Background
Invasive aspergillosis (IA) is a life-threatening disease whose incidence is growing worldwide due to the increasing number of immunocompromised patients over the last decades [
1]. Despite therapeutic advances and better diagnostic tools and criteria, IA remains difficult to diagnose and treat, and the mortality associated with this condition remains high, ranging from 60 % to 90 % [
2].
Aspergillus fumigatus is a ubiquitous opportunistic fungal pathogen that accounts for more than 90 % of all cases of IA [
3].
The innate immune system serves as the first line of defense against fungal infection, as it is capable of recognizing and initiating an effective response to eliminate invading
A. fumigatus [
4]. However, there is limited knowledge of the regulation and detailed immune mechanism involved in the defense against
A. fumigatus infection. Therefore, further investigation of the mechanism would help develop effective immunoprophylaxis and to improve patient prognosis.
Pattern recognition receptors (PRRs) recognize pathogen-associated molecular patterns (PAMPs) expressed in the cell wall during fungal infection [
4,
5]. C-type lectin receptors (CLRs) are a large family of receptors that bind to carbohydrates in a calcium-dependent manner. They are expressed by several cell types such as macrophages and dendritic cells (DCs), which phagocytose various glycoproteins and microbes for clearance and antigen presentation to T lymphocytes. CLRs are widely recognized to mediate innate immune responses to fungi, with Dectin-1 being the best characterized receptor in the context of fungal infections [
5]. Dectin-1 initiates antifungal immunity by recognizing the β-glucan present in the cell walls of
A. fumigatus [
6,
7].
PU.1, a member of the E-twenty-six (ETS) family, is a transcription factor that is essential for the development of hematopoietic stem cells and regulation of the immune response [
8,
9]. In addition, PU.1 participates in regulating the expression of a variety of PRRs, including toll-like receptor (TLR)-4 [
10], TLR-9 [
11], mannose receptor (MR) [
12], a dendritic cell-specific C-type lectin (DC-SIGN) [
13], and Dectin-1 [
14,
15]. In a previous study, pneumocystis-infected mice exhibited reduced Dectin-1 and PU.1 expression levels decreases in alveolar macrophages (AMs) [
15]. However, another study incubated human bronchial epithelial cells (HBE) with
A. fumigatus and found that Dectin-1 was upregulated in these cells [
16]. Despite these studies, the role of PU.1 in regulating the transcription and expression of the hDectin-1 gene during
A. fumigatus infection remains unclear. Therefore, we investigated the role of PU.1 regulating Dectin-1 expression in THP-1 cells stimulated with
A. fumigatus. Additionally, we characterized the transcription factor-binding sites (TFBSs) in the hDectin-1 gene promoter, indicated the regulation of hDectin-1 gene via PU.1, and further determined changes in the expression of Dectin-1 following knockdown of PU.1.
Methods
Cells, reagents, and antibodies
THP-1 (human monocytic leukemia) cells were cultured in RPMI-1640 medium (Gibco; Invitrogen, Carlsbad) and human embryonic kidney (HEK)-293 T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco). These two cell lines were gifts from Prof. Xing (Laboratory of Immunology and Virology, Nanjing University, China) [
17]. Both the culture mediums were supplemented with 10 % fetal bovine serum (FBS; Hyclone, Thermo Scientific, Logan), and 1 % antibiotic-antimycotic solution (Gibco). The cells were cultured at 37 °C in an atmosphere containing 5 % CO
2. Polymerase chain reaction (PCR) primers were synthesized by GenScript (Nanjing, China), while probes for EMSA were synthesized by Viagene Biotech (Ningbo, China). All the primers and probes used in this study are listed in Table
1,
2 and
3. The following antibodies were used for Western blot analysis: rabbit anti-PU.1, rabbit anti-β-tubulin (Cell Signaling Technology, Danvers); goat anti-Dectin-1 (N-16, Santa Cruz Biotechnology, Santa Cruz); mouse anti-GAPDH, mouse anti-β-actin, and rabbit anti-Histone (Abmart, Shanghai, China). Other secondary antibodies were purchased from Cell Signaling Technology. Rabbit anti-PU.1 (H-135, Santa Cruz Biotechnology) and rabbit IgG (Upstate Biotechnology, Waltham) were used in ChIP. Antibodies for Alexa Fluor-488 donkey anti-rabbit IgG and Alexa Fluor-568 donkey anti-goat IgG were purchased from Life Technologies.
Table 1
Primer sequences for real-time PCR
hDectin-1-Forward | GCAATACCAGGATAGCTGTTG |
hDectin-1-Reverse | CCAAGCATAGGATTCCCAA |
hPU.1- Forward | CGTGCACAGCGAGTTCGA |
hPU.1-Reverse | GCTCTGGAGCTCCGTGAAGT |
GAPDH- Forward | ACAGTCAGCCGCATCTTCTT |
GAPDH-Reverse | ACGACCAAATCCGTTGACTC |
Table 2
Primer sequences for PCR of ChIP
hDectin-1-A- Forward | CTTTTCCTTAGCAAACTCCACT |
hDectin-1-A-Reverse | TCAGTAATACTATTGCAACAGGA |
hDectin-1-B- Forward | CCTTCCATAAGCTGTTCCTTGCA |
hDectin-1-B-Reverse | CAAGGAATCAAATCAAAGCTGACTC |
hDectin-1-C- Forward | GCCTACTATATAGACTTGGAAAAG |
hDectin-1-C-Reverse | CTTTGGGAATTATCAGATATTAACAC |
hDectin-1-D- Forward | AGCCGAGATCGTGCCATTTGCA |
hDectin-1-D-Reverse | TGCTTCTCAAAGGGCAGAGAAAGA |
hDectin-1-E- Forward | GAGTCAGCTTTGATTTGATTCCTTG |
hDectin-1-E-Reverse | ACTTTTCCAAGTCTATATAGTAGGC |
Table 3
Probe sequences for EMSA
Positive control | PU.1-TP CTGCCTCCTACTTCTCCTTTTCTGC PU.1-BM GCAGAAAAGGAGAAGTAGGTGGCAG | + | CD11b |
Probe A | probe1-TP TTACTTTTGGGGAAGTTGAGTTCAG probe1-BM CTGAACTCAACTTCCCCAAAAGTAA | + | Dectin-1 |
Probe B | probe1-BM CTGAACTCAACTTCCCCAAAAGTAA probe2-TP TGATGAAAGAGGCAGTGTAGCGTAA | + | Dectin-1 |
Probe C | probe3-TP GATTGAACAAGAAAATATGTACAAC probe3-BM GTTGTACATATTTTCTTGTTCAATC | + | Dectin-1 |
Competitor | Paired with each biotin-labeled probe | - | |
A. fumigatus strain and stimulation with conidia
A. fumigatus A1 was kindly provided by the Microbiological Laboratory of Jinling Hospital. After culture on Sabouraud dextrose agar plates for 7 days at 28 °C, conidia were harvested by washing the plates with sterile phosphate-buffered saline (PBS)-0.1 % (vol/vol) Tween 20 (PBST). The suspension was then gently filtered through a 40-μm cell strainer to separate conidia from mycelium. Then, the conidia were thoroughly washed, centrifuged, and resuspended in sterile PBST at concentrations ranging from 5.0 × 107 to 1.0 × 108 colony-forming units (CFU)/mL, and stored at 4 °C within 2 weeks for further experiments. The THP-1 cells were cultured in RPMI-1640 medium at a density of 1.0–1.5 × 106/mL, and stimulated with A. fumigatus conidia at a multiplicity of infection (MOI) of 1.
Quantitative real-time RT-PCR
The total RNA precipitated from the lysates of THP-1 cells stimulated with
A. fumigatus conidia and the lysates of unstimulated THP-1 cells were used for reverse transcription (RT) with a Primescript RT reagent kit (R036A; Takara, Tokyo). The mRNA expression levels were analyzed by real-time PCR, as described previously [
18]. The specificity of primers was confirmed by melting curve analysis. The relative expression values were standardized by an internal glyceraldehyde-3-phosphate dehydrogenase (
GAPDH) control. The fold changes of mRNA were calculated according to the formula 2
(ΔCT of gene – ΔCT of GAPDH), where
C
T
is the threshold cycle.
Western blot analysis
THP-1 cell lysates of the mock or A. fumigatus conidia-stimulated cells were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica), and then incubated with primary antibodies overnight. After washing the membranes, they were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 90 min at room temperature. Images were captured using Tanon Imaging System (Tanon, Shanghai, China). For the fractionation of lysates, stimulated or control cells were washed, and cytoplasmic and nuclear fractions were isolated using cytoplasmic/nuclear protein extraction kit (KeyGene Biotechnology, Nanjing, China). The fractions were processed as described above for immunoblot analysis.
Immunofluorescence microscopy
Stimulated and unstimulated THP-1 cells were washed twice with PBS at various time points, fixed with 4 % paraformaldehyde for 30 min, and permeabilized with 0.1 % Triton X-100 for 10 min, and then washed with PBS. After blocking with 5 % bovine serum albumin (BSA) in PBS for 60 min at 37 °C, the cells were incubated with both rabbit anti-PU.1 and goat anti-Dectin-1 antibodies (1:100 dilutions for both antibodies) at 4 °C overnight. The cells were washed with PBST, and then incubated with Alexa Fluor-488 donkey anti-rabbit IgG and Alexa Fluor-568 donkey anti-goat IgG (1:200 dilution for both antibodies) at 37 °C for 1 h. Then, the cells were washed and stained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI). After washing, the slides were carefully observed under a confocal microscope (Carl Zeiss Jena, Oberkochen).
Plasmid constructs and luciferase reporter assays
The 2.0-kb DNA fragment containing the Dectin-1 gene promoter was PCR amplified from human genomic DNA using the following primers: 5′-GCGGTACCGCAGATCGAGACCATTCTGGTTAACAC-3′ and 5′-GCAAGCTTGCGAAACTATGCTGTGGTAATTTT-3′. Plasmid pGL3-Decin-1 was constructed by cloning the amplified fragment into the firefly luciferase reporter vector pGL3 (Promega, Madison). The PU.1 expression plasmid pRK5-PU.1 was obtained by cloning human PU.1 cDNA into EcoRI-digested pRK5-HA (Promega) and a selection of plasmids with properly oriented inserts. HEK-293 T cells were seeded in 24-well plates in total DMEM until 50–70 % confluence was achieved. The cells were then transfected with pRK5-HA or with various amounts of pRK5-PU.1, along with pGL3-Dectin-1 or pGL3-basic, and pRL8-SV40 by using Lipofectamine 2000 (Invitrogen). The total amount of DNA was maintained at a constant level by adding empty control plasmid. At 24 h post-transfection, the cells were stimulated by 10 ng/mL of phorbol-12-myristate-13-acetate (PMA) for 12 h, and cell lysates were analyzed for the activities of firefly and Renilla luciferases (Promega) according to the manufacturer’s instructions.
Chromatin immunoprecipitation assays
ChIP assays were performed using EZ-ChIP™ kit (Upstate Biotechnology) according to the manufacturer’s instructions. In short, 1–1.5 × 10
7 THP-1 cells were stimulated by 10 ng/mL PMA for 2 h, cross-linked with 1 % formaldehyde, and lysed in SDS lysis buffer. The chromatin samples were sonicated at high power for 7 min (in cycles of 5-s pulses with 10-s pause) using a sonicator (Bioruptor™; Diagenode, Belgium). After preclearing with salmon sperm DNA/Protein A-agarose, the protein extracts were subjected immunoprecipitated with antibodies against PU.1 (H-135), RNA polymerase, and normal rabbit IgG. The resultant immune complexes were extensively washed, and the DNA was recovered by phenol:chloroform extraction and resuspended in 50-μL volume. PCR amplification was performed by using the primers listed in Table
2. The resultant PCR products were analyzed by 2 % agarose gel electrophoresis.
Electrophoretic mobility shift assays (EMSA)
THP-1 cells were plated on RPMI-1640 at a density of 1.0–1.5 × 10
7 in the presence of 10 ng/mL PMA, and collected after 2 h. Nuclear extracts from PMA-stimulated and control cells were prepared using nuclear protein extraction kit (KeyGene Biotechnology). The probes used for EMSA are listed in Table
3. Briefly, 3 μg of nuclear protein samples were incubated with 10× binding buffer, 1.0 μg/μL poly (dI-dC), and 0.5 μL biotin-labeled probes in an EMSA kit (Viagene Biotech). Where indicated, 0.83 μL or 3.33 μL of specific, cold-competitor probe in 10× or 100× competing buffer was added before the biotin-labeled probe. The incubation mixtures were separated by 6.5 % non-denaturing PAGE, and the bands were detected by autoradiography.
RNA interference experiments
PU.1-specific small interfering RNA (siRNA) or a nonspecific siRNA control (siCtrl) were chemically synthesized at GenePharma (Shanghai, China). The sequence of the PU.1 siRNA was as follows: 5′-UAUAGAUCCGUGUCAUAGGGCACCA-3′. A 5-μL of aliquot of 20 μM siRNA was introduced into 1 × 106 THP-1 cells by using Lipofectamine 2000, according to the manufacturer’s instructions. The transfected cells were incubated for 24 h, and the cells were harvested and subjected to real-time PCR and Western blot analyses to detect PU.1, Dectin-1, and the control cell populations.
Statistical analysis
A two-tailed Student’s paired t test was used to evaluate the data by SPSS software (IBM SPSS, Armonk, USA), and values of p < 0.05 were considered to be statistically significant.
Discussion
Dectin-1 is a member of the CLR family and is expressed on the surface of many cells [
28]. Its involvement in the immune defense against
A. fumigatus has been widely confirmed [
29]. In our previous study,
A. fumigatus was shown to induce the upregulation of Dectin-1 in HBE cells in a TLR2-dependent manner [
16]. In the present study, we found that Dectin-1 mRNA and protein expression levels were increased in THP-1 cells stimulated with
A. fumigatus conidia.
PU.1 belongs to the ETS family and has a great impact on the immunity, primarily through its control of immune cell development [
30]. As PU.1 has been the focus of increasing attention for its role in inflammation and infection [
31‐
33], we evaluated PU.1 expression at the mRNA and protein levels in THP-1 monocyte cells exposed to
A. fumigatus conidia. The results of the present study demonstrated for the first time that the PU.1 protein expression was increased in THP-1 cells incubated with
A. fumigatus conidia compared to the control cells, while the mRNA level showed no significant differences between the exposed and control cells.
In our study, the PU.1 mRNA level was not correlated with its protein level. Similar to our finding, a previous study reported that the PU.1 mRNA level in preadipocytes was high, while the PU.1 protein is not expressed in these cells [
34]. Regulation of gene expression is a complicated and meticulous process, and it is controlled at multiple levels, including transcriptional, post-transcriptional, translational, and post- translational levels [
35]. MicroRNAs are a large class of small, noncoding RNAs in plants and animals, and have been known to mediate post-transcriptional regulation [
36]. PU.1 is a direct target for miR-155 and the target sequence for miR-155 is localized in the 3′-untranslated region (UTR) of PU.1. Also, miR-155 overexpression in THP-1 cells has been found to decrease the PU.1 protein level [
13]. Further studies are required to investigate the precise mechanisms responsible for the different patterns of PU.1 mRNA and protein expression during stimulation with
A. fumigatus.
In our study, PU.1 protein was localized in the cytoplasm of unstimulated THP-1 cells, and translocated into the nucleus following exposure to
A. fumigatus conidia. To the best of our knowledge, this is the first study to illustrate the translocation of PU.1 stimulated by
A. fumigatus conidia. Previously, in HeLa and RAW264.7 macrophage cell models, PU.1 has been shown to enter the nucleus via passive diffusion and active transport. The latter can be facilitated by: (i) the classical pathway requiring importin α and β, (ii) the non-classical pathway requiring only importin β, or (iii) direct interaction with nucleoporins [
37,
38]. However, to date, little is known regarding the mechanisms of PU.1 nuclear transport during
A. fumigatus stimulation. Thus, future studies are necessary to investigate the mechanisms by which
A. fumigatus drives the transport of PU.1 from the cytoplasm to the nucleus.
The regulation of Dectin-1 expression has not been extensively studied to date; however, downregulation of PU.1 is known to result in decreased Dectin-1 expression in AMs in
Pneumocystis-infected mice [
15]. In another study, BLT1 was found to modulate the transcription of Dectin-1 via a GM-CSF/PU.1 cascade [
14]. However, the role of PU.1 in regulating the transcription and expression of hDectin-1 gene during
A. fumigatus stimulation in THP-1 cells remains unknown. In our study, the results of the luciferase reporter assay showed that PU.1 promoted hDectin-1 gene activity in a dose-dependent manner. Additionally, five potential TFBSs for PU.1 were predicted by using the TFBS databases. Moreover, the ChIP assay in our study indicated that PU.1 could bind to the hDectin-1 gene promoter at the –1053 to –1047, –719 to –713, and –527 to –521 regions. The synthetic polymer poly(dI-dC) is considered to be one of the most potent, and likely the most widely used, nonspecific competitor in EMSA. Its addition to the reaction mixture before addition of crude nuclear proteins has been proven to be an efficient way of reducing any nonspecific interactions by facilitating detection of the complexes of interest [
39]. Therefore, we used poly(dI-dC) in the EMSA analysis in this study. Further EMSA results confirmed that PU.1 could bind to the abovementioned three regions of the hDectin-1 gene promoter. Based on the results of our study and those of previous reports, we suggest that PU.1 can bind to the hDectin-1 gene promoter.
To confirm that PU.1 regulates the expression of the hDectin-1 gene, we knocked down the expression of PU.1 in THP-1 cells using siRNA. Although Dectin-1 expression has been reported to be controlled by PU.1 [
15] and leukotriene B4 via a GM-CSF/PU.1 axis [
14] in mouse models, our results are the first to demonstrate that silencing the expression of PU.1 could significantly decrease the hDectin-1 gene mRNA and protein expression levels in THP-1 cells. Lack of PU.1 expression is known to contribute to decreased maturation, differentiation, and surfactant metabolism in AMs of patients with pulmonary alveolar proteinosis [
40]. In addition, PU.1 knockdown in macrophages has shown to decrease phagocytic activity [
15]. However, further studies are warranted to examine how knockdown or overexpression of PU.1 can affect the innate immune and inflammatory responses to
A. fumigatus infection and the precise mechanisms underlying this process.
Abbreviations
BSA, Bovine serum albumin; ChIP, Chromatin immunoprecipitation; CLR, C-type lectin receptor; DAPI, 4′,6-Diamidino-2-phenylindole; DMEM, Dulbecco’s modified Eagle’s medium; EMSA, Electrophoretic mobility shift assays; ETS, E-twenty-six; FBS, Fetal bovine serum; HBE, Human bronchial epithelial; IA, Invasive aspergillosis; MOI, Multiplicity of infection; NSB, Nonspecific binding; PAGE, Polyacrylamide gel electrophoresis; PAMP, Pathogen-associated molecular pattern; PBS, Phosphate-buffered saline; PBST, Phosphate-buffered saline (PBS)-0.1 % (vol/vol) Tween 20; PCR, Polymerase chain reaction; PMA:Phorbol-12-myristate-13-acetate; PRR, Pattern recognition receptor; PVDF, Polyvinylidene difluoride; RT, Reverse transcription; SDS, Sodium dodecyl sulfate; TFBS, Transcription factor-binding site; UTR, Untranslated region