Background
Aging is an inevitable physiological process in the body, characterized by a time-dependent decline in physiological functions of the major systems. Oxidative stress is one of the most important reasons for aging because of the accumulation of daily metabolic wastes [
1,
2]. Oxidative stress reactions are induced when the generation of free radicals, including reactive oxygen species (ROS), exceeds the scavenging ability of the body. Decreased activity of oxidative stress-related enzymes, including superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), and glutathione-S-transferase (GST), has been found in various tissues in animal models of aging [
1].
Quercetin, a bioflavonoid widely found in many fruits, vegetables, and leaves [
3], is well known for its pharmacological effects against various diseases, such as cancer, inflammation, thrombosis and hypertension [
4‐
7]. In some pathological conditions, quercetin has a strong scavenging effect on free radical production by increasing the activities of GSH, SOD, CAT, GSH-PX and glutathione reductase [
8,
9].
Ovary is the organ that is the most sensitive to aging. The aging of the ovary is primarily characterized by decreases in the number of follicles and in oocyte quality [
10]. Menopause is the most important sign of aging in women. After menopause, with the decline in ovarian function, the antioxidant capacity of the ovary may be reduced. Studies show that excessive ovarian ROS production in menopausal women can damage the normal structure and function of cells by disrupting the lipid, fatty acid and protein composition of cells [
10]. Okatani et al. reported that the SOD and GSH-PX enzyme activities in the ovaries of postmenopausal women are significantly lower than those in premenopausal women [
11].
Recently, some studies have reported the role of quercetin on ovarian functions in different animal models. Naseer et al. found that quercetin supplementation significantly improves the follicular development, minimize granulosa cells apoptosis in heat stress rabbits [
12]. Another study, by Victor et al., found that quercetin treatment exerts preventive effects on cadmium chloride (CdCl
2) - induced toxicity in the uterus and ovaries of Wistar rats by its antioxidant and anti-apoptotic actions [
13]. Some in vitro studies also found the possible role of quercetin on ovarian cells. Two groups have reported that quercetin contributes potentially to prevent T-2 toxin or cadmium induced oxidative damage and apoptosis in cultured granulosa cells from porcine or chicken ovarian follicles [
14,
15]. Although Chen et al. found that quercetin has positive effects by affecting the ovarian follicular reserve in aging rats [
16], the effect mechanism of quercetin on ovarian aging has not been elucidated.
In this study, female menopausal rats and primary cultured ovarian granulosa cells were used to investigate whether quercetin could protect ovarian function and whether the mechanism of action was related to its antioxidant effects.
Methods
Animals and experimental groups
Menopausal female Sprague-Dawley (SD) rats (12 months old and weighing 348 ± 40.05 g) were obtained from the animal experiment center of Harbin Medical University. The Institutional Animal Care and Use Committee (IACUC) of Harbin Medical University approved all experiments. Twenty-eight rats were randomly divided into 4 groups of 7 rats each: control (1% methylcellulose dissolved in normal saline), low-dose quercetin (QL, 12.5 mg/kg), middle-dose quercetin (QM, 25 mg/kg) and high-dose quercetin (QH, 50 mg/kg). Control solution and quercetin (dissolved in control solution) were administered intragastrically to rats for 90 days.
Estrous cycle determination by vaginal smearing
To assess the stages of the estrous cycle in the rats, vaginal smears were examined daily for 15 days before and after treatments. The vaginal smears were stained using 0.04% trypan blue, and the cytological characteristics were examined using bright-field microscopy.
Primary ovarian granulosa cell culture
Immature female SD rats (21 days old) were subcutaneously injected with pregnant mare serum gonadotropin (PMSG)50 IU and were sacrificed 48 h later. Removed ovaries were immediately washed with phosphate-buffered saline (PBS) and placed in DMEM/F12 medium. Granulosa cells were harvested in the medium by needle puncture of ovarian follicles under a dissecting microscope and then purified by filtration with a 200-μm stainless steel mesh. After the centrifugation at 1000×g for 5 min, the cells were resuspended in medium and counted in a hemocytometer. The cells were seeded in 96-well plates (1 × 105 cells/well) or in 6-well plates (1 × 107 cells/well) and cultured in DMEM/F12 medium supplemented with 15% FBS, testosterone (10− 7 M), 100 U/mL penicillin and 100 mg/mL streptomycin at 37 °C and 5% CO2 for 48 h to allow the cells to attach. The cells were randomly divided into five groups – control, H2O2 (400 μM), and H2O2 plus three concentrations of quercetin (5 μM, 20 μM, and 50 μM) – and cultured for 6 h. At the end of the experiment, estradiol (E2) production in the culture medium was determined by radioimmunoassay, and total cellular proteins were extracted and used to determine protein expression by Western blot.
Cell viability determination
Cellular viability was measured via the CCK-8 assay. At the end of culture, cells in 96-well plates were incubated in 200 μL DMEM/F12 supplemented with 20 μL of CCK-8 reagent for 3 h at 37 °C in a 5% CO2 incubator. The optical density (OD) value of each well was measured at a wavelength of 450 nm using a microplate reader. The relative cellular viability = the OD value of the test group well / the mean OD value of the control group. Each group was established in five wells, and each measurement was repeated at least 2 times.
Hormone detection by radioimmunoassay
The levels of estradiol (E2), progesterone (P), follicle stimulating hormone (FSH) and luteinizing hormone (LH) were detected using commercial radioimmunoassay kits (Sino-UK Institute of Biological Technology, Beijing, China).
Measurement of antioxidant indices
The serum activities of antioxidant indices (T-AOC, SOD, GSH, GSH-PX, and GST) were measured using commercial biochemical kits (Sino-UK Institute of Biological Technology, Beijing, China) according to the manufacturer’s instructions.
Quantitative real-time PCR
The mRNA expression of SOD-1, CAT and GSS in the ovaries was assessed using real-time PCR. Briefly, total RNA was extracted from ovaries using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from 2 μg of total RNA using a PrimeScript 1st Strand cDNA Synthesis Kit (Takara Bio Inc., Dalian, China) following the supplier’s instructions. Real-time PCR was performed in 20 μL mixtures using an SYBR Premix Ex Taq™ II Kit (Takara Bio Inc., Dalian, China) and containing 1 μL of cDNA template, 0.5 μM forward and reverse primers (for characteristics of primers and real-time RT-PCR conditions, please see Table
1), and 10 μL of SYBR Premix Ex Taq™ II. The mRNA expression levels of genes were normalized to the level of β-actin mRNA expression. The data were evaluated by the ΔΔCt method using an Applied Biosystems 7500 Real-Time PCR System.
Table 1
Characteristics of Primers and Real-Time PCR Conditions
SOD-1 | AGGGCGTCATTCACTTCGAG | CCTCTCTTCATCCGCTGGAC | |
CAT | TTTTCACCGACGAGATGGCA | CTGACTCTCCAGCGACTGTG | |
GSS | GAGTTTGAGCTTGGCGAGCAG | ATGGGGCATACGTCACCAC | |
β-actin | CACCCGCGAGTACAACCTTC | CCCATACCCACCATCACACC | NM_031144 |
Western blot analysis
The protein expression levels of SOD-1, CAT and GSS were assessed via Western blot analysis. Briefly, total protein (20 μg) was separated by 10% SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane with a Trans-Blot SD semidry transfer cell (Bio-Rad Laboratories, Richmond, Calif.). The membranes were blocked with 5% skim milk powder dissolved in Tris-buffered saline containing 0.1% Tween 20. The membranes were then incubated with SOD-1/CAT/GSS rabbit polyclonal antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4 °C and then with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 h at room temperature. The protein bands were visualized using Pierce ECL Western Blotting Substrate (Engreen Biosystem, Beijing, China). The relative density of bands was assessed by densitometry using ImageJ software (
http://rsbweb.nih.gov/ij/download.html).
Hematoxylin and eosin (HE) staining
The ovaries were isolated and fixed in 4% buffered formaldehyde in 0.1 M phosphate buffer for 48 h and then were processed for paraffin embedding and sectioning. Serial sections of 5 μm thickness were cut with a Leica RM 2016 rotator microtome. The sections were dewaxed with xylene, rehydrated with graded concentrations of ethanol and then stained with hematoxylin and eosin and evaluated via light microscopy.
Immunohistochemistry
Paraffin sections of rat ovary were dewaxed with xylene and rehydrated by graded concentrations of ethanol. After gradual hydration, the slides were incubated in citrate buffer (pH 6.0) at 95 °C for 20 min and then cooled for 1 h at room temperature. The sections were treated with 0.3% H2O2 for 10 min in a dark room to inhibit endogenous peroxidase activity. After blocking nonspecific reactions for 30 min, the sections were then incubated with SOD-1/CAT/GSS rabbit polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4 °C for 12 h. Then, the slides were incubated with the second antibody at 37 °C for 1 h and counterstained with DAB and hematoxylin.
Statistical analyses
The data are expressed as the mean ± standard deviation. Differences among the means were evaluated by one-way ANOVA using the SPSS 13.0 statistical software package (SPSS, Inc., Chicago, IL, USA). P < 0.05 was considered to indicate a statistically significant difference.
Discussion
In this study, we found that quercetin increased the antioxidant capacity of the ovary by upregulating expression of some oxidative stress-related genes both in vivo and in vitro.
The estrous cycle in female menopausal rats was determined before and after administration of quercetin. We found that most rats (28/30) had entered menopause with an irregular or prolonged estrous cycle. After administration of quercetin, no periodic change in the estrous cycle was observed in the quercetin groups compared with the control group. Consistent with the results of our study, a previous study showed no significant effect on the estrous cycle in early senescent rats (11 months old) after the administration of quercetin (50 mg/kg) for 4 months [
16]. Other studies also find that estrous cycles become irregular or prolonged when rats begin menopause [
18,
19]. Therefore, we speculate that quercetin has no significant effect on maintaining or reversing the estrous cycle of menopausal rats.
HE staining results showed that the ovaries of menopausal rats demonstrated obvious aging characteristics, including the exhaustion of the resting follicle reserve and a marked increase in the proportion of ovarian stroma. Additionally, we found that quercetin had no obvious effect on the morphology of the ovary in menopausal rats. This result is consistent with the results of Chen et al., who found that the numbers of healthy follicles and atretic follicles in quercetin-treated rats were not significantly different from those in the control group [
16]. Combined with the results that quercetin had no effect on the weights of the ovary in menopausal rats, these data confirmed the conclusion that quercetin has no significant effect on the follicular reserve in menopausal rats.
At menopause, estrogen levels decline, whereas pituitary LH and FSH levels increase [
20]. Kellis et al. reported that quercetin inhibits the aromatization of androstenedione to estrone and of testosterone to estradiol in human placental and ovarian microsomes [
21]. However, Victor et al. found that quercetin increased protection against cadmium chloride (CdCl
2)-induced imbalances in reproductive hormones (E
2, P, FSH and LH) [
13]. Our experimental results showed that the levels of E
2, P, FSH, and LH in menopausal rats treated with quercetin were not significantly different from those of the control group. Although this result is inconsistent with the results of Victor et al., a possible reason might be the use of different animal models.
Oxidative stress is one of the primary causes of aging [
22,
23]. Therefore, in this study, we first detected the serum levels of several antioxidant indices (T-AOC, SOD, GSH, GSH-PX, and GST), and the results showed no significant differences between the quercetin groups and control group. To investigate whether quercetin had an antioxidant effect on aging in the rat ovary, we further examined the expression of mRNA and proteins for the oxidative stress-related genes SOD-1, CAT, and GSS in the ovary. Compared with the control group, mRNA and protein expression levels of these oxidative stress-related genes were upregulated after treatment with low-dose quercetin. A recent report found that quercetin significantly increases the activity and level of SOD, CAT, GSH and GSH-PX in docetaxel-induced testicular damage [
24], which is consistent with our findings. Of note, the administration of high-dose quercetin decreased the mRNA and protein expression levels of SOD-1, GSS and CAT in menopausal rats. We hypothesize that within a given dose range, quercetin could increase the antioxidant capacity and protect the body against the damage of free radicals; however, when the dose is too high, its antioxidant activity may be counteracted by other toxic or side effects of the drug.
To further confirm the in vivo result, primary ovarian granulosa cells were cultured in the present or absence of H
2O
2 (400 μM) and three concentrations of quercetin (5 μM, 20 μM, and 50 μM). We found that quercetin could rescue the H
2O
2-induced cell damage and ameliorate the H
2O
2-induced decreases in expression of oxidative stress-related proteins, indicating that the protective effect of quercetin on cultured ovarian granulosa cells may be related to the upregulation of expression of oxidative stress-related proteins. Recently, Gao reported that quercetin has a protective effect on hypoxia-induced damage to primary cultured retinal ganglion cells [
25]. Another study showed the protective effects of quercetin against cell injury and inflammation in HUVECs [
26]. Our results further confirm our hypothesis that quercetin at an appropriate dose can protect ovary function against damage caused by free radicals.