Zum Inhalt

Quinic acid alleviates inflammatory responses and oxidative stress in Freund’s complete adjuvant-induced arthritic rat model and associated risk factors of atherosclerosis

  • Open Access
  • 03.10.2025
  • Original Article
Erschienen in:
Download

Abstract

Background

Arthritis is an inflammatory disease which causes inflammation, damages joint, and increases the risk of cardiovascular disorders like atherosclerosis. Quinic acid, a naturally occurring compound, exhibits anti-inflammatory and antioxidant potential.

Method

The current study was aimed to estimate the pharmacological effects of quinic acid in Freund complete adjuvant-induced arthritis and its possible impact on associated predisposing biomarkers of atherosclerosis development. Quinic acid at various doses (25, 50, and 100 mg/kg) and methotrexate as reference drug were administered, with one group receiving combination treatment. Body weight changes, paw size, arthritic and joint stiffness score, hematological parameters, lipid profile, asymmetric dimethylarginine, homocysteine, oxidative stress, inflammatory biomarkers, and histopathological evaluation of ankle joint and heart tissues were performed to ascertain the severity of arthritis and predisposing biomarkers of atherosclerosis.

Results

The findings indicated that combination treatment significantly improved (p < 0.001) body weight, hematological parameters, high density lipoprotein levels, antioxidant enzyme concentrations, and expressions of dimethyl arginine dimethyl amino hydrolase and cortistatin. Simultaneously, it substantially reduces (p < 0.001) paw size, joint stiffness, arthritic score, platelets and leucocyte count, lipid markers, asymmetric dimethylarginine, homocysteine, malondialdehyde, and nitrite levels, whereas downregulation of mRNA expression of inflammatory markers (interleukin-6, interleukin-1β, tumor necrosis factor-α) was observed. It also significantly (p < 0.001) improves the histopathological parameters of ankle joint and heart tissue.

Conclusion

It was concluded that quinic acid possessed hypolipidemic, anti-inflammatory, and antioxidant properties and may be an effective therapeutic substance for the management of polyarthritis and predisposing markers of atherosclerosis.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Introduction

Polyarthritis is a severe immune-mediated illness that impacts the synovial tissues over time. It is marked as chronic inflammation, which destroys the bone and cartilage in the joints, leads to increase mortality rates, a decline in life expectancy, and progressive disability (Deshmukh 2023). The symptoms include pain, joint stiffness, swelling, bone erosion, cartilage degeneration, pannus formation, and diminished functionality, whereas systemic symptoms include weight loss, fever, and fatigue (Parveen et al. 2023). Arthritis prevalence in general population is about 1%, with women being more frequently affected. According to reports, arthritis patients have a 50% higher prevalence of cardiovascular comorbidities than the general population, and cardiovascular mortality remains the leading reason for death among them (Hajiesmaeili et al. 2024).
The mediators and cells of innate (macrophages and monocytes) and adaptive immune system (T and B lymphocytes) interact with each other in chronic autoimmune conditions such as polyarthritis, and this leads to the progress of systemic and local inflammation. The disruption of this system may exacerbate and prolong the inflammation with joint damage (Edilova et al. 2021). Reactive oxygen species (ROS) possess the potential to have a part in polyarthritis pathophysiology, as the production of ROS is a major modulator in polyarthritis, particularly in joint inflammation. Low-density lipoproteins (LDL) are oxidized by these reactive species, leading to foam cell production. The foam cells block the arteries and develop the well-known condition known as atherosclerosis (Ahmad et al. 2016).
Asymmetric dimethylarginine (ADMA) and dimethylarginine dimethyl hydrolase (DDAH) pathway is involved in the pathophysiology of arthritis and atherosclerosis. ROS and cytokines are produced by inflammatory environment of inflamed synovia, leading to decreased expressions of DDAH, the primary enzyme responsible for the breakdown of ADMA, hence enhancing the release of ADMA, a novel indicator of cardiovascular risk factors and endothelial dysfunction in arthritis (Di Franco et al. 2018). One recognized risk factor for CVD in polyarthritic patients is hyperhomocysteinemia. The increased level of homocysteine inhibits DDAH activity, and endothelium dysfunction appears to increase proteolysis and increase ADMA levels (Di Franco et al. 2018). A part of the somatostatin neuropeptide family, cortistatin (CST), is an exceptionally potent anti-inflammatory peptide. Increased level of ADMA decreases the expression of CST, which in response leads to enhance the markers of inflammation such as IL-6, IL-1β, and TNF-α (Tanveer et al. 2022).
Medications that are currently used for treating polyarthritis, such as biological agents, NSAIDs, steroids, and DMARDs, are associated with side effects. The utilization of these medications for a long period is linked to risks of cardiovascular, gastrointestinal, and hematological problems, and loss of response to treatment (Naz et al. 2020). The use of NSAIDs for arthritic pain is prevalent. Long-term NSIADs use is attributed to a greater likelihood of CVD (Kerola et al. 2021). There is a need for exploring phytoconstituents from plants that can reduce the side effects associated with conventional arthritic therapy and inhibit cytokine production in polyarthritis treatment (Djehiche et al. 2024). Plants and their secondary metabolites are very cost-effective alternative owing to their pharmacological effects and low toxicity, especially when managing immunomodulatory and inflammatory disorders (Laurindo et al. 2023; Sharif et al. 2017; Zaib et al. 2020).
Quinic acid, known as cyclohexane carboxylic acid, is extracted from the bark of cinchona, coffee beans, and several plants including apples, peaches, and sweet potatoes (Ghasemi‐Dehnoo et al. 2023). QA is a member of the phenolic acid class (Liu et al. 2020). QA exerts its pharmacological effects via anti-inflammatory, antioxidant, and antiapoptotic activities (Ghasemi‐Dehnoo et al. 2023). QA is reported to decrease the lipid biomarkers and also possess the potential of lowering TNF-α, IL-6, and IL-1β mRNA expression levels in adipose tissue (Dong et al. 2022). The literature review revealed that the use of QA in the management of polyarthritis and its associated cardiovascular complications remains largely unexplored. There is a critical need for comprehensive research elucidating the mechanisms underlying the QA effects in polyarthritis and associated predisposing markers of atherosclerosis development in FCA-induced arthritic rat model. Our study investigates the pharmacological effect of QA for treatment of polyarthritis and associated predisposing markers of atherosclerosis development in FCA-induced arthritic rat model. The results of this research may offer valuable insights into the potential therapeutic strategies targeting both polyarthritis symptoms and its cardiovascular comorbidities (atherosclerosis).

Materials and methods

Experimental compound

Quinic acid (CAS Number: 77-95-2) with 98% purity was acquired from Shanghai Macklin Biochemical Co., Ltd. and stored according to instructions given on the label. Distilled water was used to dissolve the drug and make a solution. Standard drug methotrexate was obtained from Paramedic Laboratories (PVT) LTD, Lahore.

Experimental animals

Using the simple random sampling method, 35 albino rats, weighing 160–210 g, 6–8 weeks old of either sex was acquired from University of Veterinary and Animal Sciences (UVAS), Lahore, and retained in the Lahore College for Women University’s animal house for 7 days until they were accustomed to their new surroundings. The rats were kept individually in well-ventilated cages (n = 5). Rats were kept under standard conditions such as 23 ± 3 °C, a 12-h alternating dark and light cycle, and humidity maintained between 30 and 70%. The rats were provided with regular diet and ample supply of water. All obligatory precautionary measures for safety of animals were carried out (Zeb et al. 2024).

Ethical approval

The authorization for animal studies was acquired via the Institutional Research Ethical Committee of Lahore College for Women University, Lahore (ORIC/LCWU/41-24).

Arthritis induction

For induction of polyarthritis, 0.15 mL FCA (heat-killed Mycobacterium, ZOKEYO®) was injected subcutaneously into the left hind paws, specifically targeting the subplantar region of rats of all the groups except the V. Ctrl group rats at day 0 (Hannan et al. 2023).

Grouping and dosing

For this study, rats were categorized into seven groups; each group contained five rats. After development of polyarthritis, the treatment was commenced on the 8th day and lasted until the 22nd day. Based on available in vivo acute toxicity data (Arya et al. 2014) and previously published literature, the treatment drug quinic acid was administered orally to the treatments groups at different dose levels such as 25, 50, and 100 mg/kg body weight (Ghasemi‐Dehnoo et al. 2023), corresponding to the low, medium, and high dose, respectively. One treatment group received combination treatment that was 100 mg/kg body weight of QA orally and methotrexate 0.75 mg/kg body weight intraperitoneally (Saleem et al. 2022). Each rat was killed on the 23rd day following the induction of polyarthritis. The timeline is illustrated in Fig. 1.
Fig. 1
Timeline illustrating the experimental protocol
Bild vergrößern
Group-I: vehicle control group (V. Ctrl)
Healthy rats were given distilled water as a vehicle orally.
Group-II: arthritic control (A. Ctrl)
Arthritic control rats received distilled water as a vehicle for treating arthritis induced by FCA.
Group-III: rReference drug control (RDMTX)
Arthritic rats were given reference drug methotrexate (0.75 mg/kg b. w., IP) weekly for 15 days, beginning on the 8th day and extending to the 22nd day after arthritis was induced (Abdel-Maged et al. 2019).
Group-IV: Low-dose QA group (LDQA 25 mg/kg)
Arthritic rats received a low dose of quinic acid (25 mg/kg b. w.) orally using oral gavage for 15 days, beginning on the 8th day and extending to the 22nd day after arthritis was induced.
Group-V: medium-dose QA group (MDQA 50 mg/kg)
Arthritic rats received a medium dose of quinic acid (50 mg/kg b. w.) orally using oral gavage for 15 days, beginning on the 8th day and extending to the 22nd day after arthritis was induced.
Group-VI: high-dose QA group (HDQA 100 mg/kg)
Arthritic rats were given a high dose of quinic acid (100 mg/kg b. w.) orally using oral gavage for 15 days, beginning on the 8th day and extending to the 22nd day after arthritis was induced (Ghasemi‐Dehnoo et al. 2023).
Group-VII: high dose + reference drug group (HDQA + RDMTX)
Arthritic rats of this group received combination therapy. The rats received a high dose of quinic acid (100 mg/kg b. w. orally) treatment and reference drug methotrexate (0.75 mg/kg IP). The HDQA 100 mg/kg was given orally using oral gavage daily for a period of 15 days, while RDMTX was given IP once a week for 15 days, beginning on the 8th day and extending to the 22nd day after arthritis was induced.

Determination of body weight changes

Using an electronic weighing balance (D446410976 Shimadzu Corporation, Japan), the body weight was determined on 0, 8th, 13th, 18th, and 23rd days. To determine the percentage change in body weight, the following formula was used.
$$\% {\text{Weight}}\;{\text{change}} = \frac{wx - wo}{{wx}} \times 100,$$
where \(wx\) represents the rat’s weight on day x, while \(wo\) refers to its weight on 0 day (Kaur et al. 2023).

Determination of paw thickness and % paw edema inhibition

Paw thickness (mm) was measured using a digital vernier caliper on 0 day before FCA induction and then on the 8th, 13th, 18th, and 23rd days. The percentage paw edema inhibition was computed by the formula:
$$\% {\text{Paw}}\;{\text{edema}}\;{\text{inhibition}}\frac{(Et - Eo)controlgroup - (Et - Eo)treatedgroup}{{(Et - Eo)controlgroup}} \times 100,$$
where \(\text{Eo}\) denotes the paw size at 0 day (prior to FCA induction), \(\text{Et}\) refers to the paw size at each consequent day starting from the 13th day, and \(\left(Et-Eo\right)\) shows the paw edema (Gul et al. 2023).

Determination of arthritic score

Based on visual criteria, the arthritic score was assessed at the 0, 8th, 13th, 18th, and 23rd day. The severity of the disease was graded from o to a 4 score, where a score of 0 signifies no pathological changes, while a score of 1–4 indicated minimal paw erythema and swelling, mild paw swelling and erythema, moderate erythema and swelling of the entire paw, and severe swelling and deformity of the paw, respectively (Saleem et al. 2022).

Determination of joint stiffness

Joint stiffness was assessed using a scale from 0 to 2. Rats were delicately handled from behind in the left hand's palm and securely grasped on the back. The right hand's fingers were then used to bend and extend the knee (almost five times). The restraint of motion in both bending and extension (once for every direction) was the basis of the scale. Score 0 was assigned to no restrictions, score 1 referred to complete ankle joint restriction in bending or extension, and score 2 denoted complete range of motion restriction in both bending and extension of the ankle joint in rats (Kaur et al. 2023; Waseem et al. 2025).

Sample collection

On the 23rd day, ketamine/xylazine cocktail anesthesia was delivered via the IP route at a ratio of 40 mg/kg to 10 mg/kg to euthanize the animals (Parveen et al. 2023). The blood sample from each rat was collected in vacutainers via cardiac puncture. Blood was drawn and injected into an EDTA tube for hematology and PCR analysis (Gul et al. 2023). On the other hand, the blood for the serum separation was collected in a gel clot activator tube for the analysis of lipid profile, antioxidant enzymes, ADMA, and homocysteine level. For a histological evaluation, the rats were killed to get the left ankle joints and heart tissues. The joints and heart tissues were kept in tightly sealed containers that contained 10% neutral buffered formalin solution.

Serum separation

After collection of blood in gel clot activator tubes, the tubes were left undisturbed over a period of 15–30 min at room temperature to allow clotting. The serum was obtained by centrifugation for 10 min at 4 °C and 3000 rpm (1020D centurion Scientific, UK) (Saeed et al. 2022). The serum samples were transferred to Eppendorf tubes and kept in a freezer (Ultra Low Temp Freezer U410 Premium, New Brunswick Scientific, USA) at − 80 °C until biochemical analysis (Ahmed et al. 2015).

Determination of hematological parameters

Hematological indicators such as Hb content, red blood cell count, platelet, and leukocyte count were determined in blood samples from rats using an automatic hematology analyzer (Celltac α MEK-6500K Hematology Analyzer, Japan) (Haroon et al. 2024).

Determination of lipid profile

The serum was used to measure the lipid profile of rats. The TC, high-density lipoprotein, total triglycerides, very low-density lipoproteins, and low-density lipoproteins were estimated by means of a biochemistry analyzer (SBA-733PLU, China) (Malik et al. 2022).

Determination of ADMA concentration

The concentration of ADMA in rat’s serum sample was measured using ADMA ELISA kit for rats (LOT no. 00501, Ideal Medical Technology Co., Ltd. Shanghai, China). The procedure was carried out following the instruction provided by the kit’s manufacturer. The optical density was recorded at 450 nm by a microplate reader (BIOBASE-EL 10A, China) within minutes. The standard curve of known ADMA concentrations was used to determine the ADMA concentration in rat serum samples and the results were depicted in µmol/L (Anwar et al. 2025).

Determination of homocysteine concentration

Homocysteine concentration in rat’s sera samples was measured via Rat Homocysteine ELISA kit (CSB-E13376r, CUSABIO®). The procedure was performed according to the manufacturer’s protocol provided with the kit. Optical density was recorded at 450 nm in 5 min. Through the use of a standard curve, the homocysteine concentration in sera of rats was calculated and the results were represented in nmol/mL (Anwar et al. 2025).

Determination of oxidative stress biomarkers

Determination of superoxide dismutase activity

For determining the SOD activity, equal quantities of 0.2 mM pyrogallol solution (50 µL) and serum sample (50 µL) were mixed with 1500 µL phosphate buffer. Following the 10-s induction period, absorbance will be measured at 325 nm every 30 s for 5 min via an ELIZA reader (BIOBASE-EL 10A, China), which is the wavelength at which the radicals absorb light most effectively (Khan et al. 2020, 2024).

Determination of catalase (Deshmukh) activity

CAT activity was determined by a slight modification in the previous method. By mixing 50 µL of serum, 50 µL of 30 mM H2O2 (pH 7.0), and 100 µL of 0.1 M PBS, the reaction mixture was prepared. Next, an ELISA reader (BIOBASE-EL 10A, China) was used to measure the absorbance values every 5 s at 240 nm. The activity of CAT was determined using the extinction coefficient of H2O2 (0.071 mmol4 cm−1) and the results were expressed in U/mL (Zafar et al. 2021).

Determination of lipid peroxidation levels

The MDA level was measured by slight modification of previous methods. 0.375% thiobarbituric acid (TBA), 15% trichloroacetic acid (TCA), and 0.25 N hydrochloric acid (HCl) were added together to create a TBA solution for the measurement of MDA level (Bahrami et al. 2016). 150 µL of TBA solution was mixed with 50 µL of serum sample. After thoroughly combining the solutions, it was placed in a bath of boiling water for 15 min and quickly cooled in an ice bath. The supernatant was collected after centrifuged at 3000 rpm for 10 min (Eppendorf centrifuge 5417R). A microplate reader (BIOBASE-EL 10A, China) was used to measure supernatant absorbance at a wavelength of 532 nm (Shahbaz et al. 2024; Zeb et al. 2024). The MDA level was measured in nmol/ m L (Ansari et al. 2019).

Determination of reduced glutathione level

By slight modifications to the Ellman's method, the concentration of GSH in serum was measured. Using this approach, 30 min of centrifugation at 3000 rpm (Eppendorf centrifuge 5417R) was used to precipitate equal quantities of serum and 10% trichloroacetic acid solution (50 µL). Following that, the clear supernatant was taken out and 200 µL of PBS was added. Later on, 25 µL of (5,5′-dithiobis-(2-nitrobenzoic acid) reagent (Lot #.C12350703) was added. After incubating the samples at room temperature for 15 min, thiol groups that were present in GSH reacted with DTNB to break its disulfide bond and produce 2-nitro-5-thiobenzoate (TNB2 ) ions. The presence of TNB2 ions can be detected by an appearance of yellow color. Using an ELISA reader (BIOBASE-EL 10A, China), the samples' absorbance was recorded at 412 nm wavelength. The standard curve of known glutathione concentrations was employed to estimate the GSH amounts in rat serum samples and the results were expressed in nmol/mL (Mukhtiar et al. 2012; Saeed et al. 2022; Shakir et al. 2023).

Determination of nitrite level

As nitric oxide (NO) is unstable, it is difficult to measure the production of NO; instead, we measure the level of nitrite (NO2), one of the stable by-products of NO, which is a molecule that is stable and non-volatile in contrast to NO (Gravandi et al. 2023). The nitric oxide (NO) production can result from oxidative stress and can be assessed by measuring nitrite levels. Griess reagent was used to measure the nitrite level. After evenly combining the serum sample (50 μL) and Griess reagent (50 μL), the resulting mixture was left to incubate for 10 min, and the absorbance at 546 nm was recorded with an ELIZA reader (BIOBASE-EL 10A, China). The concentration of nitrite content in the sample was estimated based on the standard curve of known concentrations and the results were reported in nmol/ mL (Bais et al. 2015).

Determination of levels of inflammatory markers

The levels of inflammation markers such as CST, IL-16, IL-1β, DDAH1, and TNF-α in the blood of rat was determined by qPCR. Using Multi-type Sample RNA Extraction-Purification Kit (Cat no. S1006E, Sansure Biotech Inc., China), RNA was extracted from blood samples in accordance with the manufacturer’s standard protocol. The quantification of RNA samples was carried out using a NANODROP 2000 spectrophotometer (Skanit RE 4.1, Thermo Scientific). ThermoFisrt cDNA kit (HRP013 100 T ZOKEYO, China) was used to reverse transcribe RNA samples to generate cDNA, with a minimum RNA input concentration of 10 ng/uL (Fatima et al. 2024). SYBR Select Master Mix (Cat No. 4472903, ZOKEYO, China) was used to achieve real-time expression of targeted genes using cDNA as template and duplicates of the relevant primers (10 µM each) (synbio technologies). Using the universal thermal cycling conditions, PCR reactions were run on SLAN-96P Real-Time, PCR System (Sansure Biotech Inc. China). After the software generates a cycle of thresholds (Ct values), the Ct values of samples were compared to those of control samples and control samples containing housekeeping genes (GAPDH). The fold expression of a gene change was calculated using the Livak method (ΔΔCt) (Siddique et al. 2024). The primer sequences employed in the study are presented in Table 1 and have been chosen from previous literature and synthesized commercially (Synbio Technologies).
Table 1
Primer sequence
Genes
Primers
Base sequence (5’–3’)
References
TNF-α
Forward
ATGGGCTCCCTCTCATCAGT
Sial et al. (2024)
Reverse
GCTTGGTGGTTTGCTACGAC
IL-6
Forward
CCCACCAGGAACGAAAGTCA
Sial et al. (2024)
Reverse
ACTGGCTGGAAGTCTCTTGC
IL-1β
Forward
CACCTCTCAAGCAGAGCACAG
Sial et al. (2024)
Reverse
GGGTTCCATGGTGAAGTCAAC
DDAH1
Forward
AAGGACTACGCAGTTTCCACAGT
Chen et al. (2013)
Reverse
CAGCCATGCTGCAGAAACTC
Cortistatin
Forward
CCGGCCTTCTGACTTTCCTT
Chen et al. (2013)
Reverse
TGCTGGAGGGGTGGTCTTT
GAPDH
Forward
GACTCCACTCACGGCAAATTC
Sial et al. (2024)
Reverse
TCTCCATGGTGGTGAAGACA

Histopathological analysis of the ankle joint

At the termination of the study, research animals were killed on the 23rd day for histopathological evaluation of ankle joint tissues. After the ankle joints were separated, they were fixed for 36 h in 10% neutral buffered formalin. They were decalcified with decalcifying solution (ethylenediamine tetraacetic acid, hydrochloric acid, and potassium and sodium tartrate) for 48 h. The tissues that were collected required further processing before being embedded in 5 μm-thick paraffin blocks (Naz et al. 2020). Following embedding, each paw's thin histological slices were carefully processed and affixed on glass. H&E staining was subsequently applied to enable one to see their morphology under a research microscope (LFM-B10 Labtron Equipment Ltd UK). Hematoxylin imparts a violet or blue color to cellular nuclei, whereas eosin imparts red or pink color to extracellular and cytoplasmic structures. The H&E staining makes it easier to thoroughly examine pannus development, inflammatory cell infiltration, and bone erosion in rat paws, and enabling comprehensive histopathological examinations (Djehiche et al. 2024). The histopathological analysis, for the bone erosion, cartilage erosion, synovial hyperplasia, inflammation, pannus formation, and vascular congestion was assessed by scores of 0–3, where score 0 represented no pathological changes, 1 mild changes, 2 moderate changes, and 3 severe damage (Maarouf et al. 2024; Munir et al. 2021).

Histopathological analysis of heart tissues

The heart tissues were collected and quickly rinsed off with ice-cold saline to get rid of all the blood, and it was then preserved in a 10% buffered neutral formalin solution (Pullaiah et al. 2021). Following that, it was properly dehydrated in 100% ethanol and embedded in standard paraffin blocks. These paraffin blocks were used to prepare slices of heart tissue that were 4–5 µm thick, placed on a glass slides, and then stained using hematoxylin–eosin. Stained sections were evaluated via a research microscope (LFM-B10 Labtron Equipment Ltd UK) that was computer connected to take tissue photomicrographs (Olorundare et al. 2020). The parameters of the heart's histopathological assessment such as inflammation, hemorrhage, and vascular congestion were assessed by scores of 0–3, where score 0 represented no pathological changes, 1 represented mild changes, 2 represented moderate changes, and 3 represented severe damage (Akşit et al. 2023; Ali et al. 2023).

Statistical analysis

Statistical analysis of the data was performed with the help of GraphPad Prism software. The data was displayed as mean ± SD. One-way analysis of variance (ANOVA) was applied. Tukey’s post hoc test was used for multiple comparison. *: represents the comparison of treatment groups with arthritic rat group. *, **, *** indicate p < 0.05, p < 0.01, and p < 0.001, respectively.

Results

Effect of quinic acid on body weight changes in FCA-induced arthritic rats

V. Ctrl rats exhibited a gain in body weights throughout the research (13.64% increase by 23rd day), whereas A. Ctrl rats body weights displayed a sharp decline, reaching a largest drop of nearly 19.41% (p < 0.001) by the 23rd day (Table 2). Interestingly, QA delivered at a dose of 100 mg/kg when given in combination with RDMTX substantially inhibited the marked drop in body weight over a course of disease up to the 13th day (0.58%; p < 0.01) and during the recovery phase from day 13 to day 23 (9.04%; p < 0.001). Animals receiving various doses of QA exhibited a pronounced regain in body weight by day 23 when compared to the A. Ctrl group. Treatment with RDMTX also prohibited the drop in body weight. The rats in this group exhibited an increase of 6.56% (p < 0.001) relative to the A. Ctrl group. Conclusively, rats treated with HDQA 100 mg/kg + RDMTX exhibited maximum recovery during the 23rd day study period.
Table 2
Effect of quinic acid on body weight changes in FCA-induced arthritic rats
Groups
V. Ctrl
A. Ctrl
RDMTX
LDQA 25 mg/kg
MDQA 50 mg/kg
HDQA 100 mg/kg
HDQA 100 mg/kg + RDMTX
Day 0
171.0 ± 
6.633
169.8 ± 
7.887
168.2 ± 
6.979
169.0 ± 
8.155
171.0 ± 
9.055
168.6 ± 
8.081
171.0 ± 
8.631
Day 8
176 ± 
7.714
(2.84%)
155.0 ± 
7.906 ##
(-9.55%)
157.0 ± 
5.701
(-7.13%)
156.0 ± 
10.120
(-8.33%)
157.0 ± 
7.176
(-8.91%)
157.0 ± 
7.550
(-7.39%)
158.0 ± 
8.337
(-8.23%)
Day 13
184.6 ± 
6.618
(7.37%)
148.8 ± 
8.075###
(-14.11%)
168.0 ± 
6.325**
(-0.12%)
158.0 ± 
10.370
(-6.96%)
162.6 ± 
9.685
(-5.17%)
164.0 ± 
7.937
(-2.80%)
172.0 ± 
4.416**
(0.58%)
Day 18
192.0 ± 
4.899
(10.94%)
144.2 ± 
7.362###
(-17.75%)
174.0 ± 
4.528***
(3.33%)
165.0 ± 
8.456***
(-2.42%)
168.0 ± 
7.778***
(-1.78%)
170.0 ± 
7.246***
(0.82%)
178.0 ± 
7.246***
(3.93%)
Day 23
198.0 ± 
3.162
(13.64%)
142.2 ± 
7.918###
(-19.41%)
180.0 ± 
5.339***
(6.56%)
169.2 ± 
8.786***
(0.12%)
173.0 ± 
9.354***
(1.16%)
176.0 ± 
8.660***
(4.20%)
188.0 ± 
6.671***
(9.04%)
V.Ctrl: vVehicle control; A.Ctrl: arthritic control; RDMTX: reference drug methotrexate; LDQA25mg/kg: low-dose quinic acid; MDQA 50 mg/kg medium-dose quinic acid; HDQA 100 mg/kg: high-dose quinic acid; HDQA 100 mg/kg + RDMTX: high dose quinic acid combined with methotrexate

Effect of quinic acid on %age paw edema inhibition and mean paw thickness in FCA-induced arthritic rats

All treatment groups exhibited a % paw edema inhibition relative to the A. Ctrl group rats by the 23rd day as given in Table 3. Among these treatment groups, the HDQA 100 mg/kg combined with RDMTX exhibited the most significant percentage paw edema inhibition (66.7%) and reduction in mean paw thickness (4.704 ± 0.244 mm; p < 0.001) at day 23 as compared to arthritic control rats (6.752 ± 0.296 mm). Furthermore, the rats treated with different doses of QA (100 mg/kg,50 mg/kg, and 25 mg/kg) and RDMTX also had % inhibition of paw edema (59.31%,43.77%,33.55%, and 27.98%, respectively) and decrease in mean paw thickness (5.346 ± 0.399 mm; p < 0.001, 5.678 ± 0.291 mm; p < 0.001, 5.878 ± 0.421 mm; p < 0.01, and 4.922 ± 0.467 mm; p < 0.001 correspondingly) compared to the A. Ctrl group. However, the extent of this inhibition and reduction in mean paw size was less pronounced when it was compared with the group in which QA was administered in combination with the standard drug.
Table 3
Effect of quinic acid on paw thickness and % inhibition in paw edema in FCA-induced arthritic rats
Groups
V. Ctrl
mm
A. Ctrl
mm
RDMTX
mm
LDQA 25 mg/kg
mm
MDQA 50 mg/kg
mm
HDQA 100 mg/kg mm
HDQA 100 mg/kg + RDMTX
mm
Day 0
3.640 ± 0.268
3.658 ± 0.195
3.678 ± 
0.238
3.726 ± 0.183
3.652 ± 
0.163
3.710 ± 
0.110
3.694 ± 
0.220
Day 8
3.634 ± 
0.273
7.924 ± 
0.288###
7.726 ± 
0.337
7.640 ± 
0.302
7.776 ± 
0.350
7.752 ± 
0.407
7.758 ± 
0.322
Day 13
3.632 ± 
0.270
7.594 ± 
0.353###
6.656 ± 
0.519*
(23.57%)
6.922 ± 0.537
(16.74%)
6.850 ± 
0.490
(17.82%)
6.748 ± 
0.490
(19.93%)
6.494 ± 
0.484*
(27.99%)
Day 18
3.600 ± 
0.253
6.998 ± 
0.404###
5.878 ± 
0.264***
(33.35%)
6.226 ± 
0.381*
(22.80%)
6.152 ± 
0.486*
(24.14%)
6.012 ± 
0.489**
(27.77%)
5.674 ± 
0.219***
(39.84%)
Day 23
3.598 ± 
0.252
6.752 ± 
0.296###
4.922 ± 
0.467***
(59.31%)
5.878 ± 
0.421**
(27.98%)
5.678 ± 0.291***
(33.55%)
5.346 ± 
0.399***
(43.77%)
4.704 ± 
0.244***
(66.78%)
V.Ctrl: vehicle control; A.Ctrl: arthritic control; RDMTX: reference drug methotrexate; LDQA25mg/kg: low-dose quinic acid; MDQA 50 mg/kg medium-dose quinic acid; HDQA 100 mg/kg: high-dose quinic acid; HDQA 100 mg/kg + RDMTX: high-dose quinic acid combined with methotrexate

Effect of quinic acid on arthritic score in FCA-induced arthritic rats

The arthritic score was increased in all groups excluding the V. Ctrl group on the 8th day, as no disease was introduced in the V. Ctrl group, and the readings of this group’s rats were taken as 0. On day 13, 18, and 23, the arthritic score was gradually decreased in all the treatment groups in contrast to the A. Ctrl group, whereas an increase was observed in the arthritic control group throughout the study. On the 23rd day, among all treatment group rats, the group in which HDQA100mg/kg was combined with RDMTX exhibited the most substantial reduction (p < 0.001) in arthritic score when compared to A. Ctrl rats, as shown in Fig. 2.
Fig. 2
Effect of quinic acid treatment on FCA-induced changes in arthritic score (A) and joint stiffness score (B) in FCA-induced arthritic rats
Bild vergrößern

Effect of quinic acid on joint stiffness score in FCA-induced arthritic rats

Joint stiffness score (Fig. 2) was increased across all groups except the V. Ctrl group rats on the 8th day. In the V. Ctrl group, the readings were taken as 0, as no disease was induced. Joint stiffness score was gradually increased in the A. Ctrl group as compared to the V. Ctrl group, while treatment with various doses of QA (25 mg/kg, 50 mg, and 100 mg) and RDMTX decreased the joint stiffness score on the 13th, 18th, and 23rd days, but this drop was not statistically significant in contrast to the A. Ctrl group rats. HDQA100mg/kg combined with RDMTX was significantly most effective in reducing the joint stiffness score (p < 0.001) relative to A. Ctrl rats by the 23rd day.

Effect of quinic acid on hematological parameters

Effect of quinic acid on Hb content in FCA-induced arthritic rats

The A. Ctrl rats exhibited a significant reduction (9.26 ± 0.703 g/dL; p < 0.001) in Hb content relative to the V. Ctrl group rats (15.27 ± 0.357 g/dL). The rats treated with RDMTX (13.38 ± 0.497 g/dL; p < 0.001) and LDQA 25 mg/kg (10.90 ± 0.678 g/dL; p < 0.01), MDQA 50 mg/kg (12.02 ± 0.835 g/dL; p < 0.001), HDQA100mg/kg (13.48 ± 0.536 g/dL; p < 0.001), and HDQA100mg/kg + RDMTX (14.96 ± 0.241 g/dL; p < 0.001) showed significant improvement in Hb content in contrast to the A. Ctrl group (Table 4).
Table 4
Effect of quinic acid on the hematological parameters in FCA-induced arthritic rats
Parameters
V. Ctrl
A. Ctrl
RDMTX
LDQA 25 mg/kg
MDQA 50 mg/kg
HDQA 100 mg/kg
HDQA 100 mg/kg + RDMTX
Hb content (g/dL)
15.27 ± 
0.357
9.26 ± 
0.709
###
13.38 ± 
0.497
***
10.90 ± 
0.678**
12.02 ± 
0.835***
13.48 ± 
0.536***
14.96 ± 
0.249***
RBC count (109/L)
7.82 ± 
0.311
4.20 ± 
0.430
###
6.84 ± 
0.398
***
5.44 ± 
0.654**`
5.70 ± 
0.436***
6.72 ± 
0.449***
7.76 ± 
0.351***
TLC (103/µL)
9.28 ± 
0.646
15.42 ± 
0.526
###
10.64 ± 
0.518
***
14.00 ± 
0.387**
12.92 ± 
0.335***
11.84 ± 
0.669***
9.50 ± 
0.604***
Platelet count (103/µL)
715.2 ± 
61.71
1431.0 ± 
53.030###
961.8 ± 
62.010
***
1293.0 ± 
34.370
**
1185.0 ± 
68.72
***
1082.0 ± 
30.360
***
827.4 ± 
35.390
***
V.Ctrl: vehicle control; A.Ctrl: arthritic control; RDMTX: reference drug methotrexate; LDQA25mg/kg: low-dose quinic acid; MDQA 50 mg/kg medium-dose quinic acid; HDQA 100 mg/kg: high-dose quinic acid; HDQA 100 mg/kg + RDMTX: high-dose quinic acid combined with methotrexate

Effect of quinic acid on RBC count in FCA-induced arthritic rats

The A. Ctrl rats displayed a significant decline (4.20 ± 0.430 × 109/L; p < 0.001) in RBC count relative to the V. Ctrl group rats (7.82 ± 0.311 × 109/L). The rats treated with RDMTX (6.84 ± 0.398 × 109/L; p < 0.001) and LDQA 25 mg/kg (5.44 ± 0.654 × 109/µL; p < 0.01), MDQA 50 mg/kg (5.70 ± 0.436 × 109/L; p < 0.001), HDQA100mg/kg (6.72 ± 0.449 × 109/L; p < 0.001), and HDQA100mg/kg + RDMTX (7.76 ± 0.351 × 109/L; p < 0.001) exhibited significant improvement in RBC count in contrast to the A. Ctrl group (Table 4).

Effect of quinic acid on TLC in FCA-induced arthritic rats

The A. Ctrl rats exhibited a significantly elevated (15.42 ± 0.526 × 103/µL; p < 0.001) total leucocyte count in comparison to the V. Ctrl group rats (9.28 ± 0.646 × 103/µL). The rats treated with RDMTX (10.64 ± 0.518 × 103/µL; p < 0.001) and LDQA 25 mg/kg (14.00 ± 0.387 × 103/µL; p < 0.01), MDQA 50 mg/kg (12.92 ± 0.335 × 103/µL; p < 0.001), HDQA100mg/kg (11.84 ± 0.669 × 103/µL; p < 0.001), and HDQA100mg/kg + RDMTX (9.50 ± 0.604 × 103/µL; p < 0.001) showed a substantial decrease in total leucocyte count in contrast to the A. Ctrl group (Table 4).

Effect of quinic acid on platelet count in FCA-induced arthritic rats

The A. Ctrl rats showed a significantly elevated (1431.0 ± 53.030 × 103/µL; p < 0.001) platelet count in comparison to the V. Ctrl group rats (715.2 ± 61.710 × 103/µL). The rats treated with RDMTX (961.8 ± 62.010 × 103/µL; p < 0.001) and LDQA 25 mg/kg (1293.0 ± 34.370 × 103/µL; p < 0.01), MDQA 50 mg/kg (1185.0 ± 68.720 × 103/µL; p < 0.001), HDQA100mg/kg (1082.0 ± 30.360 × 103/µL; p < 0.001), and HDQA100mg/kg + RDMTX (827.4 ± 35.390 × 103/µL; p < 0.001) displayed significant reduction in platelet count in contrast to the A. Ctrl group (Table 4).

Effect of quinic acid on lipid profile levels

Effect of quinic acid on total cholesterol levels in FCA-induced arthritic rats

The levels of total cholesterol were increased significantly (199.0 ± 1.750 mg/dL; p < 0.001) in the A. Ctrl rats as compared to V. Ctrl rats (90.2 ± 10.830 mg/dL). The rats treated with RDMTX (124.2 ± 11.230 mg/dL; p < 0.001) and LDQA 25 mg/kg (167.4 ± 10.990 mg/dL; p < 0.01), MDQA 50 mg/kg (153.0 ± 10.490 mg/dL; p < 0.001), HDQA100mg/kg (128.0 ± 9.407 mg/dL; p < 0.001), and HDQA100mg/kg + RDMTX (97.4 ± 11.760 mg/dL; p < 0.001) presented a significant decrease in total cholesterol level in contrast to the A. Ctrl group (Table 5).
Table 5
Effect of quinic acid on the lipid profile in FCA-induced arthritic rats
Parameters
V. Ctrl
A. Ctrl
RDMTX
LDQA 25 mg/kg
MDQA 50 mg/kg
HDQA 100 mg/kg
HDQA 100 mg/kg + RDMTX
Total cholesterol (mg/dL)
90.2 ± 
10.830
199.0 ± 
11.750
###
124.2 ± 
11.230
***
167.4 ± 
10.990**
153.0 ± 
10.490***
128.0 ± 
9.407***
97.4 ± 
11.760***
Triglycerides (mg/dL)
62.0 ± 
9.192
145.8 ± 
12.130###
96.6 ± 
9.839
***
122.4 ± 
6.877*
114.6 ± 
11.520**
93.8 ± 
11.300***
71.2 ± 
12.850***
HDL levels (mg/dL)
72.6 ± 
5.941
32.0 ± 
5.292
###
65.4 ± 
3.362
***
43.6 ± 
2.074**
52.6 ± 
4.393***
63.6 ± 
4.037***
71.6 ± 
3.050***
LDL levels (mg/dL)
24.0 ± 
3.674
54.2 ± 
2.864
###
32.6 ± 
2.702
***
46.6 ± 
2.074**
40.4 ± 
2.302***
36.2 ± 
1.924***
27.2 ± 
2.588***
VLDL levels (mg/dL)
19.4 ± 
2.074
42.2 ± 
2.387
###
25.4 ± 
1.140
***
36.0 ± 
1.581
***
32.2 ± 
2.387***
29.4 ± 
2.074***
22.2 ± 
2.387***
V.Ctrl: vehicle control; A.Ctrl: arthritic control; RDMTX: reference drug methotrexate; LDQA25mg/kg: low-dose quinic acid; MDQA 50 mg/kg medium-dose quinic acid; HDQA 100 mg/kg: high-dose quinic acid; HDQA 100 mg/kg + RDMTX: high-dose quinic acid combined with methotrexate

Effect of quinic acid triglycerides levels in FCA-induced arthritic rats

The triglycerides levels were elevated significantly (145.8 ± 12.130 mg/dL; p < 0.001) in the A. Ctrl rats as compared to V. Ctrl rats (62.0 ± 9.192 mg/dL). The rats treated with RDMTX (124.2 ± 11.230 mg/dL; p < 0.001) and LDQA 25 mg/kg (167.4 ± 10.990 mg/dL; p < 0.05), MDQA 50 mg/kg (153.0 ± 10.490 mg/dL; p < 0.001), HDQA100mg/kg (128.0 ± 9.407 mg/dL; p < 0.001), and HDQA100mg/kg + RDMTX (97.4 ± 11.760 mg/dL; p < 0.001) demonstrated a significant decline in total cholesterol level in comparison to the A. Ctrl group rats (Table 5).

Effect of quinic acid HDL levels in FCA-induced arthritic rats

The HDL levels were significantly lowered (32.0 ± 5.292 mg/dL; p < 0.001) in A. Ctrl rats relative to V. Ctrl rats (72.6 ± 5.91 mg/dL). The rats treated with RDMTX (65.4 ± 3.362 mg/dL; p < 0.001) and LDQA 25 mg/kg (43.6 ± 2.074 mg/dL; p < 0.01), MDQA 50 mg/kg (52.6 ± 4.393 mg/dL; p < 0.001), HDQA100mg/kg (63.6 ± 4.037 mg/dL; p < 0.001), and HDQA100mg/kg + RDMTX (71.6 ± 3.050 mg/dL; p < 0.001) displayed a significantly improved HDL level in contrast to the A. Ctrl group rats (Table 5).

Effect of quinic acid on LDL levels in FCA-induced arthritic rats

The LDL levels were elevated significantly (54.2 ± 2.864 mg/dL; p < 0.001) in FCA-induced arthritic rats in contrast to V. Ctrl rats (24.0 ± 3.674 mg/dL). The levels of LDL were: RDMTX (32.6 ± 2.702 mg/dL; p < 0.001); LDQA 25 mg/kg (46.6 ± 2.074 mg/dL; p < 0.01); MDQA 50 mg/kg (40.4 ± 2.302 mg/dL; p < 0.001); HDQA100mg/kg (36.2 ± 1.924 mg/dL; p < 0.001); and HDQA 100 mg/kg + RDMTX (27.2 ± 2.588 mg/dL; p < 0.001) (Table 5).

Effect of quinic acid VLDL levels in FCA-induced arthritic rats

The VLDL levels were significantly greater (42.2 ± 2.387 mg/dL; p < 0.001) in FCA-induced arthritic rats in comparison to V. Ctrl rats (19.4 ± 2.074 mg/dL). The levels of VLDL were: RDMTX (25.4 ± 1.140 mg/dL; p < 0.001); LDQA (25 mg/kg, 36.0 ± 1.581; p < 0.001); MDQA 50 mg/kg (32.2 ± 2.387 mg/dL; p < 0.001); HDQA 100 mg/kg (29.4 ± 2.074 mg/dL; p < 0.001); and HDQA 100 mg/kg + RDMTX (22.2 ± 2.387 mg/dL; p < 0.001). The levels were significantly improved relative to those in the A. Ctrl group (Table 5).

Effect of quinic acid on ADMA concentration in FCA-induced arthritic rats

The ADMA concentration was elevated significantly (2.1380 ± 0.0458 µmol/L; p < 0.001) in FCA-induced arthritic rats in comparison to V. Ctrl rats (1.0440 ± 0.0404 µmol/L). The concentration of ADMA was: RDMTX (1.3000 ± 0.0346 µmol/L; p < 0.001); LDQA 25 mg/kg (1.9170 ± 0.0762 µmol/L; p < 0.001); MDQA 50 mg/kg (1.7800 ± 0.0948 µmol/L; p < 0.001); HDQA 100 mg/kg (1.4290 ± 0.0633 µmol/L; p < 0.001); and HDQA 100 mg/kg + RDMTX (1.0730 ± 0.0568 µmol/L; p < 0.001) as shown in Fig. 3.
Fig. 3
Effect of quinic acid treatment on ADMA concentration (A) and homocysteine concentration (B) in FCA-induced arthritic rats
Bild vergrößern

Effect of quinic acid on homocysteine concentration in FCA-induced arthritic rats

The results showed elevated homocysteine concentration (10.020 ± 0.3790 nmol/mL; p < 0.001) in FCA-induced arthritic rats in comparison to V. Ctrl rats (4.701 ± 0.3496 nmol/mL). These levels were significantly decreased after treatment with RDMTX (6.114 ± 0.3530 nmol/mL; p < 0.001), LDQA 25 mg/kg (7.586 ± 0.3017 nmol/mL; p < 0.001), MDQA 50 mg/kg (6.901 ± 0.1588 nmol/mL nmol/mL; p < 0.001), HDQA 100 mg/kg (5.724 ± 0.2407 nmol/mL; p < 0.001), and HDQA 100 mg/kg + RDMTX (5.089 ± 0.2877 nmol/mL; p < 0.001) relative to the A. Ctrl group, as shown in Fig. 3.

Effect of quinic acid on oxidative stress markers

Effect of qQuinic acid on SOD activity in FCA-induced arthritic rats

The SOD activity was significantly decreased (122.5 ± 10.930 U/mL; p < 0.001) in A. Ctrl rats relative to V. Ctrl rats (242.4 ± 13.040 U/mL). The levels of SOD were significantly improved by treatment with RDMTX (202.8 ± 8.949 U/mL; p < 0.001), LDQA 25 mg/kg (151.8 ± 9.627 U/mL; p < 0.01), MDQA 50 mg/kg (164.6 ± 9.436 U/mL; p < 0.001), HDQA 100 mg/kg (193.5 ± 17.840 U/mL; p < 0.001), and HDQA 100 mg/kg + RDMTX (233.6 ± 9.993 U/mL; p < 0.001) as compared to the A. Ctrl group rats, as shown in Fig. 4.

Effect of quinic acid on CAT level in FCA-induced arthritic rats

The CAT level was significantly decreased (37.07 ± 3.216 U/mL; p < 0.001) in A. Ctrl rats relative to V. Ctrl rats (88.69 ± 2.665 U/mL). The treatment with RDMTX (67.32 ± 2.592 U/mL; p < 0.001), LDQA 25 mg/kg (48.14 ± 1.395 U/mL; p < 0.001), MDQA 50 mg/kg (56.80 ± 2.554 U/mL; p < 0.001), HDQA 100 mg/kg (66.45 ± 1.537 U/mL; p < 0.001), and HDQA 100 mg/kg + RDMTX (73.23 ± 2.345 U/mL; p < 0.001) significantly ameliorated the level of CAT in contrast to A. Ctrl group rats, as shown in Fig. 4.
Fig. 4
Effect of quinic acid treatment on oxidative stress markers, SOD activity (A), CAT activity (B), MDA level (C), GSH level (D), and nitrite level (E) in FCA-induced arthritic rats
Bild vergrößern

Effect of quinic acid on MDA level in FCA-induced arthritic rats

The effect of QA on lipid peroxidation was assessed by the measurement of serum MDA levels. The level of MDA was significantly elevated (4.882 ± 0.240 nmol/mL; p < 0.001) in A. Ctrl rats relative to V. Ctrl rats (2.641 ± 0.453 nmol/mL). The treatment with RDMTX (3.287 ± 0.270 nmol/mL; p < 0.001), LDQA 25 mg/kg (4.097 ± 0.3345 nmol/mL; p < 0.01), MDQA 50 mg/kg (3.920 ± 0.336 nmol/mL; p < 0.001), HDQA 100 mg/kg (3.193 ± 0.267 nmol/mL; p < 0.001), and HDQA 100 mg/kg + RDMTX (2.708 ± 0.161 nmol/mL; p < 0.001) significantly reduced the MDA level in comparison to A. Ctrl group rats, as shown in Fig. 4.

Effect of quinic acid on GSH level in FCA-induced arthritic rats

The level of GSH was significantly reduced (46.89 ± 3.536 nmol/mL; p < 0.001) in A. Ctrl rats relative to V. Ctrl rats (89.46 ± 5.209 nmol/mL). The treatment was as follows: with RDMTX (78.54 ± 3.802 nmol/mL; p < 0.001), LDQA 25 mg/kg (60.75 ± 5.293 nmol/mL; p < 0.001), MDQA 50 mg/kg (72.61 ± 3.184 nmol/mL; p < 0.001), HDQA 100 mg/kg (79.11 ± 3.996 nmol/mL; p < 0.001), and HDQA 100 mg/kg + RDMTX (87.75 ± 2.508 nmol/mL; p < 0.001), as shown in Fig. 4.

Effect of quinic acid on nitrite level in FCA-induced arthritic rats

The level of nitrite was significantly increased (47.36 ± 2.711 nmol/mL; p < 0.001) in A. Ctrl rats relative to V. Ctrl rats (13.53 ± 2.612 nmol/mL). The treatment with RDMTX (26.45 ± 4.219 nmol/mL; p < 0.001), LDQA 25 mg/kg (38.80 ± 3.032 nmol/mL; p < 0.01), MDQA 50 mg/kg (32.61 ± 2.844 nmol/mL; p < 0.001), HDQA 100 mg/kg (20.89 ± 2.149 nmol/mL; p < 0.001), and HDQA 100 mg/kg + RDMTX (15.26 ± 2.514 nmol/mL; p < 0.001) significantly decreased the level of nitrite in contrast to A. Ctrl group rats, as shown in Fig. 4.

Effect of quinic acid on inflammatory markers

Effect of quinic acid on TNF-α expression levels in FCA-induced arthritic rats

The mRNA expression of TNF-α was significantly increased and fold change was observed to be 2.789 ± 0.2258; p < 0.001 in A. Ctrl rats as compared to V. Ctrl rats (1.009 ± 0.1523). The treatment with RDMTX (1.378 ± 0.1832; p < 0.001), LDQA 25 mg/kg (1.702 ± 0.2337;p < 0.001), MDQA 50 mg/kg (1.517 ± 0.1430; p < 0.001), HDQA 100 mg/kg (1.336 ± 0.2101; p < 0.001), and HDQA 100 mg/kg + RDMTX (1.155 ± 0.0792; p < 0.001) significantly decreased the fold change of TNF-α in contrast to A. Ctrl group rats (Fig. 5).
Fig. 5
Effect of quinic acid treatment on mRNA expression of inflammatory markers, TNF- α (A), 1L-6 (B), 1L-1 β (C), DDAH1 (D), and CST (E) in FCA-induced arthritic rats
Bild vergrößern

Effect of quinic acid on IL-6 expression levels in FCA-induced arthritic rats

The mRNA expression levels of IL-6 were significantly elevated and fold change was observed to be 3.070 ± 0.2038; p < 0.001 in A. Ctrl rats in contrast to V. Ctrl rats (1.006 ± 0.1192). The treatment with RDMTX (1.513 ± 0.2823; p < 0.001), LDQA 25 mg/kg (2.373 ± 0.1816; p < 0.001), MDQA 50 mg/kg (2.018 ± 0.2917; p < 0.001), HDQA 100 mg/kg (1.494 ± 0.2436; p < 0.001), and HDQA100mg/kg + RDMTX (1.171 ± 0.1092; p < 0.001) significantly decreased the fold change of IL-6 relative to A. Ctrl group rats, as shown in Fig. 5.

Effect of quinic acid on IL-1β expression levels in FCA-induced arthritic rats

The mRNA expression levels of IL-1β levels were significantly raised and fold change was found to be 2.970 ± 0.2015; p < 0.001 in A. Ctrl rats in contrast to V. Ctrl rats (1.002 ± 0.0714). The treatment with RDMTX (1.427 ± 0.1357; p < 0.001), LDQA 25 mg/kg (2.141 ± 0.1702; p < 0.001), MDQA 50 mg/kg (1.899 ± 0.1883; p < 0.001), HDQA 100 mg/kg (1.519 ± 0.0738; p < 0.001), and HDQA 100 mg/kg + RDMTX (1.204 ± 0.0653; p < 0.001) significantly reduced the fold change of IL-1β as compared to A. Ctrl group rats, as shown in Fig. 5.

Effect of quinic acid on DDAH1expression levels in FCA-induced arthritic rats

The mRNA expression levels of DDAH-1 were significantly lowered and the fold change was found to be 0.276 ± 0.0508; p < 0.001 in A. Ctrl rats in contrast to V. Ctrl rats (1.003 ± 0.0794). The treatment with RDMTX (0.681 ± 0.0882; p < 0.001), LDQA 25 mg/kg (0.498 ± 0.0306; p < 0.001), MDQA 50 mg/kg (0.620 ± 0.0924; p < 0.001), HDQA 100 mg/kg (0.657 ± 0.0657; p < 0.001), and HDQA 100 mg/kg + RDMTX (0.941 ± 0.0823; p < 0.001) significantly improved the fold change of DDAH-1 as compared to A. Ctrl group rats, as shown in Fig. 5.

Effect of Quinic Acid on CST expression levels in FCA-induced arthritic rats

The mRNA expression levels of cortistatin were significantly decreased and fthe old change was found to be 0.3066 ± 0.0374; p < 0.001 in A. Ctrl rats in contrast to V. Ctrl rats (1.002 ± 0.0630). The treatment with RDMTX (0.807 ± 0.0574; p < 0.001), LDQA 25 mg/kg (0.554 ± 0 0.0273; p < 0.01), MDQA 50 mg/kg (0.640 ± 0.0493; p < 0.001), HDQA 100 mg/kg (0.802 ± 0.0580; p < 0.001), and HDQA 100 mg/kg + RDMTX (0.907 ± 0.0254; p < 0.001) significantly elevated the fold change of cortistatin as compared to A. Ctrl group rats, as shown in Fig. 5.

Effect of quinic acid on the histopathological parameters

Effect of quinic acid on histopathological changes in ankle joint tissues in FCA-induced arthritic rats

Figure 6 shows that a significant (p < 0.001) increase in the severity of score of bone erosion, cartilage erosion, synovial membrane hyperplasia, infiltration of inflammatory cells, and pannus formation was observed in A. Ctrl rats as compared to V. Ctrl rats. Treatment with different doses of QA and RDMTX attenuated all the arthritic parameters, but the combination dose group (HDQA100mg/kg + RDMTX) displayed the most significant (p < 0.001) decrease in the score of bone erosion, cartilage erosion, synovial hyperplasia, infiltration of inflammatory cells, and pannus formation as compared to A. Ctrl group rats.
Fig. 6
Photomicrographs showing the histopathological section of ankle joint tissue of rats of all the experimental group (10×, H&E staining). Pannus formation (orange arrow), infiltration of inflammatory cells (yellow arrow), cartilage (black arrow), bone (blue arrow), and synovial membrane (green arrow) (color figure online)
Bild vergrößern

Effect of quinic acid on histopathological changes in the arteries of ankle joint and cardiac tissues in FCA-induced arthritic rats

Figure 7 (Left aligned figures and right aligned figures) represents that A. Ctrl rats exhibited significant (p < 0.001) increase in the score of vascular congestion in arteries of the ankle joint and cardiac tissues as compared to V. Ctrl rats. Treatment with different doses of QA and RDMTX decreased the score of vascular congestion, but combination dose group (HDQA100mg/kg + RDMTX) displayed the most significant (p < 0.001) decrease in score as compared to A. Ctrl group rats.
Fig. 7
Photomicrographs showing the histopathological section of artery of rats of all the experimental group (40×, H&E staining) (left aligned figures). Photomicrograph showing the histopathological section of arteries of cardiac tissue of rats of all the experimental group (10× & 40×, H &E staining) (right aligned figures)
Bild vergrößern

Effect of quinic acid on histopathological changes in cardiac tissues in FCA-induced arthritic rats

Figure 8 represents that A. Ctrl rats showed distorted histoarchitecture of cardiac muscle fibers that was evident by splitting and degeneration of cardiac muscle fibers. There was evidence of infiltration of inflammatory cells. Hemorrhage was evident by the presence of extensive extravascular red blood cells in the cardiac muscles as compared to V. Ctrl rats. Treatment with different doses of QA and RDMTX decreased the splitting, hemorrhage, and infiltration of inflammatory cells, but the combination dose group (HDQA100mg/kg + RDMTX) displayed the most significant (p < 0.001) decrease in the score of hemorrhage and infiltration of inflammatory cells as compared to A. Ctrl group rats.
Fig. 8
Photomicrographs showing the histopathological section of cardiac muscle fibers of rats of all the experimental group (40×, H&E staining). Splitting and degeneration of cardiac muscle fiber (black arrows), infiltration of inflammatory cells (green arrow), and hemorrhage (yellow arrows) (color figure online)
Bild vergrößern

Discussion

In spite of advancements in the treatment of arthritis, many patients still experience significant morbidity and mortality, particularly due to associated complications such as atherosclerosis (Di Franco et al. 2018). Adjuvant-induced arthritic rat model is a recognized model and frequently utilized to discover the underlying mechanism of polyarthritis and assess potential therapeutic interventions. The model closely resembles human arthritis because of the role of serological, pathological changes and inflammatory mediators which are similar in the human and rat models (Naz et al. 2020). Based on our insight, the already available treatments may not fully focus on the underlying inflammatory processes driving both polyarthritis and predisposing biomarkers of atherosclerosis. The study findings revealed the potential therapeutic effect of QA in alleviating inflammation and oxidative stress that are the main contributors in the pathogenesis of polyarthritis and might affect atherosclerosis.
Combination therapy leads to more significant reduction in clinical features than a treatment with drug that is taken alone. Methotrexate is the first choice of DMARDs, but due to its adverse effect its use is limited (Li et al. 2018). A combination of QA and MTX was used to attenuate the MTX-associated adverse effects. The current study demonstrated that a combination of HDQA + RDMTX provided better control of polyarthritis along with a reduction of the likelihood of atherosclerosis.
The decrease in the weight of FCA-treated rats is associated with increased inflammatory cytokines and enhanced metabolic rate, which activates proteolytic pathway that could be responsible for weight loss and muscle wastage (Farrow et al. 2021). Upon administration of experimental drugs (QA, RDMTX), an increase in the body weight of all treated rats could be attributed to decreased levels of inflammatory cytokines that might activate the pathways responsible for weight loss. The rats treated with HDQA + RDMTX exhibited an increased trend in gaining weight that is close to the V. Ctrl group as compared to the FCA-untreated group.
FCA induction is associated with chronic inflammation that is manifested as increased paw size initiating a biphasic response. Edema was developed in the acute phase, possibly due to an irritation reaction of adjuvant that was accompanied by the release of inflammatory mediators which occurred in the first 10 days. The chronic phase was followed by an immunologic response that persisted for months (Ijaz et al. 2021). The paw edema, paw thickness, and arthritic and joint stiffness scores were employed as macroscopic parameters to evaluate the inflammatory progression in FCA-induced rats. The treatment with QA, MTX, as well as HDQA 100 mg/kg combined with RDMTX resulted in the reduction of percentage paw edema and paw size thickness that was accompanied by an improvement of the arthritic score and joint stiffness as compared to the A. Ctrl group.
Anemia is often seen with arthritis that is characterized by low levels of Hb content and RBCs. Anemia occurs due to the storage defect of iron and the incapability of bone marrow to produce sufficient cells (Jarlborg and Gabay 2022; Mahnashi et al. 2021). Our findings revealed that QA and RDMTX treatment normalized the Hb content and RBC count instead of A. Ctrl rats, which showed a decline in Hb content and RBC count. In polyarthritis, antigen attack causes activation of the immune system that leads to increase in the level of leucocyte and platelets (Anwar et al. 2025). Our study demonstrated that treatment with QA and RDMTX decreased the level of leucocytes and platelets as compared to  A. Ctrl rats.
Polyarthritis is linked to dyslipidemia, suggesting that changes in the lipoprotein levels above or below the normal values makes animals more prone to the atherosclerosis development. HDL is a vital plasma lipoprotein that is involved in the elimination of cholesterol (Ahmad et al. 2016). Previous studies had also revealed that protection against inflammatory-related diseases, such as polyarthritis and atherosclerosis, can be provided by therapeutic agents which reduce serum LDL, TC, VLDL, and TG and enhance HDL levels. It could be helpful to lessen cardiovascular morbidity and mortality (Anyasor et al. 2015). Our results exhibited substantial decrease in LDL, TC, VLDL, and TG contents and increased HDL levels that indicated that QA might be helpful in the treatment of dyslipidemia associated with polyarthritis.
Inflammation markers in polyarthritis are not only responsible for joint inflammation, but also increase ADMA production. Elevated ADMA levels are suggested as potential indicators of cardiovascular comorbidity, especially atherosclerosis in arthritis (Di Franco et al. 2018). ADMA is primarily degraded by an enzyme DDAH1, and reduced DDAH1 activity is likely to result in increased ADMA levels (Shen et al. 2022). Our study results demonstrated that treatment with QA and RDMTX decreased the level of ADMA and may protect endothelial dysfunction in contrast to A. Ctrl rats. The results of our study also showed elevated mRNA expression of DDAH1 levels that might be due to due to the modulation of the DDAH/ADMA system as compared to A. Ctrl rats.
Methotrexate inhibits folic acid which is responsible for the catabolism of homocysteine; thus, low level of folic acid leads to hyperhomocysteinemia (Garg et al. 2024). High levels of hcy promoted inflammation by inducing the synoviocytes to produce pro-inflammatory cytokines and exert toxic effects directly on endothelial cells, accelerating atherosclerosis (El Bouchti et al. 2008). Our study results demonstrated that QA treatment decreased the hcy level, which might be attributed to increase level of folic acid, which increased the catabolism of hcy as compared to A. Ctrl rats that showed increase in the levels of hcy.
Oxidative stress appears as a secondary messenger in inflammation and immune cellular response, and is responsible for joint damage in polyarthritis. The production of ROS is regulated by various antioxidant defense mechanism of the body that includes catalase, SOD, and glutathione reductase. Other considerable oxidative stress indicators besides antioxidant enzymes are malondialdehyde (MDA) and NO (Ali et al. 2024). MDA is an aldehydic secondary product, produced by lipid peroxidation and regarded as a marker for oxidative stress (Fadoju et al. 2019). Increased oxidative stress resulted in the depletion of antioxidant defense and stimulated the production of pro-inflammatory cytokines that leads to enhanced level of numerous inducible enzymes involving inducible nitric oxide synthase (iNOS) associated with increased nitric oxide (NO) production (Tseuguem et al. 2019). The outcomes of our research indicated that QA and RDMTX effectively reduce ROS production by improving the oxidative defense system in FCA-induced arthritic rats, that is, lead to increased SOD, CAT, and GHS levels and reduced MDA and nitrite levels. This revealed that QA showed antioxidant properties that might be due to scavenging free radicals.
The pro-inflammatory cytokines are associated with the pathogenesis of arthritis. The exaggerated inflammatory response, after sequential activation of TNF-α, triggers the discharge of IL-1β and IL-6 (Gul et al. 2023; Mateen et al. 2016). Besides TNF-α, IL-6, and IL1-β, cortistatin (CST), a natural cyclic neuropeptide, is a powerful anti-inflammatory substance that can inactivate inflammatory response. CST works by preventing macrophage activation and reduces the activity and production of pro- inflammatory cytokines by competitively binding to TNF-α receptors (Atalay 2017). The findings of our research demonstrated that QA and RDMTX treatment resulted in the reduction of inflammatory cytokine mRNA expressions relative to A. Ctrl rats, due to reduction of pro-inflammatory cytokines. Moreover, elevated CST mRNA expression levels were recorded in treatment groups relative to A. Ctrl group. Thus, the reduction of these pro-inflammatory cytokines and elevation of CST showed that QA might be used successfully to prevent the inflammation of joints.
A noticeable inflammation was detected in the left hind paw of rats that were inoculated with FCA. It might be due to the immune cells that are transported to FCA injected site in the acute phase of inflammation. Afterward, pro-inflammatory cytokine production facilitates pannus formation, damage to cartilage and bone, and synovial hyperplasia in the chronic phase of inflammation (Anwar et al. 2025). The results of our study showed that QA and RDMTX attenuated all the histopathological arthritic markers as compared to A. Ctrl rats that exhibited increase in cartilage erosion, bone erosion, pannus formation, inflammatory cell infiltration, and synovial hyperplasia.
Histopathological evaluation of arteries in paw tissues and heart demonstrated that treatment with different doses of QA and RDMTX showed mild to moderate vascular congestion or absence of vascular congestion that might be attributed to decreased infiltration of immune cells into tissues, which can prevent vascular congestion as compared to disease control group. The disease control group showed severe vascular congestion in both arteries of paw and heart tissues.
The abnormal histoarchitecture, inflammation. and hemorrhage in cardiac muscle showed cardiac cells damage that might be due to excessive ROS formation that causes oxidation of cardiac cell leading to its damage (Kurnijasanti et al. 2023). The disease control rats exhibited distorted histoarchitecture of cardiac muscle fibers, infiltration of inflammatory cells, and hemorrhage. The hemorrhage presence may have indicated vasoconstriction and vascular damage of small arterial vessels. The treatment with QA improves the histopathological changes in cardiac muscle fibers as compared to the disease control group.

Conclusion

The present study data suggested that QA has anti-arthritic properties and also possesses the ability to reduce the predisposing biomarkers of atherosclerosis. It is evident from the significant reduction in paw size, arthritic and joint stiffness score, as well as the normalization of altered hematological and lipid parameters and modulation of oxidative stress and inflammatory markers. Additionally, QA significantly reduced the concentration of the predisposing biomarkers of atherosclerosis such as ADMA and homocysteine, along with improvement in the histopathological parameters of the heart. The most effective results were observed when QA was given in combination with standard drug methotrexate. Based on the reduction in atherosclerotic biomarkers, hypolipidemic effect, anti-inflammatory and antioxidant activities, it is an appropriate choice for the management of polyarthritis and predisposing biomarkers of atherosclerosis. To confirm these results and completely elucidate the safety and effectiveness of QA in humans, more clinical studies are needed.

Acknowledgements

Not applicable.

Declarations

Competing interests

The authors have no relevant financial or non-financial interests to disclose.
Not applicable.

Declaration of generative AI and AI-assisted technologies in the writing process

No AI tool was used in the preparation of this manuscript.

Data Availability Statement; The data that support the findings of this study are available on request from the corresponding author. Ethics approval and consent to participate

The study was conducted followed by the approval of Institutional Research Ethical Committee of Lahore College for Women University, Lahore (ORIC/LCWU/41-24 in accordance with the NC3Rs ARRIVE Guidelines, adhering to the ethical guidelines of The Basel Declaration, the International Council for Laboratory Animal Science (ICLAS) ethical guidelines, and Directive 2010/63/EU).
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Download
Titel
Quinic acid alleviates inflammatory responses and oxidative stress in Freund’s complete adjuvant-induced arthritic rat model and associated risk factors of atherosclerosis
Verfasst von
Iqra
Ali Sharif
Bushra Akhtar
Chuxiao Shao
Shuanghu Wang
Ayesha Younas
Publikationsdatum
03.10.2025
Verlag
Springer International Publishing
Erschienen in
Inflammopharmacology / Ausgabe 11/2025
Print ISSN: 0925-4692
Elektronische ISSN: 1568-5608
DOI
https://doi.org/10.1007/s10787-025-01930-8
Zurück zum Zitat Abdel-Maged AE, Gad AM, Wahdan SA, Azab SSJT, Pharmacology A (2019) Efficacy and safety of Ramucirumab and methotrexate co-therapy in rheumatoid arthritis experimental model: involvement of angiogenic and immunomodulatory signaling. 380:114702
Zurück zum Zitat Ahmad S, Alam K, Hossain MM, Fatima M, Firdaus F, Zafeer MF, Arif Z, Ahmed M, Nafees KJM, Biochemistry C (2016) Anti-arthritogenic and cardioprotective action of hesperidin and daidzein in collagen-induced rheumatoid arthritis. 423:115–127
Zurück zum Zitat Ahmed YM, Messiha BA, Abo-Saif AAJP (2015) Protective effects of simvastatin and hesperidin against complete freund’s adjuvant-induced rheumatoid arthritis in rats. Pharmacology 96(5–6):217–225CrossRefPubMed
Zurück zum Zitat Akşit E, Büyük B, Oğuz SJAOMSA (2023) Histopathological changes in myocardial tissue due to coronary venous hypertension. 19(6):1714
Zurück zum Zitat Ali A, Saadullah M, Fakhar-e-Alam M, Siddique R, Atif MJ (2024) Appraisal of the anti-arthritic potential of Strelitzia reginae in Wistar rats via modulating molecular inflammatory cascades IL-6, IL-17a, IL-1β, TNF-α, IFN-γ, RANKL, OPG, and IL-4 and attenuating oxidative stress biomarkers. J King Saud Univ. https://doi.org/10.1016/j.jksus.2024.103315CrossRef
Zurück zum Zitat Ali S, Faisal MN, Khan JA, Muhammad F (2023) Role of monolaurin additive with medium-chain fatty acids against dextran sulfate sodium-induced acute colitis through down regulating the oxidative stress in wistar rats. Pak J Agric Sci 60(2)
Zurück zum Zitat Ansari MO, Parveen N, Ahmad MF, Wani AL, Afrin S, Rahman Y, Jameel S, Khan YA, Siddique HR, Tabish MJSr (2019) Evaluation of DNA interaction, genotoxicity and oxidative stress induced by iron oxide nanoparticles both in vitro and in vivo: attenuation by thymoquinone. Sci Rep 9(1):6912CrossRefPubMedPubMedCentral
Zurück zum Zitat Anwar I, Sharif A, Ahmad M, Shabbir M, Akhtar B (2025) Farnesol alleviates inflammatory responses and oxidative stress in Freund’s complete adjuvant induced arthritic rat model and associated risk factors of atherosclerosis. Inflammopharmacology. https://doi.org/10.1007/s10787-025-01787-xCrossRefPubMedPubMedCentral
Zurück zum Zitat Anyasor GN, Onajobi FD, Osilesi O, Adebawo OJPb (2015) Hematological and lipid profile evaluation of a hexane fraction of Costus afer leaves in arthritic rats. Pharm Biol 53(11):1671–1676CrossRefPubMed
Zurück zum Zitat Arya A, Al-Obaidi MMJ, Shahid N, Noordin MIB, Looi CY, Wong WF, Khaing SL, Mustafa MR (2014) Synergistic effect of quercetin and quinic acid by alleviating structural degeneration in the liver, kidney and pancreas tissues of STZ-induced diabetic rats: a mechanistic study. Food Chem Toxicol 71:183–196CrossRefPubMed
Zurück zum Zitat Atalay BJBÜYBD (2017) The effects of cortistatin administration on plasma antioxidant system and cytokine levels of rabbits with acute inflammation. 7(2/2):190–201
Zurück zum Zitat Bahrami S, Shahriari A, Tavalla M, Azadmanesh S, Hamidinejat HJOM, Longevity C (2016) Blood levels of oxidant/antioxidant parameters in rats infected with Toxoplasma gondii. 2016(1):8045969
Zurück zum Zitat Bais S, Gill N, Kumar NJCJOB (2015) Neuroprotective effect of Juniperus communis on chlorpromazine induced Parkinson disease in animal model. 2015(1):542542
Zurück zum Zitat Deshmukh RJMTC (2023) Rheumatoid arthritis: pathophysiology, current therapeutic strategies and recent advances in targeted drug delivery system. Mater Today Commun 35:105877CrossRef
Zurück zum Zitat Di Franco M, Lucchino B, Conti F, Valesini G, Spinelli FRJMOI (2018) Asymmetric dimethyl arginine as a biomarker of atherosclerosis in rheumatoid arthritis. 2018(1):3897295
Zurück zum Zitat Djehiche C, Benzidane N, Djeghim H, Tebboub M, Mebrek S, Abdelouhab K, Baghiani A, Charef N, Messaoudi M, Bensouici CJAB, Biotechnology (2024) Ammodaucus leucotrichus seed extract as a potential therapy in animal models of rheumatoid arthritis induced by complete freund adjuvant and chicken cartilage collagen, 1–25
Zurück zum Zitat Dong J, Zheng H, Zeng Q, Zhang X, Du L (2022) Bais SJH, Toxicology E (2022) Protective effect of D-(−)-quinic acid as food supplement in modulating AMP-activated protein kinase signalling pathway activation in HFD induced obesity. 41:09603271221119804
Zurück zum Zitat Edilova M, Akram A, Abdul-Sater AJJ (2021) Innate immunity drives pathogenesis of rheumatoid arthritis Biomed. 44(2):172–182
Zurück zum Zitat El Bouchti I, Sordet C, Kuntz J-L, Sibilia JJJBS (2008) Severe atherosclerosis in rheumatoid arthritis and hyperhomocysteinemia: is there a link? 75(4):499–501
Zurück zum Zitat Fadoju O, Ogunsuyi O, Akanni O, Alabi O, Alimba C, Adaramoye O, Cambier S, Eswara S, Gutleb AC, Bakare AJET, Pharmacology (2019) Evaluation of cytogenotoxicity and oxidative stress parameters in male Swiss mice co-exposed to titanium dioxide and zinc oxide nanoparticles. 70:103204
Zurück zum Zitat Farrow M, Biglands J, Tanner S, Hensor EM, Buch MH, Emery P, Tan ALJR (2021) Muscle deterioration due to rheumatoid arthritis: assessment by quantitative MRI and strength testing. Rheumatology 60(3):1216–1225CrossRefPubMed
Zurück zum Zitat Fatima B, Faisal MN, Aslam B, Muhammad F (2024) Phyto-profiling and therapeutic intervention of Helianthus annuus seeds and Spinacia oleracea leaves extracts against Dextran sodium sulphate induced colitis in Wistar rats. Pak J Agric Sci 61(1)
Zurück zum Zitat Garg A, Rohilla M, Saini RJIJFMRP (2024) A comparative review: the correlation between rheumatoid arthritis and the accelerated progression and incidence of atherogenesis 2(3):01–17
Zurück zum Zitat Ghasemi-Dehnoo M, Lorigooini Z, Amini-Khoei H, Sabzevary-Ghahfarokhi M, Rafieian-Kopaei MJI (2023) Quinic acid ameliorates ulcerative colitis in rats, through the inhibition of two TLR4-NF-κB and NF-κB-INOS-NO signaling pathways. Inflam Dis 11(8):e926CrossRef
Zurück zum Zitat Gravandi MM, Pourmanouchehri Z, Behbood L, Fakhri S, Mohammadi-Noori E, Zhaleh M, Shirvani S, Kiani A, Farzaei MHJN-SSAOP (2023) Rutin-loaded chitosan nanoparticles alleviated Freund’s adjuvant induced rheumatoid arthritis via modulating oxidative stress and inflammatory parameters in Wistar rats. 1–20
Zurück zum Zitat Gul B, Anwar R, Saleem M, Noor A, Ullah MIJI (2023) Cassia absus-mediated upregulation of IL-4, IL-10 and downregulation of IL-1β, IL-6, TNF-α, NF-κB, IFN-γ in CFA-induced arthritis model. Inflammopharmacology 31(3):1241–1256CrossRefPubMed
Zurück zum Zitat Hajiesmaeili Y, Tamhankar P, Stranges S, Barra LJAR (2024) Factors associated with incident cardiovascular disease in patients with rheumatoid arthritis: a scoping review. Autoimmun Rev. https://doi.org/10.1016/j.autrev.2024.103539CrossRefPubMed
Zurück zum Zitat Hannan A, Akhtar B, Sharif A, Anjum F, Pasha I, Khan A, Akhtar MF, Saleem A (2023) Quercetin-loaded chitosan nanoparticles ameliorate adjuvant-induced arthritis in rats by regulating anti-oxidant enzymes and downregulating pro-and inflammatory cytokines. Inflammopharmacology 31(1):287–300CrossRefPubMed
Zurück zum Zitat Haroon K, Hassan F, Sajid MR, Sahar T, Ijaz M, Mohyud-din MT, Manzoor A, Babar M, Rashid A, Iqbal K (2024) Anti-proliferative effect of biosynthesized zinc-oxide nanoparticles using albizia lebbeck leaves extract against arsenic-induced liver cancer in rats. Pak J Agric Sci 61(3)
Zurück zum Zitat Ijaz M, Fatima M, Anwar R, Uroos MJRa (2021) Green synthesis of gold nanoparticles from Manilkara zapota L. extract and the evaluation of its intrinsic in vivo antiarthritic potential. RSC Adv 11(44):27092–27106CrossRefPubMedPubMedCentral
Zurück zum Zitat Jarlborg M, Gabay CJC (2022) Systemic effects of IL-6 blockade in rheumatoid arthritis beyond the joints. 149:155742
Zurück zum Zitat Kaur B, Kumar N, Patel MK, Chopra K, Saxena SJJOE (2023) Validation of traditional claims of anti-arthritic efficacy of trans-Himalayan snow mountain garlic (Allium ampeloprasum L.) extract using adjuvant-induced arthritis rat model: a comparative evaluation with normal garlic (Allium sativum L.) and dexamethasone. 303:115939
Zurück zum Zitat Kerola AM, Rollefstad S, Semb AGJECR (2021) Atherosclerotic cardiovascular disease in rheumatoid arthritis: impact of inflammation and antirheumatic treatment. Eur Cardiol Rev. https://doi.org/10.15420/ecr.2020.44. (16)CrossRef
Zurück zum Zitat Khan D, Sharif A, Zafar M, Akhtar B, Akhtar MF, Awan S (2020) Delonix regia a folklore remedy for diabetes; attenuates oxidative stress and modulates type II diabetes mellitus. Curr Pharm Biotechnol 21(11):1059–1069CrossRefPubMed
Zurück zum Zitat Khan SR, Iqbal R, Hussain R, Ali M, Khalid M, Nazish N, Naqvi SS (2024) Broccoli partially lowers oxidative stress, histopathological lesions and enhances antioxidant profile of mono sex tilapia exposed to zinc oxide nanoparticles. Pak Vet J 44(2):306–313
Zurück zum Zitat Kurnijasanti R, Wardani G, Mustafa MR, Sudjarwo SAJP (2023) Protective mechanism pathway of Swietenia macrophylla extract nanoparticles against cardiac cell damage in diabetic rats. Pharmaceuticals 16(7):973CrossRefPubMedPubMedCentral
Zurück zum Zitat Laurindo LF, de Maio MC, Minniti G, de Góes Corrêa N, Barbalho SM, Quesada K, Guiguer EL, Sloan KP, Detregiachi CR, Araújo ACJM (2023) Effects of medicinal plants and phytochemicals in Nrf2 pathways during inflammatory bowel diseases and related colorectal cancer: a comprehensive review. 13(2):243
Zurück zum Zitat Li F, Li H, Luo S, Ran Y, Xie X, Wang Y, Zheng M, Wang M, Zhao Z, Li XJB, Pharmacotherapy (2018) Evaluation of the effect of andrographolide and methotrexate combined therapy in complete Freundʼs adjuvant induced arthritis with reduced hepatotoxicity. 106:637–645
Zurück zum Zitat Liu L, Liu Y, Zhao J, Xing X, Zhang C, Meng HJEBC, Medicine A (2020) Neuroprotective effects of D‐(‐)‐Quinic acid on aluminum chloride‐induced dementia in rats. 2020(1):5602597
Zurück zum Zitat Maarouf RE, Abdel-Rafei MK, Thabet NM, Azab KS, Rashed L, El Bakary NMJIJOI, Pharmacology (2024) Ondansetron or beta-sitosterol antagonizes inflammatory responses in liver, kidney, lung and heart tissues of irradiated arthritic rats model. 38:03946320241260635
Zurück zum Zitat Mahnashi MH, Jabbar Z, Alamgeer, Irfan HM, Asim MH, Akram M, Saif A, Alshahrani MA, Alshehri MA, Asiri SAJI (2021) Venlafaxine demonstrated anti-arthritic activity possibly through down regulation of TNF-α, IL-6, IL-1β, and COX-2. 29:1413–1425
Zurück zum Zitat Malik M, Sharif A, Hassan SU, Muhammad F, Khan HM, Akhtar B, Saeed M (2022) Amelioration of hyperglycaemia and modulation of pro-inflammatory cytokines by Tamarix gallica fractions in alloxan induced diabetic rats. Arch Physiol Biochem 128(6):1666–1675CrossRefPubMed
Zurück zum Zitat Mateen S, Zafar A, Moin S, Khan AQ, Zubair SJCca (2016) Understanding the role of cytokines in the pathogenesis of rheumatoid arthritis. Clin Chim Acta 455:161–171CrossRefPubMed
Zurück zum Zitat Mukhtiar M, Khan MF, Jan SU, Khan H, Ullah NJPJPS (2012) Evaluation of the interaction of vanadium with glutathione in human blood components. 25(3):549–553
Zurück zum Zitat Munir A, Muhammad F, Zaheer Y, Ali MA, Iqbal M, Rehman M, Munir MU, Akhtar B, Webster TJ, Sharif A (2021) Synthesis of naringenin loaded lipid based nanocarriers and their in-vivo therapeutic potential in a rheumatoid arthritis model. J Drug Deliv Sci Technol 66:102854CrossRef
Zurück zum Zitat Naz R, Ahmed Z, Shahzad M, Shabbir A, Kamal FJEBC, Medicine A (2020) Amelioration of rheumatoid arthritis by Anacardium occidentale via inhibition of collagenase and lysosomal enzymes. 2020(1):8869484
Zurück zum Zitat Olorundare O, Adeneye A, Akinsola A, Kolo P, Agede O, Soyemi S, Mgbehoma A, Okoye I, Albrecht R, Mukhtar HJOM, Longevity C (2020) Irvingia gabonensis seed extract: an effective attenuator of doxorubicin‐mediated cardiotoxicity in wistar rats. 2020(1):1602816
Zurück zum Zitat Parveen S, Shabbir A, Butt AM, Imran M, Jamil A, Asim A, Mashaal K (2023) Amelioration of rheumatoid arthritis in rats by 4-allylanisole through modulation of inflammatory mediator
Zurück zum Zitat Pullaiah CP, Nelson VK, Rayapu SGVNK, Kedam TJBP, Toxicology (2021) Exploring cardioprotective potential of esculetin against isoproterenol induced myocardial toxicity in rats: in vivo and in vitro evidence. 22:1–11
Zurück zum Zitat Saeed M, Sharif A, Hassan SU, Akhtar B, Muhammad F, Malik M (2022) Cyperus iria aqueous-ethanol extract ameliorated hyperglycemia, oxidative stress, and regulated inflammatory cytokines in streptozotocin-induced diabetic rats. Environ Sci Pollut Res 29(3):4769–4784CrossRef
Zurück zum Zitat Saleem MU, Muhammad F, Sharif A, Arshad MI, Akhtar K, Javed Y, Akhtar B (2022) Methotrexate-loaded biodegradable nanoparticles exert anti-arthritic effect by downregulating pro-inflammatory cytokines in Freund’s complete adjuvant-induced arthritic rats. Inflammopharmacology 30(3):1079–1091CrossRefPubMed
Zurück zum Zitat Shahbaz S, Sharif A, Akhtar B, Mobashar A, Shazly GA, Metouekel A, Bourhia M (2024) Therapeutic potential of 3-acetyl coumarin against polycystic ovarian syndrome induced by letrozole using female rats. Naunyn-Schmiedebergs Arch Pharmacol. https://doi.org/10.1007/s00210-024-03720-5CrossRefPubMed
Zurück zum Zitat Shakir N, Sharif A, Ali S, Akhtar B, Akhtar MF, Muhammad F, Saleem A, Akhtar K, Tariq I, Khan MI (2023) Pirarubicin loaded biodegradable nanoparticles downregulate IL-6, COX-II and TNF-α along with oxidative stress markers in comparison to conventional pirarubicin in healthy albino rats. J Drug Deliv Sci Technol 84:104498CrossRef
Zurück zum Zitat Sharif A, Akhtar MF, Akhtar B, Saleem A, Manan M, Shabbir M, Ashraf M, Peerzada S, Ahmed S, Raza M (2017) Genotoxic and cytotoxic potential of whole plant extracts of Kalanchoe laciniata by Ames and MTT assay. EXCLI J 16:593PubMedPubMedCentral
Zurück zum Zitat Shen X, Ishaq SM, Wang QE, Yuan J, Gao J, Lu ZJA (2022) DDAH1 protects against acetaminophen-induced liver hepatoxicity in mice. 11(5):880
Zurück zum Zitat Sial NT, Malik A, Iqbal U, Mehmood MH, Rehman MF (2024) Novel antiarthritic mechanisms of azelaic acid against CFA-induced arthritis in rats by modulating pro-and anti-inflammatory cytokines network. Inflammopharmacology 32(4):2445–2462CrossRefPubMed
Zurück zum Zitat Siddique R, Muhammad F, Faisal MN, Akhtar B, Saleem A, Kousar S, Sharif A, Saeed M, Muhammad S (2024) Gingerol nanoparticles attenuate complete Freund adjuvant-induced arthritis in rats via targeting the RANKL/OPG signaling pathway. Inflammopharmacology 32(5):3311–3326CrossRefPubMed
Zurück zum Zitat Tanveer A, Akhtar B, Sharif A, Saleem U, Rasul A, Ahmad A, Jilani K (2022) Pathogenic role of cytokines in COVID-19, its association with contributing co-morbidities and possible therapeutic regimens. Inflammopharmacology 30(5):1503–1516CrossRefPubMedPubMedCentral
Zurück zum Zitat Tseuguem PP, Ngangoum DAM, Pouadjeu JM, Piégang BN, Sando Z, Kolber BJ, Tidgewell KJ, Nguelefack TBJ (2019) Aqueous and methanol extracts of Paullinia pinnata L. (Sapindaceae) improve inflammation, pain and histological features in CFA-induced mono-arthritis: evidence from in vivo and in vitro studies. J Ethnopharmacol 236:183–195CrossRefPubMedPubMedCentral
Zurück zum Zitat Waseem F, Sharif A, Shabbir M, Akhtar B, Shah SWA, Shahnaz, Arshad A, Basheer E, Hanif MA, Ali M (2025) N-dimethyl chalcone facilitated augmentation of IL-10 and diminution of TNF-α, IL-1β, IL-6, NFκB, and COX-2 in FCA-induced arthritic rat model. Inflammopharmacology, pp 1–16
Zurück zum Zitat Zafar M, Sharif A, Khan D, Akhtar B, Muhammad F, Akhtar MF, Fatima T (2021) Preventive effect of Euphorbia royleana Boiss on diabetes induced by streptozotocin via modulating oxidative stress and deoxyribonucleic acid damage. Toxin Rev 40(4):777–790CrossRef
Zurück zum Zitat Zaib M, Sharif A, Akhtar B, Khan HM, Akhtar MF, Hassan W, Razzaq F, Nawaz S, Qaisar N (2020) Berberis lycium Royle. extracts attenuate inflammation and modulates hyperglycemia in alloxan induced diabetic rats. Pak J Pharm Sci
Zurück zum Zitat Zeb Z, Sharif A, Akhtar B, Shahnaz (2024) 3-Acetyl coumarin alleviate neuroinflammatory responses and oxidative stress in aluminum chloride-induced Alzheimer’s disease rat model. Inflammopharmacology 32(2):1371–1386