Background
The incidence and mortality rates of melanoma have increased world-wide in the last 30 years [
1]. Melanoma is notorious for its propensity to metastasize. Early stage melanoma is readily treatable, but advanced metastatic melanoma becomes resistant to treatment. It is reported that the long-term survival rate for patients with metastatic melanoma is only 5% [
2]. Currently available chemotherapeutic approaches for melanoma often carry tolerance, low response rate [
3] and high toxicity [
4,
5]. New targeted therapies with high response rate and low toxicity are urgently needed for managing malignant melanoma.
Recently, the role of receptor tyrosine kinase c-Met in melanoma pathogenesis has been gaining interest. c-Met is a cell surface receptor consists of a 50-kDa extracellular α chain and a 140-kDa membrane-spanning β chain, and is synthesized from a single-chain 170-kDa precursor [
6]. Binding of HGF (hepatocyte growth factor), the only known endogenous ligand of c-Met [
7], to c-Met leads to c-Met homo-dimerization and auto-phosphorylation. The phosphorylated regions of c-Met then act as the multifunction docking site for adaptor molecules which propagate a signaling cascade through a number of effector proteins [
8]. Dysregulation of c-Met has been found in many types of cancer, which usually correlated with a poor prognosis [
9]. Interestingly, abnormal activation of c-Met signaling is implicated in the acquisition of tumorigenic and metastatic phenotypes in tumors [
10,
11]. Examinations indicated that c-Met was expressed and activated in melanoma tissues and cell lines [
12]. Studies showed that overexpression of c-Met was associated with melanoma growth and metastasis [
13,
14]. Constitutive activation of c-Met signaling has been reported to promote melanoma metastasis in mice [
15,
16], while inhibition of c-Met signaling with a specific small molecule tyrosine kinase inhibitor reduced growth and metastasis of experimental human melanoma [
17,
18]. Blockade of c-Met signaling with the specific small interfering (si) RNA also induced melanoma cell differentiation and prevented melanoma metastasis in a mouse model [
17,
18]. These studies suggest that c-Met is a therapeutic target for melanoma metastasis.
The dietary flavonoid quercetin (3,3’,4’,5,7-pentahydroxyflavone) is a bioactive compound that wildly distributed in the plant kingdom. It possesses low intrinsic toxicity and does not have carcinogenic activity
in vivo [
19]. Besides, it has a relatively high oral bioavailability [
20]. Quercetin has many biological functions including anti-melanoma activity [
21]. Several studies showed that quercetin inhibited melanoma growth [
22-
24] and metastasis [
25,
26]. Moreover, quercetin also inhibited HGF-induced c-Met phosphorylation in human medulloblastoma cell line DAOY [
27], and suppressed HGF-stimulated migration and invasion in DAOY cells [
27] and human hepatoma HepG2 cells [
28].
Our published data [
29] demonstrated that quercetin inhibited melanoma cell migration and invasion
in vitro and prevented melanoma lung metastasis
in vivo. Here, we show that quercetin inhibits HGF/c-Met signaling manifested by suppressing c-Met phosphorylation, interfering c-Met dimerization, reducing c-Met protein expression and attenuating the activities of downstream molecules including Gab1, FAK and PAK, which contributes to the anti-metastatic action of quercetin in melanoma.
Discussion
The HGF/c-Met pathway is activated in various types of cancer, which stimulates cancer cell growth and metastasis [
9]. HGF is a multifunctional cytokine acting as a mitogen, motogen and morphogen [
37]. Most cancers express both HGF and c-Met, leading to autocrine activation of c-Met. Besides, aberrant c-Met activation can also be achieved through c-Met overexpression, activating c-Met mutations, or c-Met gene amplification [
38]. In melanoma, HGF and c-Met are expressed [
9] and involved in tumorigenesis [
30]. In this study, we found that quercetin, a widely existed dietary flavonoid, suppressed c-Met signaling by inhibiting c-Met phosphorylation and dimerization (Figure
2A, B and C). Quercetin also inhibited HGF-stimulated melanoma cell migration and invasion (Figure
1), which was in agreement with the previous studies that quercetin inhibited HGF-stimulated migration and invasion in human medulloblastoma cell DAOY [
27] and human hepatoma HepG2 cells [
28]. In addition, many other known flavonoids, such as EGCC [
39], luteolin [
28,
31], kaempferol [
27] and myricetin [
27] also showed inhibitory effects on HGF-stimulated cancer cells migration. These observations indicated that these plant-derived flavonoids shared similar activities and may be useful in melanoma treatment and prevention.
Since some melanoma cells were reported to express HGF and secret a detectable level of HGF to induce constitutive activation of c-Met [
30], we wondered if quercetin exerted its effects by affecting HGF autocrine. We collected the culture medium of quercetin-treated A375 and A2058 cells, and examined the HGF levels by ELISA, but the level of secreted HGF was too low to be detected. Besides, we also found that the inhibitory effect of quercetin on HGF mRNA expression was not obvious (Figure
2D). Based on these results we could not draw a conclusion regarding the impact of HGF autocrine on quercetin-mediated c-Met signaling inhibition.
We found that c-Met protein levels were decreased after quercetin treatment in both dose- and time-dependent manners (Figure
3A and B). Since melanoma can be divided into three mutually exclusive genetic subsets: BRAF mutant melanoma, NRAS mutant melanoma and melanoma of wild type at both loci [
40], to confirm the generality of this finding, beside two BRAF mutant melanoma cell lines A375 and A2058, NRAS mutant melanoma cell line sk-mel-2 and wild type NRAS and BRAF melanoma cell line MeWo with constant c-Met activation [
12] were also used. Results showed that treatment with quercetin down-regulated the expression levels of c-Met in all these four cell lines (Figure
3A and B), suggesting that the inhibitory effect of quercetin on c-Met receptor is a general phenomenon in melanoma. It was further found that c-Met expression was higher in membrane fractions than in cytosol fractions, and c-Met in both fractions were inhibited by quercetin treatment (Figure
3C). We also found that quercetin did not affect the mRNA expression levels of c-Met in all these cell lines (data not shown), which indicated that quercetin post-transcriptionally down-regulated c-Met expression. Coleman
et al. identified a regulatory link between FAS and c-Met. They found that inhibition of FAS by using inhibitors (luteolin or C75) or the shRNA knockdown approach can down-regulate c-Met expression in human prostate cancer cells, and the production of the 16-carbon fatty acid palmitate by FAS is required for maintaining c-Met expression [
31]. Similar results have also been observed in diffuse large B cell lymphoma by Uddin
et al. [
41] and in breast cancer by Hung
et al. [
42]. Furthermore, Coleman
et al. found that all the flavonoids luteolin, apigenin, and quercetin, which possess a same moiety with a C2-C3 double bond in the C-ring, reduced c-Met expression in human prostate cancer cells [
31]. In this study, we found that quercetin reduced c-Met expression, C75, a specific inhibitor of FAS, showed similar inhibitory effect on the expression of FAS and c-Met (Figure
3E), and exogenous palmitate prevented quercetin-induced reduction of c-Met (Figure
3F), further supporting a role of FAS in maintaining c-Met expression levels. However, the mechanism by which FAS inhibition decreases c-Met expression is not yet clear. A possible explanation is that FAS inhibition may cause an imbalance in the membrane phospholipids levels, which may result in decreased c-Met membrane localization [
41,
43]. Lipid rafts are membrane microdomains that serve as platforms for cell signaling, and FAS was shown to regulate the activity of lipid rafts [
44]. Recent studies found that altering the structure or function of lipid rafts prevented the activation of c-Met [
45]. Quercetin is also reported to suppress lipid biosynthesis in breast cancer MDA-MB-231 cells [
35]. Therefore, the quercetin-mediated reduction of c-Met in melanoma cells may be due to FAS inhibition.
After phosphorylation on tyrosine site 1349, c-Met becomes a docking site for recruiting Gab1, which further activates downstream FAK and PAK [
9]. Activation of both c-Met/Gab1/FAK and c-Met/Gab1/PAK signalings promotes tumor metastasis [
9]. Our data showed that quercetin dose-dependently decreased the levels of phospho-Gab1, phospho-FAK and phospho-PAK (Figure
4A, B and C), suggesting that inhibition of the c-Met/Gab1/FAK and c-Met/Gab1/PAK pathways may contribute to the anti-metastatic effects of quercetin. It is well-known that quercetin has multiple targets including receptor tyrosine kinases, matrix metalloproteinase, mitochondria and other signaling enzymes [
46]. Besides Gab1, c-Met can also activate other molecules such as STAT3 [
8] which is involved in melanoma metastasis. STAT3 can be suppressed by quercetin treatment as shown in our previous study [
29]. Therefore, we could not exclude the possibilities that quercetin inhibits melanoma metastasis by modulating other pathways downstream of c-Met. Indeed, overexpression of FAK or PAK only partially reversed quercetin-mediated inhibitory effects on melanoma cell migration (Figure
5C). Whether overexpression of both PAK and FAK can completely reverse the migration inhibitory effect of quercetin in melanoma cells needs to be further studied.
Methods
Reagents and antibodies
Antibodies against phospho-Met (Tyr1234/Y1235), phospho-Met (Tyr1349), phospho-Met (Tyr1003), c-Met, phospho-Gab1 (Tyr307), FAK, phospho-FAK (Tyr576/577), phospho-FAK (Tyr925), phospho-FAK (Tyr397), PAK1/2/3, phospho-PAK1 (Ser144)/PAK2 (Ser141), phospho-PAK1 (Ser199/204)/PAK2 (Ser192/197), phospho-PAK1 (Thr423)/PAK2 (Thr402) and FAS were obtained from Cell Signaling Technology (Beverly, MA, USA). Anti-GAPDH was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Goat anti-rabbit IgG, goat anti-mouse IgG and protein markers were supplied by Bio-Rad (Hercules, CA, USA). Recombinant human HGF was obtained from PeproTech (PeproTech, NJ, USA). Other chemicals were obtained from Sigma–Aldrich (St. Louis, MO, USA). Quercetin was obtained from Chromadex (USA). The stock solution of 100 mM quercetin was prepared in dimethyl sulfoxide (DMSO) and stored at −20°C. Palmitate was complexed to bovine serum albumin as previously described [
47]. In short, sodium palmitate was dissolved in ethanol:H
2O (1:1, v/v) at 70°C at a final concentration of 150 mM, then the solutions were complexed with fatty-acid-free BSA (10% solution in H
2O) by stirring for 1 h at 37°C and then diluted in culture medium. The final molar ratio of fatty acid:BSA was 5:1.
Cell culture
A375, A2058, sk-mel-2 and MeWo cell lines were obtained from the American Type Culture Collection (ATCC, USA), and were incubated in high glucose Dulbecco’s modified Eagle’s medium (DMEM, GIBCO, USA), supplemented with 10% (v/v) fetal bovine serum (FBS, GIBCO, USA) and 1% penicillin/streptomycin (P/S, GIBCO, USA) at 37°C in a humidified atmosphere of 5% CO2.
Cell migration and invasion assay
The cell migratory ability was tested using a commercial Transwell insert (8 μm pore size, Corning, NY, USA). A2058 and A375 cells were suspended in serum-free DMEM medium containing 0.1% BSA. Then 0.1 ml of the cells suspension was added to the top of the Transwell inserts, and 0.5 ml of serum-containing medium with (+) or without (−) HGF (100 ng/ml) was plated in the bottom wells. Quercetin was added to both inserts and wells. The chambers were then assembled and incubated for 24 h or 48 h at 37°C in a 5% CO2 incubator. After that, non-invading cells were removed from the upper surface of the membrane by scrubbing. The migrated cells on the underside of the filter were first fixed with 100% methanol and then stained by 0.1% crystal violet solution and counted in five random fields. The relative migration was calculated from the ratio of the migrated cells that quercetin treated versus the vehicle control cells.
For the invasion assay, BD BioCoat™Matrigel™ invasion chamber (24 well plate, 8-μm pore size, BD Biosciences, San Jose, CA, USA) were used. 0.5 ml warm (37°C) serum-free medium was added to both the inserts and the wells to allow the chamber rehydrated at 37°C in a 5% CO2 incubator for 2 h. Then A2058 and A375 cells in 0.5 ml serum-free medium containing 0.1% BSA were added to the inserts, while 0.75 ml of serum-containing medium with or without HGF (100 ng/ml) was placed in the lower chambers. Quercetin was added to both the inserts and the lower chambers. Chambers were then assembled and incubated for 24 h or 48 h at 37°C. Subsequent steps were performed in the same manner as described for cell migration assay.
Western blot analysis
Membrane protein was extracted using Mem-PER™ Plus kit (Thermo Scientific, Rockford, IL, USA) according to the manufacturer’s protocol. Preparation of total protein lysates and Western blot analysis were performed as described previously [
29]. Protein concentrations were determined according to the Bio-Rad protein assay reagent. The cell lysates were separated on 6% or 8% gels and transferred to nitrocellulose membranes. The membranes were incubated in 5% skim milk in TBS-T buffer at room temperature. Blocked membranes were incubated with primary antibodies at 4°C overnight, followed by incubation with secondary antibodies at room temperature for 1 hour. After washing in TBS-T, immune-reactive bands were visualized by chemiluminescence substrate (Thermo Scientific, Rockford, IL, USA).
Real-time PCR
Total RNA was extracted with Trizol reagent (Invitrogen, USA), and reverse-transcripted with oligo-dT using M-MLV reverse transcriptase (Promega, USA) according to the manufacturer’s protocol. Quantitative real time PCR was carried out by monitoring the increase in fluorescence of SYBR green with the ViiA 7 Real Time PCR System (Applied Biosystems, USA). The primer sets were synthesized by Invitrogen, HGF primers: forward TCCCCATCGCCATCCCC and reverse CACCATGGCCTCGGCTGG, GAPDH primers: forward CTGCACCACCAACTGCTTAGC and reverse CTTCACCACCTTCTTGATGTC. Each sample was amplified in triplicate for quantification. Data were analyzed by relative quantitation using the ΔΔCt method and normalized to GAPDH.
Dimerization of c-Met
The dimerization of c-Met was analyzed as described previously [
48]. Melanoma cells were starved overnight and then treated with vehicle control or quercetin for 6 h, followed by stimulation with HGF (100 ng/ml) on ice for 10 min. Subsequently, the cross-linker Bis[sulfosuccinimidyl] substrate (BS
3, 0.25 mM, Thermo Scientific, Rockford, IL, USA) was added to cells and reacted at 37°C for 5 min. Cells were then transferred on ice for 10 min. After that, non-reactive BS
3 were quenched with 50 mM Tris–HCl (pH 7.4). Cell lysates were separated by 6% SDS-PAGE and immunoblotted with an anti-c-Met antibody.
Plasmid transient transfection
Plasmids pCMV6M-Pak1 (Addgene plasmid 12209) was provided by Sells
et al. [
49] and myc-Rapr-FAK (Addgene plasmid 25926) was supplied by Karginov
et al. [
50]. To overexpress FAK and PAK, cells were transfected with plasmids using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s protocol. Empty pcDNA3.0 plasmid was used as mock transfectant. Cells were transfected with plasmids for 24 h or 48 h before functional assays were carried out.
Statistical analysis
The Student’s t-test was used to analyze differences between two groups. All data were presented as means ± S.D. from at least three independent experiments. P < 0.05 was considered as statistically significant.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
HC designed, carried out the experiments, analyzed data and drafted the manuscript. XF, HG, TL participated in the data analysis. HY, CC and TS contributed to the reagents and analysis tools. AT and ZY conceived of the study and participated in its design. HK and ZY helped to the final drafting of the manuscript. All authors read and approved the final manuscript.