; Diagenode, Belgium). After preclearing with salmon sperm DNA/Protein A-agarose, the protein extracts were subjected immunoprecipitated with antibodies against PU.1 (H-135), RNA polymerase, and normal rabbit IgG. The resultant immune complexes were extensively washed, and the DNA was recovered by phenol:chloroform extraction and resuspended in 50-μL volume. PCR amplification was performed by using the primers listed in Table 2. The resultant PCR products were analyzed by 2 % agarose gel electrophoresis.

Electrophoretic mobility shift assays (EMSA)

THP-1 cells were plated on RPMI-1640 at a density of 1.0–1.5 × 107 in the presence of 10 ng/mL PMA, and collected after 2 h. Nuclear extracts from PMA-stimulated and control cells were prepared using nuclear protein extraction kit (KeyGene Biotechnology). The probes used for EMSA are listed in Table 3. Briefly, 3 μg of nuclear protein samples were incubated with 10× binding buffer, 1.0 μg/μL poly (dI-dC), and 0.5 μL biotin-labeled probes in an EMSA kit (Viagene Biotech). Where indicated, 0.83 μL or 3.33 μL of specific, cold-competitor probe in 10× or 100× competing buffer was added before the biotin-labeled probe. The incubation mixtures were separated by 6.5 % non-denaturing PAGE, and the bands were detected by autoradiography.

RNA interference experiments

PU.1-specific small interfering RNA (siRNA) or a nonspecific siRNA control (siCtrl) were chemically synthesized at GenePharma (Shanghai, China). The sequence of the PU.1 siRNA was as follows: 5′-UAUAGAUCCGUGUCAUAGGGCACCA-3′. A 5-μL of aliquot of 20 μM siRNA was introduced into 1 × 106 THP-1 cells by using Lipofectamine 2000, according to the manufacturer’s instructions. The transfected cells were incubated for 24 h, and the cells were harvested and subjected to real-time PCR and Western blot analyses to detect PU.1, Dectin-1, and the control cell populations.

Statistical analysis

A two-tailed Student’s paired t test was used to evaluate the data by SPSS software (IBM SPSS, Armonk, USA), and values of p < 0.05 were considered to be statistically significant.

Results

Dectin-1 and PU.1 mRNA and protein expression levels in A. fumigatus conidia-stimulated THP-1 cells

In order to study the PU.1 and Dectin-1 expression patterns in the antifungal immune response, THP-1 cells were exposed to A. fumigatus conidia at an MOI of 1 for 2, 8, and 12 h. Real-time PCR and Western blot analyses were then used to analyze the Dectin-1 and PU.1 mRNA and protein expression levels, respectively, in THP-1. It was observed that both Dectin-1 mRNA and protein levels were upregulated in the conidia-stimulated THP-1 cells compared to the controls (Fig. 1a and c). Interestingly, the results also found that PU.1 mRNA levels remained unchanged in THP-1 cells; however, the PU.1 protein expression was higher in the stimulated cells than in the control cells (Fig. 1b and d).

Cellular localization of Dectin-1 and PU.1

We performed immunofluorescence analysis to the cellular localization of Dectin-1 and PU.1 in THP-1 cells. The stimulated (MOI = 1) or unstimulated THP-1 cells, fixed at different time points after stimulation (2, 8, and 12 h), were stained with diluted goat anti-Dectin-1 and rabbit anti-PU.1 antibodies. In the confocal study, Dectin-1 protein (red) was dispersed in the membrane of conidia-exposed THP-1 cells (Fig. 2). Additionally, Dectin-1 protein expression increased with time of exposure (Fig. 2), as explained previously (Fig. 1c). Meanwhile, translocation of PU.1 protein (green) into the nucleus was markedly stimulated by A. fumigatus conidia (Fig. 2), which was not the case in the control cells.

A. fumigatus activates PU.1 nuclear translocation

To gain further insights into the role of A. fumigatus in the activation of PU.1, we studied nuclear translocation by Western blot analysis of the cytoplasmic and nuclear cell fractions. In the cytoplasm, the PU.1 protein level started to decrease at 8 h after stimulation (Fig. 3a). Meanwhile, in the nucleus, the PU.1 protein levels were higher compared to the corresponding levels in the control cells; moreover, the PU.1 protein levels in the nuclear lysates of the stimulated cells increased with time (Fig. 3b). The histone and β-tubulin protein levels in the cytoplasmic and nuclear fractions were similar in the stimulated and control cells.

PU.1 promotes hDectin-1 gene activity

To investigate whether PU.1 accounts for the hDectin-1 gene promoter activity, HEK-293 T cells were cotransfected with the reporter plasmid pGL3-hDectin-1 and the PU.1-expressing plasmid pRK5-PU.1. HEK-293 T cells were chosen for this experiment instead of monocytes because they normally do not express PU.1; therefore, the influence of endogenous PU.1 can be avoided. Results of the immunoblotting analyses demonstrated the presence of PU.1 protein in transfected cell lysates, indicating that pRK5-PU.1 plasmid could successfully express PU.1 (Fig. 4b). As shown in Fig. 4a, luciferase activity of HEK-293 T cells transfected with 0.10, 0.25, and 0.50 μg of pRK5-PU.1 increased by 3.2–, 8.5–, and 23.0-fold that of the control, respectively, indicating that PU.1 activated hDectin-1 expression in a dose-dependent manner.

PU.1 binds directly to the hDectin-1 gene promoter

To investigate the regulation of hDectin-1 gene expression, we analyzed the 2000-bp region upstream from the transcription initiation start site of the hDectin-1 gene promoter for candidate TFBSs using TRANSDAC [19] and JASPAR [20]. A total of five potential TFBSs were identified for PU.1 (Fig. 5a), which including A (GGGAAGT, –1053 to –1047), B (AGGCAGT, –719 to –713), C (AGAAAAT, –527 to –521), D (AGAAAGA, –1411 to –1405), and E (AGAAAGA, –618 to –612).
The results of the luciferase reporter assays indicate that PU.1 activates the hDectin-1 gene promoter (Fig. 4a). We performed ChIP to determine whether PU.1 interacts with the hDectin-1 gene promoter in THP-1 cells (Fig. 5b). To verify the five putative PU.1 binding motifs, the DNA fragments were amplified with specific hDectin-1 gene-targeting primers (Table 2). The results showed that three regions relative to the transcription start site (+1) of the hDectin-1 gene: –1102 to –1000, –768 to –653, and –564 to –443 were co-precipitated by PU.1, confirming that PU.1 can bind with hDectin-1 gene promoter.
To further verify the ChIP results, EMSA was performed by using nuclear extracts from THP-1 cells. Three biotin-labeled double-stranded oligonucleotide probes (Table 3) carrying the hDectin-1 gene promoter regions A (–1053 to –1047), B (–719 to –713), and C (–527 to –521) were designed and synthesized. Meanwhile, the PU.1-binding sequence from the CD11b gene promoter [21, 22] was chosen as the positive control. Each of these four probes had an unlabeled oligonucleotide probe as the competitor, and the competitor concentrations were 25-fold and 100-fold. An NF-kB probe was used to verify whether the EMSA system worked properly. PMA activates the protein kinase C (PKC) pathway by mimicking diacylglycerol, a natural ligand and activator of PKCs [23], and can alter gene expression via the activation of PKC and modulating the activity of transcriptional factors that bind cis elements such as NF-kB [24], AP-1 [25], and AP-2 [26]. As only active transcription factors could bind to the specific probe, so we prepared two groups of nuclear extracts: one from THP-1 cells that were treated with PMA for 2 h [27] and one group from untreated cells. As shown in Fig. 5c, Probe A bound to nuclear extracts from PMA-stimulated THP-1 cells (Fig. 5c, lane 8), and the band was located at the same position with the CD11b probe (Fig. 5c, lane 4), indicating the specificity of this protein-DNA complex. Adding increasing amounts of competitors (25- and 100-fold) into the assay resulted in a decreasing intensity of PU.1, demonstrating its presence in this complex (Fig. 5c, lanes 9 and 10). These data suggest that the PU.1 protein directly binds to the –1053 to –1047 gene promoter region. A specific PU.1 band could be observed in EMSA using probes B and C (for the –719 to –713 and –527 to –521 regions, respectively Fig. 5d). These results indicated that PU.1 recognizes and binds to the –1053 to –521 region of the hDectin-1 gene promoter through at least three different sites.

Effect of PU.1 knockdown on hDectin-1 gene expression

In order to further confirm that PU.1 regulates the expression of the hDectin-1 gene, THP-1 cells were transfected with control or PU.1 siRNA, and assayed for the expression levels of PU.1 and Dectin-1. Transfection with PU.1 siRNA resulted in approximately 60 % knockdown of PU.1 mRNA expression (Fig. 6a) relative to the control siRNA. In addition, PU.1 silencing decreased Dectin-1 mRNA expression by approximately 32 % in THP-1 cells relative to the expression level in the controls (Fig. 6b). Results of the Western blot analysis also confirmed that THP-1 cells transfected with PU.1 siRNA showed a significant reduction in the Dectin-1 protein expression (Fig. 6c and d), but cells transfected with control siRNA showed no such reduction. These results indicate that PU.1 may participate in the regulation of hDectin-1 gene expression in THP-1 cells.

Discussion

Dectin-1 is a member of the CLR family and is expressed on the surface of many cells [28]. Its involvement in the immune defense against A. fumigatus has been widely confirmed [29]. In our previous study, A. fumigatus was shown to induce the upregulation of Dectin-1 in HBE cells in a TLR2-dependent manner [16]. In the present study, we found that Dectin-1 mRNA and protein expression levels were increased in THP-1 cells stimulated with A. fumigatus conidia.
PU.1 belongs to the ETS family and has a great impact on the immunity, primarily through its control of immune cell development [30]. As PU.1 has been the focus of increasing attention for its role in inflammation and infection [3133], we evaluated PU.1 expression at the mRNA and protein levels in THP-1 monocyte cells exposed to A. fumigatus conidia. The results of the present study demonstrated for the first time that the PU.1 protein expression was increased in THP-1 cells incubated with A. fumigatus conidia compared to the control cells, while the mRNA level showed no significant differences between the exposed and control cells.
In our study, the PU.1 mRNA level was not correlated with its protein level. Similar to our finding, a previous study reported that the PU.1 mRNA level in preadipocytes was high, while the PU.1 protein is not expressed in these cells [34]. Regulation of gene expression is a complicated and meticulous process, and it is controlled at multiple levels, including transcriptional, post-transcriptional, translational, and post- translational levels [35]. MicroRNAs are a large class of small, noncoding RNAs in plants and animals, and have been known to mediate post-transcriptional regulation [36]. PU.1 is a direct target for miR-155 and the target sequence for miR-155 is localized in the 3′-untranslated region (UTR) of PU.1. Also, miR-155 overexpression in THP-1 cells has been found to decrease the PU.1 protein level [13]. Further studies are required to investigate the precise mechanisms responsible for the different patterns of PU.1 mRNA and protein expression during stimulation with A. fumigatus.
In our study, PU.1 protein was localized in the cytoplasm of unstimulated THP-1 cells, and translocated into the nucleus following exposure to A. fumigatus conidia. To the best of our knowledge, this is the first study to illustrate the translocation of PU.1 stimulated by A. fumigatus conidia. Previously, in HeLa and RAW264.7 macrophage cell models, PU.1 has been shown to enter the nucleus via passive diffusion and active transport. The latter can be facilitated by: (i) the classical pathway requiring importin α and β, (ii) the non-classical pathway requiring only importin β, or (iii) direct interaction with nucleoporins [37, 38]. However, to date, little is known regarding the mechanisms of PU.1 nuclear transport during A. fumigatus stimulation. Thus, future studies are necessary to investigate the mechanisms by which A. fumigatus drives the transport of PU.1 from the cytoplasm to the nucleus.
The regulation of Dectin-1 expression has not been extensively studied to date; however, downregulation of PU.1 is known to result in decreased Dectin-1 expression in AMs in Pneumocystis-infected mice [15]. In another study, BLT1 was found to modulate the transcription of Dectin-1 via a GM-CSF/PU.1 cascade [14]. However, the role of PU.1 in regulating the transcription and expression of hDectin-1 gene during A. fumigatus stimulation in THP-1 cells remains unknown. In our study, the results of the luciferase reporter assay showed that PU.1 promoted hDectin-1 gene activity in a dose-dependent manner. Additionally, five potential TFBSs for PU.1 were predicted by using the TFBS databases. Moreover, the ChIP assay in our study indicated that PU.1 could bind to the hDectin-1 gene promoter at the –1053 to –1047, –719 to –713, and –527 to –521 regions. The synthetic polymer poly(dI-dC) is considered to be one of the most potent, and likely the most widely used, nonspecific competitor in EMSA. Its addition to the reaction mixture before addition of crude nuclear proteins has been proven to be an efficient way of reducing any nonspecific interactions by facilitating detection of the complexes of interest [39]. Therefore, we used poly(dI-dC) in the EMSA analysis in this study. Further EMSA results confirmed that PU.1 could bind to the abovementioned three regions of the hDectin-1 gene promoter. Based on the results of our study and those of previous reports, we suggest that PU.1 can bind to the hDectin-1 gene promoter.
To confirm that PU.1 regulates the expression of the hDectin-1 gene, we knocked down the expression of PU.1 in THP-1 cells using siRNA. Although Dectin-1 expression has been reported to be controlled by PU.1 [15] and leukotriene B4 via a GM-CSF/PU.1 axis [14] in mouse models, our results are the first to demonstrate that silencing the expression of PU.1 could significantly decrease the hDectin-1 gene mRNA and protein expression levels in THP-1 cells. Lack of PU.1 expression is known to contribute to decreased maturation, differentiation, and surfactant metabolism in AMs of patients with pulmonary alveolar proteinosis [40]. In addition, PU.1 knockdown in macrophages has shown to decrease phagocytic activity [15]. However, further studies are warranted to examine how knockdown or overexpression of PU.1 can affect the innate immune and inflammatory responses to A. fumigatus infection and the precise mechanisms underlying this process.

Conclusions

As Dectin-1 is a major recognition receptor for numerous fungi, including species of Candida, Aspergillus, Histoplasma, Cryptococcus, and Coccidioides [41], our data suggest a potentially broad role for PU.1 in antifungal defense. Meanwhile, Dectin-1 may participate in recognizing other microbes as well, and it may therefore be important that future studies investigate the potential roles of PU.1 in defense against infections by other pathogens. In conclusion, this study provides novel insights to modulate the immune response to A. fumigatus, and lays a foundation for the diagnosis and therapeutic strategy for A. fumigatus aspergillosis.

Abbreviations

BSA, Bovine serum albumin; ChIP, Chromatin immunoprecipitation; CLR, C-type lectin receptor; DAPI, 4′,6-Diamidino-2-phenylindole; DMEM, Dulbecco’s modified Eagle’s medium; EMSA, Electrophoretic mobility shift assays; ETS, E-twenty-six; FBS, Fetal bovine serum; HBE, Human bronchial epithelial; IA, Invasive aspergillosis; MOI, Multiplicity of infection; NSB, Nonspecific binding; PAGE, Polyacrylamide gel electrophoresis; PAMP, Pathogen-associated molecular pattern; PBS, Phosphate-buffered saline; PBST, Phosphate-buffered saline (PBS)-0.1 % (vol/vol) Tween 20; PCR, Polymerase chain reaction; PMA:Phorbol-12-myristate-13-acetate; PRR, Pattern recognition receptor; PVDF, Polyvinylidene difluoride; RT, Reverse transcription; SDS, Sodium dodecyl sulfate; TFBS, Transcription factor-binding site; UTR, Untranslated region

Acknowledgements

The authors would like to thank Prof. Xing for providing cell lines. This work was supported by grants from the National Natural Science Foundation of China (Grant No. 81270064 and 81330035).

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article.

Authors’ contributions

SY and SX conceived and designed the study, and critically revised the manuscript. WM and LZC performed the experiments, analyzed the data and drafted the manuscript. LCY, WT, CF and WQ helped in experiment implementation. All authors read and approved the final manuscript.

Competing interests

The authors have declared that they have no competing interests.
Not applicable.
Not applicable.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Patterson KC, Strek ME. Diagnosis and treatment of pulmonary aspergillosis syndromes. Chest. 2014;146(5):1358–68.CrossRefPubMed Patterson KC, Strek ME. Diagnosis and treatment of pulmonary aspergillosis syndromes. Chest. 2014;146(5):1358–68.CrossRefPubMed
2.
Zurück zum Zitat Bassetti M, Righi E, De Pascale G, De Gaudio R, Giarratano A, Mazzei T, Morace G, Petrosillo N, Stefani S, Antonelli M. How to manage aspergillosis in non-neutropenic intensive care unit patients. Crit Care. 2014;18(4):458.CrossRefPubMedPubMedCentral Bassetti M, Righi E, De Pascale G, De Gaudio R, Giarratano A, Mazzei T, Morace G, Petrosillo N, Stefani S, Antonelli M. How to manage aspergillosis in non-neutropenic intensive care unit patients. Crit Care. 2014;18(4):458.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Sugui JA, Kwon-Chung KJ, Juvvadi PR, Latge JP, Steinbach WJ. Aspergillus fumigatus and related species. Cold Spring Harb Perspect Med. 2015;5(2):a19786.CrossRef Sugui JA, Kwon-Chung KJ, Juvvadi PR, Latge JP, Steinbach WJ. Aspergillus fumigatus and related species. Cold Spring Harb Perspect Med. 2015;5(2):a19786.CrossRef
6.
Zurück zum Zitat Jia XM, Tang B, Zhu LL, Liu YH, Zhao XQ, Gorjestani S, Hsu YMS, Yang L, Guan JH, Xu GT. CARD9 mediates Dectin-1-induced ERK activation by linking Ras-GRF1 to H-Ras for antifungal immunity. J Exp Med. 2014;211(11):2307–21.CrossRefPubMedPubMedCentral Jia XM, Tang B, Zhu LL, Liu YH, Zhao XQ, Gorjestani S, Hsu YMS, Yang L, Guan JH, Xu GT. CARD9 mediates Dectin-1-induced ERK activation by linking Ras-GRF1 to H-Ras for antifungal immunity. J Exp Med. 2014;211(11):2307–21.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Lee DH, Kim HW. Innate immunity induced by fungal beta-glucans via dectin-1 signaling pathway. Int J Med Mushrooms. 2014;16(1):1–16.CrossRefPubMed Lee DH, Kim HW. Innate immunity induced by fungal beta-glucans via dectin-1 signaling pathway. Int J Med Mushrooms. 2014;16(1):1–16.CrossRefPubMed
8.
Zurück zum Zitat Kastner P, Chan S. PU.1: A crucial and versatile player in hematopoiesis and leukemia. Int J Biochem Cell Biol. 2008;40(1):22–7.CrossRefPubMed Kastner P, Chan S. PU.1: A crucial and versatile player in hematopoiesis and leukemia. Int J Biochem Cell Biol. 2008;40(1):22–7.CrossRefPubMed
9.
Zurück zum Zitat Moreau-Gachelin F, Tavitian A, Tambourin P. Spi-1 is a putative oncogene in virally induced murine erythroleukaemias. Nature. 1988;331(6153):277–80.CrossRefPubMed Moreau-Gachelin F, Tavitian A, Tambourin P. Spi-1 is a putative oncogene in virally induced murine erythroleukaemias. Nature. 1988;331(6153):277–80.CrossRefPubMed
10.
Zurück zum Zitat Pedchenko TV. Inducible binding of PU.1 and interacting proteins to the Toll-like receptor 4 promoter during endotoxemia. AJP. 2005;289(3):L429–37. Pedchenko TV. Inducible binding of PU.1 and interacting proteins to the Toll-like receptor 4 promoter during endotoxemia. AJP. 2005;289(3):L429–37.
11.
Zurück zum Zitat Schroder K, Lichtinger M, Irvine KM, Brion K, Trieu A, Ross IL, Ravasi T, Stacey KJ, Rehli M, Hume DA. PU.1 and ICSBP control constitutive and IFN- -regulated Tlr9 gene expression in mouse macrophages. J Leukocyte Biol. 2007;81(6):1577–90.CrossRefPubMed Schroder K, Lichtinger M, Irvine KM, Brion K, Trieu A, Ross IL, Ravasi T, Stacey KJ, Rehli M, Hume DA. PU.1 and ICSBP control constitutive and IFN- -regulated Tlr9 gene expression in mouse macrophages. J Leukocyte Biol. 2007;81(6):1577–90.CrossRefPubMed
12.
Zurück zum Zitat Egan BS, Lane KB, Shepherd VL. PU.1 and USF are required for macrophage-specific mannose receptor promoter activity. J Biol Chem. 1999;274(13):9098–107.CrossRefPubMed Egan BS, Lane KB, Shepherd VL. PU.1 and USF are required for macrophage-specific mannose receptor promoter activity. J Biol Chem. 1999;274(13):9098–107.CrossRefPubMed
13.
Zurück zum Zitat Martinez-Nunez RT, Louafi F, Friedmann PS, Sanchez-Elsner T. MicroRNA-155 modulates the pathogen binding ability of dendritic cells (DCs) by down-regulation of DC-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN). J Biol Chem. 2009;284(24):16334–42.CrossRefPubMedPubMedCentral Martinez-Nunez RT, Louafi F, Friedmann PS, Sanchez-Elsner T. MicroRNA-155 modulates the pathogen binding ability of dendritic cells (DCs) by down-regulation of DC-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN). J Biol Chem. 2009;284(24):16334–42.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Serezani CH, Kane S, Collins L, Morato-Marques M, Osterholzer JJ, Peters-Golden M. Macrophage dectin-1 expression is controlled by leukotriene B4 via a GM-CSF/PU.1 axis. J Immunol. 2012;189(2):906–15.CrossRefPubMedPubMedCentral Serezani CH, Kane S, Collins L, Morato-Marques M, Osterholzer JJ, Peters-Golden M. Macrophage dectin-1 expression is controlled by leukotriene B4 via a GM-CSF/PU.1 axis. J Immunol. 2012;189(2):906–15.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Zhang C, Wang SH, Liao CP, Shao S, Lasbury ME, Durant PJ, Lee CH. Downregulation of PU.1 Leads to Decreased Expression of Dectin-1 in Alveolar Macrophages during Pneumocystis Pneumonia. Infect Immun. 2010;78(3):1058–65.CrossRefPubMedPubMedCentral Zhang C, Wang SH, Liao CP, Shao S, Lasbury ME, Durant PJ, Lee CH. Downregulation of PU.1 Leads to Decreased Expression of Dectin-1 in Alveolar Macrophages during Pneumocystis Pneumonia. Infect Immun. 2010;78(3):1058–65.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Sun WK, Lu X, Li X, Sun QY, Su X, Song Y, Sun HM, Shi Y. Dectin-1 is inducible and plays a crucial role in Aspergillus-induced innate immune responses in human bronchial epithelial cells. Eur J Clin Microbiol. 2012;31(10):2755–64.CrossRef Sun WK, Lu X, Li X, Sun QY, Su X, Song Y, Sun HM, Shi Y. Dectin-1 is inducible and plays a crucial role in Aspergillus-induced innate immune responses in human bronchial epithelial cells. Eur J Clin Microbiol. 2012;31(10):2755–64.CrossRef
17.
Zurück zum Zitat Qu B, Qi X, Wu X, Liang M, Li C, Cardona CJ, Xu W, Tang F, Li Z, Wu B. Suppression of the Interferon and NF- B Responses by Severe Fever with Thrombocytopenia Syndrome Virus. J Virol. 2012;86(16):8388–401.CrossRefPubMedPubMedCentral Qu B, Qi X, Wu X, Liang M, Li C, Cardona CJ, Xu W, Tang F, Li Z, Wu B. Suppression of the Interferon and NF- B Responses by Severe Fever with Thrombocytopenia Syndrome Virus. J Virol. 2012;86(16):8388–401.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Wu X, Qi X, Qu B, Zhang Z, Liang M, Li C, Cardona CJ, Li D, Xing Z. Evasion of Antiviral Immunity through Sequestering of TBK1/IKK/IRF3 into Viral Inclusion Bodies. J Virol. 2014;88(6):3067–76.CrossRefPubMedPubMedCentral Wu X, Qi X, Qu B, Zhang Z, Liang M, Li C, Cardona CJ, Li D, Xing Z. Evasion of Antiviral Immunity through Sequestering of TBK1/IKK/IRF3 into Viral Inclusion Bodies. J Virol. 2014;88(6):3067–76.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Wingender E. The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation. Brief Bioinform. 2008;9(4):326–32.CrossRefPubMed Wingender E. The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation. Brief Bioinform. 2008;9(4):326–32.CrossRefPubMed
20.
Zurück zum Zitat Bryne JC, Valen E, Tang MH, Marstrand T, Winther O, Da PI, Krogh A, Lenhard B, Sandelin A. JASPAR, the open access database of transcription factor-binding profiles: new content and tools in the 2008 update. Nucleic Acids Res. 2008;36(Database issue):D102–6.PubMed Bryne JC, Valen E, Tang MH, Marstrand T, Winther O, Da PI, Krogh A, Lenhard B, Sandelin A. JASPAR, the open access database of transcription factor-binding profiles: new content and tools in the 2008 update. Nucleic Acids Res. 2008;36(Database issue):D102–6.PubMed
21.
Zurück zum Zitat Dominguez-Soto A, Puig-Kroger A, Vega MA, Corbi AL. PU.1 Regulates the Tissue-specific Expression of Dendritic Cell-specific Intercellular Adhesion Molecule (ICAM)-3-grabbing Nonintegrin. J Biol Chem. 2005;280(39):33123–31.CrossRefPubMed Dominguez-Soto A, Puig-Kroger A, Vega MA, Corbi AL. PU.1 Regulates the Tissue-specific Expression of Dendritic Cell-specific Intercellular Adhesion Molecule (ICAM)-3-grabbing Nonintegrin. J Biol Chem. 2005;280(39):33123–31.CrossRefPubMed
22.
Zurück zum Zitat Nika E, Brugnoli F, Piazzi M, Lambertini E, Grassilli S, Bavelloni A, Piva R, Capitani S, Bertagnolo V. hnRNP K in PU.1-containing complexes recruited at the CD11b promoter: a distinct role in modulating granulocytic and monocytic differentiation of AML-derived cells. Biochem J. 2014;463(1):115–22.CrossRefPubMed Nika E, Brugnoli F, Piazzi M, Lambertini E, Grassilli S, Bavelloni A, Piva R, Capitani S, Bertagnolo V. hnRNP K in PU.1-containing complexes recruited at the CD11b promoter: a distinct role in modulating granulocytic and monocytic differentiation of AML-derived cells. Biochem J. 2014;463(1):115–22.CrossRefPubMed
23.
Zurück zum Zitat Ghamlouch H, Ouled-Haddou H, Guyart A, Regnier A, Trudel S, Claisse JF, Fuentes V, Royer B, Marolleau JP, Gubler B. Phorbol myristate acetate, but not CD40L, induces the differentiation of CLL B cells into Ab-secreting cells. Immunol Cell Biol. 2014;92(7):591–604.CrossRefPubMedPubMedCentral Ghamlouch H, Ouled-Haddou H, Guyart A, Regnier A, Trudel S, Claisse JF, Fuentes V, Royer B, Marolleau JP, Gubler B. Phorbol myristate acetate, but not CD40L, induces the differentiation of CLL B cells into Ab-secreting cells. Immunol Cell Biol. 2014;92(7):591–604.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Ghosh S, Baltimore D. Activation in vitro of NF-kappa B by phosphorylation of its inhibitor I kappa B. Nature. 1990;344(6267):678–82.CrossRefPubMed Ghosh S, Baltimore D. Activation in vitro of NF-kappa B by phosphorylation of its inhibitor I kappa B. Nature. 1990;344(6267):678–82.CrossRefPubMed
25.
Zurück zum Zitat Bos TJ, Bohmann D, Tsuchie H, Tjian R, Vogt PK. v-jun encodes a nuclear protein with enhancer binding properties of AP-1. Cell. 1988;52(5):705–12.CrossRefPubMed Bos TJ, Bohmann D, Tsuchie H, Tjian R, Vogt PK. v-jun encodes a nuclear protein with enhancer binding properties of AP-1. Cell. 1988;52(5):705–12.CrossRefPubMed
26.
Zurück zum Zitat Williams T, Admon A, Luscher B, Tjian R. Cloning and expression of AP-2, a cell-type-specific transcription factor that activates inducible enhancer elements. Genes Dev. 1988;2(12A):1557–69.CrossRefPubMed Williams T, Admon A, Luscher B, Tjian R. Cloning and expression of AP-2, a cell-type-specific transcription factor that activates inducible enhancer elements. Genes Dev. 1988;2(12A):1557–69.CrossRefPubMed
27.
Zurück zum Zitat Foster N, Lea SR, Preshaw PM, Taylor JJ. Pivotal Advance: Vasoactive intestinal peptide inhibits up-regulation of human monocyte TLR2 and TLR4 by LPS and differentiation of monocytes to macrophages. J Leukocyte Biol. 2007;81(4):893–903.CrossRefPubMed Foster N, Lea SR, Preshaw PM, Taylor JJ. Pivotal Advance: Vasoactive intestinal peptide inhibits up-regulation of human monocyte TLR2 and TLR4 by LPS and differentiation of monocytes to macrophages. J Leukocyte Biol. 2007;81(4):893–903.CrossRefPubMed
28.
Zurück zum Zitat Wevers BA, Geijtenbeek TB, Gringhuis SI. C-type lectin receptors orchestrate antifungal immunity. Future Microbiol. 2013;8(7):839–54.CrossRefPubMed Wevers BA, Geijtenbeek TB, Gringhuis SI. C-type lectin receptors orchestrate antifungal immunity. Future Microbiol. 2013;8(7):839–54.CrossRefPubMed
29.
Zurück zum Zitat Saijo S, Iwakura Y. Dectin-1 and Dectin-2 in innate immunity against fungi. Int Immunol. 2011;23(8):467–72.CrossRefPubMed Saijo S, Iwakura Y. Dectin-1 and Dectin-2 in innate immunity against fungi. Int Immunol. 2011;23(8):467–72.CrossRefPubMed
30.
Zurück zum Zitat Gallant S, Gilkeson G. ETS transcription factors and regulation of immunity. Arch Immunol Ther Exp (Warsz). 2006;54(3):149–63.CrossRef Gallant S, Gilkeson G. ETS transcription factors and regulation of immunity. Arch Immunol Ther Exp (Warsz). 2006;54(3):149–63.CrossRef
31.
Zurück zum Zitat Qian F, Deng J, Lee YG, Zhu J, Karpurapu M, Chung S, Zheng J, Xiao L, Park GY Christman JW. The transcription factor PU.1 promotes alternative macrophage polarization and asthmatic airway inflammation. J Mol Cell Biol. 2015;7(6):557–67.CrossRefPubMedPubMedCentral Qian F, Deng J, Lee YG, Zhu J, Karpurapu M, Chung S, Zheng J, Xiao L, Park GY Christman JW. The transcription factor PU.1 promotes alternative macrophage polarization and asthmatic airway inflammation. J Mol Cell Biol. 2015;7(6):557–67.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Steinwede K, Tempelhof O, Bolte K, Maus R, Bohling J, Ueberberg B, Langer F, Christman JW, Paton JC, Ask K. Local delivery of GM-CSF protects mice from lethal pneumococcal pneumonia. J Immunol. 2011;187(10):5346–56.CrossRefPubMedPubMedCentral Steinwede K, Tempelhof O, Bolte K, Maus R, Bohling J, Ueberberg B, Langer F, Christman JW, Paton JC, Ask K. Local delivery of GM-CSF protects mice from lethal pneumococcal pneumonia. J Immunol. 2011;187(10):5346–56.CrossRefPubMedPubMedCentral
33.
Zurück zum Zitat Zhang G, Zhou B, Li S, Yue J, Yang H, Wen Y, Zhan S, Wang W, Liao M, Zhang M. Allele-specific induction of IL-1beta expression by C/EBPbeta and PU.1 contributes to increased tuberculosis susceptibility. PLoS Pathog. 2014;10(10):e1004426.CrossRefPubMedPubMedCentral Zhang G, Zhou B, Li S, Yue J, Yang H, Wen Y, Zhan S, Wang W, Liao M, Zhang M. Allele-specific induction of IL-1beta expression by C/EBPbeta and PU.1 contributes to increased tuberculosis susceptibility. PLoS Pathog. 2014;10(10):e1004426.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Wang F, Tong Q. Transcription factor PU.1 is expressed in white adipose and inhibits adipocyte differentiation. Am J Physiol Cell Physiol. 2008;295(1):C213–20.CrossRefPubMed Wang F, Tong Q. Transcription factor PU.1 is expressed in white adipose and inhibits adipocyte differentiation. Am J Physiol Cell Physiol. 2008;295(1):C213–20.CrossRefPubMed
35.
Zurück zum Zitat Marcel V, Catez F, Diaz JJ. p53, a translational regulator: contribution to its tumour-suppressor activity. Oncogene. 2015;34(44):5513–23.CrossRefPubMed Marcel V, Catez F, Diaz JJ. p53, a translational regulator: contribution to its tumour-suppressor activity. Oncogene. 2015;34(44):5513–23.CrossRefPubMed
36.
Zurück zum Zitat Chen K, Rajewsky N. The evolution of gene regulation by transcription factors and microRNAs. Nat Rev Genet. 2007;8(2):93–103.CrossRefPubMed Chen K, Rajewsky N. The evolution of gene regulation by transcription factors and microRNAs. Nat Rev Genet. 2007;8(2):93–103.CrossRefPubMed
37.
Zurück zum Zitat Kwok JC, Perdomo J, Chong BH. Identification of a monopartite sequence in PU.1 essential for nuclear import, DNA-binding and transcription of myeloid-specific genes. J Cell Biochem. 2007;101(6):1456–74.CrossRefPubMed Kwok JC, Perdomo J, Chong BH. Identification of a monopartite sequence in PU.1 essential for nuclear import, DNA-binding and transcription of myeloid-specific genes. J Cell Biochem. 2007;101(6):1456–74.CrossRefPubMed
38.
Zurück zum Zitat Zhong H, Takeda A, Nazari R, Shio H, Blobel G, Yaseen NR. Carrier-independent nuclear import of the transcription factor PU.1 via RanGTP-stimulated binding to Nup153. J Biol Chem. 2005;280(11):10675–82.CrossRefPubMed Zhong H, Takeda A, Nazari R, Shio H, Blobel G, Yaseen NR. Carrier-independent nuclear import of the transcription factor PU.1 via RanGTP-stimulated binding to Nup153. J Biol Chem. 2005;280(11):10675–82.CrossRefPubMed
39.
Zurück zum Zitat Larouche K, Bergeron MJ, Leclerc S, Guerin SL. Optimization of competitor poly(dI-dC).poly(dI-dC) levels is advised in DNA-protein interaction studies involving enriched nuclear proteins. Biotechniques. 1996;20(3):439–44.PubMed Larouche K, Bergeron MJ, Leclerc S, Guerin SL. Optimization of competitor poly(dI-dC).poly(dI-dC) levels is advised in DNA-protein interaction studies involving enriched nuclear proteins. Biotechniques. 1996;20(3):439–44.PubMed
40.
Zurück zum Zitat Bonfield TL, Raychaudhuri B, Malur A, Abraham S, Trapnell BC, Kavuru MS, Thomassen MJ. PU.1 regulation of human alveolar macrophage differentiation requires granulocyte-macrophage colony-stimulating factor. Am J Physiol Lung Cell Mol Physiol. 2003;285(5):L1132–6.CrossRefPubMed Bonfield TL, Raychaudhuri B, Malur A, Abraham S, Trapnell BC, Kavuru MS, Thomassen MJ. PU.1 regulation of human alveolar macrophage differentiation requires granulocyte-macrophage colony-stimulating factor. Am J Physiol Lung Cell Mol Physiol. 2003;285(5):L1132–6.CrossRefPubMed
41.
Zurück zum Zitat Brown GD. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat Rev Immunol. 2006;6(1):33–43.CrossRefPubMed Brown GD. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat Rev Immunol. 2006;6(1):33–43.CrossRefPubMed
Metadaten
Titel
PU.1 is involved in the immune response to Aspergillus fumigatus through upregulating Dectin-1 expression
verfasst von
Min Wang
Zhicheng Liu
Chenyang Liu
Ting Wu
Feng Cai
Quan Wang
Xin Su
Yi Shi
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2016
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-016-1632-x

Weitere Artikel der Ausgabe 1/2016

BMC Infectious Diseases 1/2016 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.