Background
Nasopharyngeal carcinoma (NPC) poses one of the serious health problems in Southern China, including Hong Kong. It is the fifth commonest cause of cancer deaths in our male population and affects a younger age population (< 45 years old) than most of other cancers. The annual incidence rate in Hong Kong is 29.8/100,000 (Hong Kong Cancer Registry 2007;
http://www3.ha.org.hk/cancereg/e_stat.asp), in great contrast to those among Caucasians in other countries (< 1/100,000) [
1]. The reason of the peculiar geographic distribution remains unclear. The environmental factors and the strong association with Epstein-Barr virus (EBV) have been implicated [
1]. Understanding of the molecular basis of this cancer is essential to derive effective markers for early diagnosis and targeted therapies.
Human disabled-2 (
DAB2) encodes a 96 kDa mitogen responsive phosphoprotein that is one of the two mammalian orthologues of the drosophila disabled protein. It contains a proline-rich, SH3-binding domain (PRD) in its C-terminus, and a phosphotyrosine-binding (PTB)/-interacting domain (PID) in its N-terminus. The C-terminal PRD interacts with Grb2 by interrupting the binding of Grb2 and SOS, potentially suppressing the mitogenic signalling via Ras pathway [
2,
3]. It also binds clathrin, the clathrin-adaptor protein AP2 and myosin VI, facilitating clathrin-coated pit assembly and receptor-mediated endocytosis [
4,
5]. The endocytic and vesicular trafficking function of DAB2 are postulated to mediate its effects on cellular signalling. The conserved N-terminal PTB of DAB2 binds to members of the low-density lipoprotein receptor family [
5] and transforming growth factor-β (TGF-β) type I and II receptors [
6], as well as with the Ras GAP DIP1/2 [
7]. The association of DAB2 with multiple signalling proteins and the lack of intrinsic catalytic enzyme activity suggest that it is an adaptor molecule involved in multiple receptor-mediated signalling pathways that plays a pivotal role in the cellular homeostasis.
DAB2 is a putative tumour suppressor and plays an important regulatory role in cellular differentiation. Induction of differentiation in the absence of DAB2 expression commits the cell to apoptosis [
8]. Recently it is reported that DAB2 functions as a negative regulator of canonical Wnt signalling by stabilized beta-catenin degradation complex [
9]. Decreased expression of DAB2 has been demonstrated in several cancers including ovarian, breast, prostate, oesophagus, urinary bladder, colon and choriocarcinoma [
10‐
17]. Ectopic expression of DAB2 reduced in vitro tumour growth in ovarian, prostatic and choriocarcinoma cell lines [
13,
18,
19] and significantly reduced the ability to form tumours in nude mice when stably expressed in ovarian cancer cells [
10]. The involvement of DAB2 in nasopharyngeal carcinoma (NPC) has not been addressed before. We found that
DAB2 transcript was absent or significantly down-regulated in NPC xenografts and cell lines comparing to immortalized normal nasopharyngeal epithelial cell lines. The protein expression in primary NPC was also significantly reduced. The differential expression patterns pointed to a possible tumour suppressor role of DAB2 in NPC. In the current study, we aimed to investigate the functional role of DAB2 in NPC carcinogenesis, and to delineate the mechanisms leading to the down-regulation of DAB2.
Methods
Cell lines, xenografts, and primary NPC tissues
NPC cell lines (C666-1, HK1 and HONE1), xenografts (X2117, X666, C15, C17, X1915) were maintained as described previously [
20]. An SV40 large T oncogene immortalized normal nasopharyngeal epithelial cell line NP69 was also included in this study [
21]. The NPC cell line C666-1 and all the NPC xenografts harbour EBV, whereas HK1, HONE1 and NP69 cells are EBV-negative. Forty-six formalin-fixed paraffin-embedded primary NPC biopsy samples were retrieved from tissue bank of the Department of Anatomical and Cellular Pathology at Prince of Wales Hospital, Hong Kong. All specimens were taken before treatment and were histologically evaluated to be EBV-positive undifferentiated carcinomas as demonstrated by EBER in situ hybridization. The male to female ratio of the patients was 3.1:1. The age of the patients ranged from 16 to 84 years with the median age of 48. Based on UICC staging classification, 5 patients had Stage I disease (11%), 14 patients had Stage II (30%), 10 patients had Stage III (22%), 17 patients had Stage IV disease (37%). The median follow-up time was 57.8 months (range 13.8-95.5 months). The study protocol was approved by the Joint CUHK-NTE Clinical Research Ethics Committee, Hong Kong.
5-Aza-2'-deoxycytidine (5-aza) and Trichostatin A (TSA) treatment
NPC cell line C666-1 was treated with 1, 5, 10, 15 μM of 5-Aza-2'-deoxycytidine (Sigma, St. Louis, MO) for 3 days. Culture medium with fresh 5-aza was replenished every 24 hours. For TSA treatment, cells were incubated with 50, 100 and 200 ng/ml TSA (Sigma) for 24 hours. Synergistic effect of 5-aza and TSA was tested by treating cells with 5 μM of 5-aza for 3 days followed by 100 ng/ml of TSA for 24 hours.
Immunohistochemistry
Immunohistochemistry was performed on the Ventana Nex ES automated stainer (Ventana Corporation, Tucson, AZ) using anti-DAB2 antibody (1:50, Santa Cruz Biotechnology, Santa Cruz, CA). The cytoplasmic expression of DAB2 was assessed by assigning a proportion score and an intensity score. The proportion score was according to proportion of tumour cells with positive cytoplasmic staining (0, none; 1, < = 10%; 2, 10 to < = 25%; 3, > 25 to 50%; 4, > 50%). The intensity score was assigned for the average intensity of positive tumour cells (0, none; 1, weak; 2, intermediate; 3, strong). The cytoplasmic score of DAB2 was the product of proportion and intensity scores, ranging from 0 to 12. The cytoplasmic expression was categorized into low (score 0 to 3), intermediate (score 4-6), and high (score 7-12). The scoring was independently assessed by two pathologists (K.F.T. and A.W.C.)
Bisulfite sequencing and methylation specific PCR (MSP)
Bisulfite sequencing and MSP has been described previously [
22,
23]. A total of 47 CpG sites spanning approximately 800-bp on the 5'CpG island of
DAB2 gene were analyzed by bisulfite sequencing (Additional file
1 Figure S1). This region covered the critical transcriptional regulatory domains sufficient for DAB2 expression in epithelial cells [
24,
25]. The PCR Primers are listed in Table
1.
Table 1
PCR primers used for bisulfite sequencing and methylation specific PCR
Bisulfite sequencing | | |
Region1 Forward | 5'-TAGTTTTTTGTTTAAAGGGTTTTAACGGGT-3' | 365 bp |
Region1 Reverse | 5'- ACCTAAACTTAATAACTCCCCCTCA -3' | |
Region2 Forward | 5'- ATTTTGGTATATTTTTGGGGAGTTT-3' | 360 bp |
Region2 Reverse | 5'- CCCAAACACAAAATCTCATTTCTA -3' | |
Methylation specific PCR | | |
Methylated Forward | 5'-ATTTTTCGTCGGGAGTGGTC-3' | 79 bp |
Methylated Reverse | 5'-GCAACGAATACGACGAACCT-3' | |
Unmethylated Forward | 5'-GGGAGTGGTTGTGTGGTTTT-3' | 103 bp |
Unmethylated Reverse | 5'-AACTTGGGGACACCCAAA-3' | |
Restoration of DAB2 expression in C666-1 cells
Full length DAB2 was amplified from TrueORF cDNA clone (Origene, Rockville, MD) and inserted into pcDNA3.1(+) (Invitrogen) to produce DAB2 expression vector. pcDNA3.1(+)/DAB2 were transfected into C666-1 cells using FuGENE HD (Roche, Mannheim, Germany). Restoration of DAB2 expression was confirmed by western blot analysis using DAB2 antibody (1:4000, Santa Cruz Biotechnology, Santa Cruz, CA, USA).
Flow cytometric analysis
Cells transfected with pcDNA3.1(+) or pcDNA3.1(+)/
DAB2 were subjected to flow cytometric analysis as described previously [
22].
Cell proliferation and monolayer colony formation assay
Cell proliferation of DAB2 transfected C666-1 cells was assessed using CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT) (Promega, Madison, WI) according to the manufacturer's instructions. For monolayer colony formation assay, C666-1 cells were culture overnight in 60 mm plates and transfected with pcDNA3.1(+)/DAB2 or empty vector. Forty-eight hours later the transfectants were re-plated in triplicate and cultured for 21 days in selection medium containing G418 (500 μg/ml). Surviving colonies were stained with Gentian violet after methanol fixation and counted. The experiments were repeated in triplicate.
Microarray analysis
Gene expression analysis of C666-1 transiently transfected with pcDNA3.1(+)/
DAB2 for 24 hours as compared with cells transfected with empty vectors as controls were subjected to microarray analysis using 4 × 44 K Whole Human Genome Oligo Microarray system (Agilent Technologies, Santa Clara, CA). The experiment was done in duplicate. Microarray slides were scanned using Agilent G2505C microarray scanner (Agilent). The images were quantified with Feature Extraction Software (Agilent Technologies). The raw data were quantile normalized by robust multiarray average (RMA) algorithm and analyzed in Partek Genomics Suite 6.4 (Partek, St. Charles, MO). Differential gene expression was evaluated using one-way ANOVA. A fold-change cut-off of 1.5 and p < 0.01 was set to identify differentially expressed genes. The Ingenuity Pathways Analysis (IPA, Ingenuity
® Systems,
http://www.ingenuity.com) was utilized to identify network of interacting genes and the biological functions that were most significant to the data set. Fisher's exact test was used to calculate a p-value determining the probability that each biological function assigned to that data set is due to chance alone. A p-value of less than 0.01 was considered significant.
Quantitative real-time PCR (QRT-PCR)
QRT-PCR was performed using premixed primers and probes from TaqMan
® Gene Expression Assays (Appliedbiosystems, Foster city, CA) and run on ABI 7500 real time fast PCR system (Appliedbiosystems). All reactions were done in triplicate. The relative expression level was normalized with beta-actin and calculated using the 2^(-Delta Delta Ct) method [
26].
Western blot analysis
MAP kinase pathways were studied by western blotting according to standard procedures as described previously [
22,
23]. Anti-ERK1/2, anti-phospho-ERK1/2 and anti-c-Fos antibodies came from Cell Signalling Technology, Inc. (Beverly, MA). Anti-GAPDH (Calbiochem, La Jolla, CA) was used as a loading control.
Statistical Analysis
Mann-Whitney U test was used to compare the data and p value < 0.05 was considered as statistically significant. Statistical analyses were performed using SPSS 16.0 software (SPSS Inc., Chicago, IL, USA).
Discussion
Although decrease or absent of DAB2 has been reported in several cancer types, the status in NPC has not been explored. In this study, we screened NPC cell lines and xenografts for DAB2 expression level and observed a significant down-regulation of DAB2 transcript level in NPC cells comparing to immortalized normal nasopharyngeal epithelial cells. We further examined the DAB2 protein expression level in primary NPC biopsy samples using immunohistochemistry. DAB2 expression was retained in normal nasopharyngeal epithelium. However, complete loss of DAB2 expression was seen in 72% of primary NPC. The frequent down-regulation of DAB2 in NPC implied that it might be a tumour suppressor gene involved in NPC pathogenesis.
Several genetic and epigenetic processes contribute to the silencing of tumour suppressor genes, including loss of genetic materials, mutation, promoter methylation, histone acetylation and post-transcriptional regulation by micro RNAs, etc. Loss of heterozygosity and deletion of chromosome 5p13, where
DAB2 is located, is uncommon in NPC according to our previous studies [
29‐
31]. Since
DAB2 down-regulation was observed in transcription level, post-transcriptional regulation by micro RNAs is unlikely. In colorectal and gastric cancer cell lines, GATA4 and GATA5 genes and their target genes including
DAB2 promoter were found to be hypermethylated, suggesting epigenetic silencing may be responsible for loss of DAB2 protein expression in these cell lines [
32]. Zhou et al reported that the transcription regulation of
DAB2 is mediated through histone acetylation and by specific transcription factors such as GATA6 but not by DNA methylation in urothelial carcinoma [
16,
19]. They found a critical regulatory region on
DAB2 promoter (-295 and -120-bp upstream from exon 1) that contains the major GATA6
cis elements. We sequenced the promoter region of
DAB2 gene spanning the critical regulatory domains described by Zhou et al and no mutation was found in NPC cell lines and xenografts [Genbank: HM135031 to HM135036], suggesting mechanisms other than mutation on transcription factor binding sites should contribute to the down-regulation of
DAB2.
Previous studies suggested that DNA methylation in the promoter region of
DAB2 is infrequent in esophageal and breast cancers [
11,
15]. In contrast to these studies, we found that promoter methylation of
DAB2 is observed in 65.2% (30/46) of primary NPC. Methylation status on the promoter region was associated with the expression level of
DAB2 in NPC cell lines and xenografts. Treatment with demethylation agent 5-aza-2'-deoxycytidine restored the
DAB2 expression in NPC cell line in a dose-dependent manner. The results strongly suggested that promoter methylation is one of the frequent epigenetic mechanisms contributed to the inactivation of
DAB2 in NPC.
One of the unique features of NPC in our locality is that the majority of NPC is undifferentiated carcinoma and consistently associated with Epstein Barr virus (EBV). In our previous studies, we have demonstrated the frequent hypermethylation of multiple genes in NPC including RASSF1A, RARβ, DAP-kinase, p15, p16, TSLC1, DLEC1,
etc. [
33‐
36]. The alterations are accompanied by methylation of EBV genome, suggesting a process of virus-associated hypermethylation in cancer development. EBV-associated gastric cancer showed global CpG island methylation on promoter region of various cancer-related gene and demonstrated methylation phenotype [
37]. The mechanisms by which EBV infection promotes DNA methylation are largely unknown. Recent studies suggested that EBV latent membrane protein 1 (LMP1) activates cellular DNA methyltransferases, and therefore down-regulates the expression of critical host genes using cellular DNA methylation machinery [
38].
The high frequency of epigenetic inactivation of
DAB2 in NPC has led to the hypothesis that
DAB2 might be a tumour suppressor gene in this cancer. In keeping with this hypothesis, we demonstrated that exogenous expression of DAB2 suppressed NPC tumour growth in vitro as demonstrated by cell proliferation assay, and reduced the anchorage-dependent colony formation. Previously, DAB2 has been found to exert the tumour suppressor effect by uncoupling MAP kinase activation and c-Fos expression [
28]. In keeping with this finding, our results showed that serum-induced c-Fos expression was greatly reduced in DAB2-expressing NPC cells compared to vector-transfected controls, whereas the activity of MAP kinase did not changed. DAB2 might restrict the nuclear entry of MAP kinase by mediating the trafficking of cargos containing importins away from nuclear pore, thus preventing the activation of c-Fos by MAP kinase in nucleus [
39].
To further explore the functional role of DAB2 in NPC carcinogenesis, we compared the expression profile of DAB2 expressing-C666-1 cells and the vector control-transfectants. Functional network analysis of differentially expressed genes revealed that the networks involved were centred on signalling proteins NFκB, AKT, TGFbeta, and ERK, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways.
Recent studies demonstrated that DAB2 interacts with Axin and contributes to the maintenance of the differentiated state and restrain Wnt-mediated proliferation [
40]. Over expression of DAB2 inhibits Wnt-3A-induced accumulation of beta-catenin, decreased Dishevelled-3 (Dvl-3)/Axin interactions and maintains Axin/beta-catenin/GSK3 interactions, and attenuates Wnt/beta-catenin-mediated signalling. In this study, pathways analysis of the microarray data confirmed the involvement of DAB2 in Wnt/beta-catenin signalling pathway. Attenuation of canonical Wnt/beta-catenin signalling was observed in C666-1 cells expressing DAB2 (Additional file
1 Figure S2). Although the role of the Wnt pathway in NPC has not been fully explored, there is abundant evidence that aberrant Wnt signalling plays a role in NPC development [
41]. Delineation of the regulatory role of DAB2 might provide insight into the molecular mechanisms of NPC development.
The mitotic role of Polo-like kinase is the top-scored canonical pathway identified in DAB2 expressing C666-1 cells. Polo-like kinases play critical roles during multiple stages of cell cycle progression, starting from control of the G2/M transition through phosphorylation of CDC25C and mitotic cyclins and a role in the DNA damage checkpoint adaptation to prevent entry into mitosis [
42]. DAB2 is phosphorylated by CDC2 during mitosis phase, which promotes the binding of DAB2 to the peptidylprolyl isomerase Pin1 [
43]. The interaction between DAB2 and Pin1 facilitates DAB2 dephosphorylation. However, little is known about the role of DAB2 in mitotic control. The observation that the mitotic role of Polo-like kinase pathway is down-regulated in DAB2 expressing C666-1 cells is of interest. DAB2 might exert its growth inhibitory effect through the regulation of mitosis. The exact role of DAB2 in mitotic control remains to be elucidated.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
DN, LC, KS carried out the molecular studies. PL performed the immunohistochemistry. RL was responsible for the quality control of data and algorithms. TL, MC and AC carried out the microarray analysis and statistical analysis. JT conceived of the study, and participated in its design and draft the manuscript. KL and KT participated in the design of the study, data analysis and interpretation, and manuscript review. All authors read and approved the final manuscript.