Quinic acid derivatives inhibit dengue virus replication in vitro

Huh7.5 human hepatoma cells (PTA-8561, U.S. Patent Number 7455969) were grown in Dulbecco’s Modified Eagle Medium - nutrient mixture F-12 (DMEM-F12, Gibco-Life Technologies, USA) that was supplemented with 100 IU/μg/mL penicillin/streptomycin (Gibco-Invitrogen, USA) and 10 % FCS. Upon project approval by the FIOCRUZ Committee of Ethics in Research (#514/09), primary Peripheral Blood Mononuclear Cells (PBMCs) were isolated from whole blood samples taken from healthy volunteers with lymphocyte separation medium (Lonza, USA) by density gradient centrifugation, in accordance with the manufacturer’s recommendations. PBMCs were cultured in 24-well plates with Roswell Park Memorial Institute medium-1640 (RPMI-1640, Lonza, USA) that was supplemented with 2 mM glutamine (Gibco-Life Technologies, USA), 100 IU/μg/mL penicillin/streptomycin, 2.5 μg/mL amphotericin B (Cristália, Brazil), 100 mM sodium pyruvate (Sigma-Aldrich, USA) and 10 % FCS. Both Huh7.5 cells and PBMCs were maintained in a humid 37 °C atmosphere with 5 % CO₂.

DENV-1/FGA/89 was isolated in 1989 from a South American patient suffering from dengue fever (GenBank: AF226687). DENV-2/ICC-265 and DENV-3/97 are clinical isolates from Brazilian patients who had dengue fever in 2009 and 2004, respectively. DENV-4/TVP360 is a laboratory strain that was kindly provided by Dr. Ricardo Galler (Fundação Oswaldo Cruz, Rio de Janeiro, Brazil). Viruses were grown in insect C6/36 cells, and culture supernatants were titrated using a focus immunodetection assay [42].

Ten (1–10) amides of quinic acid derivatives were synthesized as previously described [43]. Compounds were prepared both with and without lipophilic chains to investigate the influence of lipophilicity on antiviral activity (Table 1). All compounds were recovered in 100 % dimethyl sulfoxide (DMSO, Sigma-Aldrich, USA) and stored at −20 °C. The maximum concentration of DMSO that was used in cell culture assays was 0.5 %. There were no difference in control treatments with or without 0.5 % DMSO.

Huh7.5 cells were treated with the compounds ranging from 1000 to 0.5 μM, and cell viability was measured after 72 h simultaneously by MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] and Neutral Red (NR) assays, as previously described [30]. Data from three independent experiments were normalized with the following equation: cell viability (%) = (OD sample value - OD blank control)/(OD cell control - OD blank control) × 100. The non-toxic concentration (NTC) of each compound was determined using both assays and defined as the highest concentration that did not show significant differences from the non-treated control (one-way ANOVA and Dunnett’s post-test). CC₅₀ was calculated using a sigmoidal dose response curve (variable slope).

To establish NTCs in PBMCs, serial dilutions of compounds 2 and 10 were tested after 5 days of treatment, using Annexin V-PE-Cy7 and 7-AAD (Apoptosis Detection Kit, Becton & Dickinson, EUA) according to the manufacturer’s instructions and were analyzed by flow cytometry using a BD FACS Canto II (Flow Cytometry Facility RPT08L PDTIS/Carlos Chagas Institute - Fiocruz, PR-Brazil).

The antiviral activities of ten quinic acid derivatives were screened using in situ ELISA [33]. Briefly, Huh7.5 cells (2x10⁴ cells/well in 96-well plates) were infected with DENV-1, −2 and −3 with a MOI of 4 and DENV-4 with a MOI of 0.1. The NTCs of the compounds were used to treat cells both during and after infection (to cover all steps of the virus life cycle). After 72 h, cells were fixed with methanol:acetone for 1 h at −20 °C, blocked with 2 % skim milk and 0.05 % Tween-20 in PBS for 30 min, and then incubated with the 4G2 mouse monoclonal antibody that is specific to flavivirus envelope protein for 1 h at 37 °C. Following this, cells were washed four times with washing buffer (0.01 % Tween 20 in PBS) and a secondary goat anti-mouse IgG HRP antibody (Sigma-Aldrich, USA) was added. After 1 h incubation at 37 °C, cells were washed four times, and TMB substrate (KPL, USA) was added for 10 min under protection from light. The reaction was stopped with the addition of 2 M H₂SO₄. Absorbance was read at a wavelength of 450 nm in a microplate reader (Synergy H1M, Biotek, USA). Data were normalized as % of infection compared to controls; non-infected cells (mock) were considered to represent 0 % infection, and untreated infected cells were considered to represent 100 % infection. Recombinant IFN-α-2A (100 IU/mL) was used as a reference control, and compounds were considered as active when 70 % of inhibition of at least one serotype was achieved.

Furthermore, concentration response curves were obtained using serial dilutions of the active compounds, starting from their NTCs. The concentration that inhibited 50 % of virus infection (IC₅₀) was obtained using nonlinear regression followed by sigmoidal concentration-response (variable slope; GraphPad) and selectivity index (SI = CC₅₀/IC₅₀).

The active compounds that were obtained from the initial screening were confirmed by two methods. Huh7.5 cells were infected with DENV-1 through −4 and treated during virus inoculation. Following this, media that contained compounds 2 or 10 was added to the cells and incubated with them for 72 h. After the incubation period, cell culture supernatants were recovered to perform a foci-forming immunodetection assay in C6/36 cells, as previously described [42]. Huh7.5 cells were recovered, blocked for 20 min at room temperature (PBS, 5 % FCS), fixed with Cytofix/Cytoperm™ (BD Biosciences) and stained with the anti-Flavivirus 4G2 mouse monoclonal antibody in Perm/Wash solution (BD Biosciences) for 20 min at 37 °C. After washing with Perm/Wash, the cells were stained with rabbit anti-mouse IgG (H + L) Alexa-633 (Life Technologies) for 20 min at 37 °C. Finally, cells were washed two times with 1x PBS and analyzed using a BD FACS Canto II (BD Biosciences).

A virucidal assay was performed as previously described [35] with minor modifications. Briefly, samples of each DENV serotype (2x10⁵ ffu/mL) were treated with the NTCs of the active compounds (2 and 10) in the presence or absence of 150 μg/mL RNase A (USB-Affymetrix Inc.) for 1 h at 37 °C. After treatment, viral RNA was extracted using a QIAamp Viral RNA Mini Kit (QIAGEN). The RNA was reverse-transcribed using 250 pmol of a random primer (Invitrogen, USA) and Improm II Reverse Transcriptase (Promega, USA). Amplification by PCR was performed as described by Lanciotti et al. [44] with some modifications. Briefly, cDNA was amplified using D1 (5′- TCAATATGCTGAAACGCGCGAGAAACCG - 3′) and D2 primers (5′- ATTGCACCAGCAGTCAACGTCATCTGGTTC - 3′) with Taq DNA polymerase. Samples were maintained at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min in a GeneAmp PCR System 9700 (Applied Biosystems, USA). Recently extracted DENV-3/97 RNA samples, that were either treated or not treated with RNase, were used as the positive and negative controls, respectively.

To perform a binding assay, Huh7.5 cells were seeded in 96-well plates (2x10⁴ cells/well), infected with DENV-1, −2, −3 (MOI 4) and −4 (MOI 0.1) and treated with the active compounds. After 1 h at 4 °C, cells were washed twice with cold PBS, and the viral inoculum was replaced with complete media. After incubation for 72 h at 37 °C and 5 % CO₂, the in situ ELISA was performed.

An internalization assay was performed by infecting Huh7.5 cells as described above for 1 h at 4 °C. Following this, cells were washed twice with cold PBS, and the active compounds were added. After another hour of incubation at 37 °C, the cells were washed and treated with citrate buffer (citric acid 40 mM, potassium chloride 10 mM, sodium chloride 135 mM, pH 3.0) for 1 min to remove non-internalized viral particles. After washing, cells received complete media and were incubated at 37 °C, 5 % CO₂ for 72 h until analysis by in situ ELISA. The mouse monoclonal 4G2 antibody (neutralizing antibody against flavivirus) and recombinant IFN-α 2A (100 IU/mL) were used as controls for both assays.

To quantify the inhibition of RNA replication by the active compounds, two transient replicon assays were used: RepDV1 generated from dengue virus serotype-1 BR/90 strain (GenBank AF226685) and RepDV3 generated from dengue virus serotype-3 BR DEN3 290–02 strain (GenBank EF629369) [37, 38]. DNA plasmids were purified from the Escherichia coli Top10 strain using a Wizard Plus Midiprep DNA Purification System (Promega, Madison, WI, USA) following manufacturer’s recommendations. Plasmids were linearized with the SwaI restriction enzyme and submitted to phenol/chloroform extraction and ethanol precipitation. An in vitro transcription reaction using DNA templates was achieved using a MEGAscript T7 High Yield Transcription Kit (Ambion, Austin, TX, USA) in the presence of an m⁷G(5′)ppp(5′) RNA Cap analog (New England Biolabs, Ipswich, MA, USA). RNA purification was performed with an RNeasy kit (QIAGEN, Valencia, CA, USA). Finally, the resulting RNAs were used to transfect Huh7.5 cells (2 ng RNA/ 2x10⁶ cells) following the recommendations of the manufacturer of the Amaxa Cell Line Nucleofector Kit T and Nucleofector II/2B device (Lonza, Cologne, Germany).

After transfection, cells were plated in 24- (1x10⁵ cells) and 96-well (2x10⁴ cells) plates. Treatments with the NTCs of the active compounds were performed one hour after transfection, and the plates were incubated for an additional 72 h. After this period, the cells from the 24-well plates were recovered, blocked for 20 min at room temperature (PBS, 5 % FCS), fixed with Cytofix/Cytoperm (Becton & Dickinson, San Jose, CA) and stained with the 1722 mouse monoclonal antibody (anti-NS3 recombinant protein from dengue virus serotype-1) in Perm/Wash solution (Becton & Dickinson, San Jose, CA) for 20 min at 37 °C. The mouse monoclonal antibody 1722 recognizes dengue virus serotypes 1, 2 and 3. (data not shown). After washing with Perm/Wash, cells were stained with anti-mouse Alexa-633 (Life Technologies) for 20 min at 37 °C. Finally, cells were washed two times with Perm/Wash and analyzed using a BD FACS Canto II (Becton & Dickinson, San Jose, CA). The cells in the 96-well plates were submitted to a cell viability neutral red assay [29].

Non-RNA-transfected and non-treated cells were used as mock controls. Huh7.5 cells that were transfected with RNA and that were not treated were used as a positive control for virus replication. Cells that were treated with recombinant IFN-α 2A (100 IU/mL) and 20 μM ribavirin were used as reference controls.

Peripheral blood mononuclear cells (PBMCs) were infected with DENV-4 (MOI 10) for 2 h and treated with the NTCs of the active compounds for five days at 37 °C and 5 % CO₂. After incubation, cells were analyzed for DENV antigen quantification by FACS. Briefly, the cells were blocked with PBS, 5 % FCS (Gibco-Invitrogen, South America) and 1 % human serum type AB (Lonza, Walkersville, MD) for 20 min at room temperature. Following this, the cells were fixed using Cytofix/Cytoperm (Becton & Dickinson, San Jose, CA), washed using Perm/Wash, and stained with the 4G2 monoclonal (specific for flavivirus envelope protein) for 20 min at 37 °C. After incubation, the cells were washed with Perm/Wash and incubated for 20 min at 37 °C with the secondary antibody (donkey anti-mouse conjugated with Alexa-488; Life Technologies). Finally, cells were washed twice with Perm/Wash and analyzed using a FACSCanto II (BD Biosciences). Data were analyzed by two-way ANOVA followed by the Bonferroni post test.