Skip to main content
Erschienen in: BMC Musculoskeletal Disorders 1/2019

Open Access 01.12.2019 | Research article

Rare variant of HSPG2 is not involved in the development of adolescent idiopathic scoliosis: evidence from a large-scale replication study

verfasst von: Chao Xia, Leilei Xu, Bingchuan Xue, Fei Sheng, Yong Qiu, Zezhang Zhu

Erschienen in: BMC Musculoskeletal Disorders | Ausgabe 1/2019

Abstract

Background

Rare variants of HSPG2 have recently been reported to function as a potential contributor to the susceptibility of adolescent idiopathic scoliosis (AIS) in the Caucasians. A replication study in the different population is warranted to validate the role of HSPG2 in AIS. The aim of this study was to determine the association between HSPG2 and AIS in the Chinese patients and to further investigate its influence on the phenotype of the patients.

Methods

SNVs p.Asn786Ser of HSPG2 was genotyped in 1752 patients and 1584 normal controls using multiple ligase detection reactions. The mRNA expression of HSPG2 in the paraspinal muscles was quantified for 90 patients and 26 controls. The The Student’s t test was used to analyze the inter-group comparison of the HSPG2 expression. The relationship between the HSPG2 expression and the curve magnitude of the patients was analyzed by the Pearson correlation analysis.

Results

No case of mutation in the reported SNV p.Asn786Ser of HSPG2 was found in our cohort. The mRNA expression of HSPG2 in patients was comparable with that in the controls (0.0016 ± 0.0013 vs. 0.0019 ± 0.0012, p = 0.29). 42 patients with curve magnitude > 60 degrees were assigned to the severe curve group. The other 58 patients were assigned to the moderate curve group. These two groups were found to have comparable HSPG2 expression (0.0015 ± 0.0011 vs. 0.0017 ± 0.0014, p = 0.57). And there was no remarkable correlation between the expression level of HSPG2 and the curve severity (r = 0.131, p = 0.71).

Conclusions

HSPG2 gene was not associated with the susceptibility or the phenotypes of AIS in the Chinese population. The whole HSPG2 gene can be sequenced in more AIS patients to identify potentially causative mutations.
Abkürzungen
AIS
Adolescent idiopathic scoliosis
GWAS
Genome-wide association study
HSPG2
Human heparan sulfate proteoglycan 2
LDR
Ligase detection reactions
SNV
Single nucleotide variant
WES
Whole exome sequencing

Background

Adolescent idiopathic scoliosis (AIS) is a complex spinal deformity that affects millions of children worldwide [1]. To benefit the prognosis and therapeutic strategy for patients with AIS, it is crucial to have a clear understanding of the etiopathogenesis of this disease. For the past half century, numerous studies have been carried out to investigate the etiology of AIS while the conclusions remain obscure [2]. Traditionally, AIS is considered as a multifactorial disorder that involves interaction between different factors, including genetic susceptibility, growth disturbance, hormones and metabolic dysfunction, abnormal central nervous system and proprioception impairment [37]. Among these factors, previous familial studies of AIS have strongly implied the genetic background of AIS [8, 9]. But to date, the exact inheritance mode of AIS remains unclear.
Confined by the low efficiency to define the genetic markers, whole-genome linkage analysis was firstly used in the genetic research of AIS which could only identify large chromosome regions potentially containing disease-related genes [10, 11]. Gradually, it became feasible to analyze SNPs through TaqMan real-time quantitative PCR assay, which was a high-throughput method to differentiate the genotype of target variants. Since then, multiple susceptible genes of AIS have been discovered through candidate genetic association studies [1217]. To be noted, however, few of these genes could be successfully replicated in different populations, which greatly weakened the reliability of such candidate susceptible genes in AIS [18, 19]. Commonly, ethic differences and small sample size of the patients were considered to underlie the discrepancy between the original and the replication studies [18, 19]. In addition, the speculation based on which those candidate genes was selected was mostly lack of essential scientific evidence, thus inevitably leading to the failed replication.
To overcome the above-mentioned limitations of candidate genetic association studies, a much powerful tool, genome-wide genotyping chip, was utilized to identify the susceptible gene of AIS [2026]. Sharma et al. [26] performed the first genome-wide association study (GWAS) in the Caucasians and reported that CHL1 was associated with AIS. In the following decade, more susceptible loci of AIS were discovered in the Caucasian, the Japanese and the Chinese populations through GWAS, including LBX1, GPR126, BNC2, PAX1, LBX1-AS1, BCL2, AJAP1, PAX3, TNIK, MEIS1, and MAGI1 [2025]. However, only a small proportion of the heritability of AIS can be explained by these common variants.
With the advances of sequencing techniques, more research teams have begun to analyze the role of rare variants in AIS using whole exome sequencing (WES) in recent years [2729]. With a low minor allele frequency in normal population, rare variants are usually expected to have larger impact on the inheritance of complex disease than common variants. Patten et al. [27] performed the first WES in AIS and reported 3 rare variants of the POC5 functionally associated with AIS. Subsequently, Buchan et al. [28] reported that rare variants in FBN1 and FBN2 could contribute to both risk and severity of AIS. Haller et al. [30] found that rare variants across extracellular matrix genes contributed strongly to the risk of AIS in patients with European ancestry. Overall, identification and validation of rare variants associated with AIS is a promising method to explain the missing heritability of this complex disease.
In a recent study, rare variants of HSPG2 were reported to function as a potential contributor to the susceptibility of AIS in the Caucasians [31]. Obviously a replication study in the different population is warranted to validate the role of HSPG2 in AIS. This study aimed to determine the association between HSPG2 and AIS in the Chinese patients and to further investigate its influence on the phenotype of the patients.

Methods

Subjects

Under the approval of the local institutional review board, a cohort of 1752 female AIS patients and 1584 controls were included in the current study. All the patients were excluded to have neurological defect through MRI examination. All the controls were excluded to have scoliosis through Adam’s Forward Bend Test using the standard criteria performed by a senior spine surgeon (Z.Z.). Demographic data were collected for each participant, including initial age, curve pattern and curve magnitude measured by the Cobb angle method on the standing posteroanterior X-ray films.

Genotyping of the rare variant

All the subjects signed the informed consent for the collection of blood samples. Genomic DNA was then extracted with the commercial kit (Qiagen K.K., Tokyo, Japan). Single nucleotide variant (SNV) p.Asn786Ser (rs143736974) of HSPG2 was genotyped for all participants. Allelic-specific multiple ligase detection reactions (LDR) was used for genotyping assay as previously reported, with the primer shown in Table 1. Fifteen percent of the samples were randomly selected for Sanger sequencing to ensure the reproducibility of the LDR results.
Table 1
Primers for the genotyping assay and expression analysis
 
Primers
p.Asn786Ser
 TC
TTTTTTTTTTTTTTTTGTTGCACTGTGGCCCCTCCtTGC
 TT
TTTTTTTTTTTTTTTTTTTGTTGCACTGTGGCCCCTCCtTGT
 TR
TGTGCTGGCAATTCTAGAAGAAGGAtttttt
 GAPDH
TTTTTTTTTAGCTGCAGATCCTGCACCAAGAGC
 Forward
5′- GAGTCAACGGATTTGGTCGT − 3’
 Reverse
5′- TTGATTTTGGAGGGATCTCG − 3’
HSPG2
 Forward
5′ - TACACACGCCACCTGATCTC -3’
 Reverse
5′ - GCTGCCAGTAGAAGGACTCA −3’

Genotyping of common variations in HSPG2

Common variants covering HSPG2 gene were identified through the Ensemble database (http://​www.​ensembl.​org/​index.​html). GWAS database that was composed of 1446 AIS patients and 2080 controls was processed with the PLINK (version 1.90, http://​zzz.​bwh.​harvard.​edu/​plink/​tutorial.​shtml) to determine the genotyping results of these common variants.

RNA extraction and real-time qPCR

Ninety-eight female AIS patients were included in the expression analysis of HSPG2. Twenty-eight female lumbar disc herniation (LDH) patients with no presence of spinal deformity were included as the controls. The paraspinal muscle was collected from each subject during the surgery. For AIS patients, we collected the muscle sample from both the concave side and convex side at the apex of the curve. Total RNA was then extracted from the muscle tissue using a commercial kit (CWBio. Co. Ltd). The mRNA expression of HSPG2 was quantified with real-time polymerase chain reaction (PCR) on ABI 7900HT, with GAPDH used as the endogenous control. All amplifications were performed in triplicate. The relative expression of HSPG2 was normalized using the ΔΔCt method. The primers of HSPG2 and GAPDH were shown in Table 1.

Statistical analysis

SPSS version 17.0 (SPSS Inc., Chicago, USA) was used for data analysis. Cochran-Armitage trend test was used to calculate the association between common variants and AIS. Patients included expression analysis were classified into different subgroups according to the curve pattern or the curve severity. The Student’s t test was used to analyze the inter-group comparison of the baseline characteristics and mRNA expression of HSPG2. The relationship between the HSPG2 expression and the curve magnitude of the patients was analyzed by the Pearson correlation analysis. The statistical was set at p < 0.05.

Results

Demographic data

The mean age of patients included in the LDR analysis was 15.3 ± 3.4 years (range 10.5–18.8 years). The mean curve magnitude was 54.3 ± 11.2 degrees (range 27–72 degrees). One thousand eighteen patients had curve magnitude more than 50 degrees and thus underwent posterior spinal correction surgery. The mean age of the healthy controls was 18.9 ± 3.2 years (range 16.5–22.8 years).

Genotyping of SNVs

No case of mutation in the reported SNV p.Asn786Ser of HSPG2 was found in our cohort. All the 3336 subjects were found to have genotype TT. A total of 16 SNPs covering HSPG2 were analyzed, with the distribution of minor allele frequency summarized in Table 2. All the SNPs were found to have comparable allele frequency between the patients and the controls.
Table 2
The allele frequency of 16 SNPs covering HSPG2
SNP
MA
MAF
p
OR (95% CI)
Patients (n = 1446)
Controls (n = 2080)
rs4654770
T
0.170
0.169
0.9262
1.01 (0.90–1.12)
rs12040859
T
0.190
0.192
0.8902
0.99 (0.87–1.11)
rs17459139
T
0.165
0.167
0.8384
0.99 (0.87–1.11)
rs7556412
G
0.179
0.195
0.1463
0.90 (0.81–0.99)
rs12043008
G
0.179
0.175
0.7164
1.03 (0.92–1.14)
rs10799718
A
0.385
0.371
0.278
1.06 (0.94–1.17)
rs11810496
G
0.393
0.390
0.8497
1.01 (0.90–1.12)
rs2445142
G
0.395
0.381
0.3187
1.06 (0.94–1.17)
rs878949
T
0.148
0.151
0.8051
0.99 (0.87–1.11)
rs2501257
A
0.395
0.386
0.5053
1.04 (0.94–1.16)
rs6680566
C
0.394
0.388
0.6465
1.03 (0.92–1.14)
rs6698486
G
0.347
0.341
0.6487
1.03 (0.92–1.14)
rs9426783
C
0.443
0.436
0.62
1.03 (0.92–1.14)
rs4654773
T
0.440
0.433
0.5781
1.03 (0.92–1.14)
rs16826053
C
0.199
0.189
0.383
1.06 (0.94–1.17)
rs10917067
T
0.107
0.116
0.2869
0.91 (0.82–1.01)
MA indicates minor allele, MAF indicates minor allele frequency, OR indicates odds ratio, CI indicates confidential interval

mRNA expression level of HSPG2

A total of 98 patients and 28 controls were included for expression analysis. Eight patients and 2 controls were excluded from the analysis due to degradation of total RNA. The expression level of HSPG2 was successfully detected in the paraspinal muscles of 90 patients and 26 controls. There was no significant difference regarding the mean age of the two groups (15.2 ± 1.1 years vs. 15.5 ± 1.2 years, p = 0.48). The mRNA expression of HSPG2 in patients was comparable with that in the controls (0.0016 ± 0.0013 vs. 0.0019 ± 0.0012, p = 0.29).

Relationship between HSPG2 and phenotype of the patients

For the 90 patients included in the expression analysis, 42 patients had curve magnitude more than 60 degrees, thus assigned to the severe curve group. Forty-eight patients with curve magnitude less than 60 degrees were assigned to the moderate curve group. These two groups classified by curve severity were found to have comparable HSPG2 expression (0.0015 ± 0.0011 vs. 0.0017 ± 0.0014, p = 0.57). And there was no remarkable correlation between the expression level of HSPG2 and the curve severity (r = 0.131, p = 0.71), either.
As for the curve pattern, 67 patients had single thoracic curve and the other 23 patients had double major curve. There was no significant difference of HSPG2 expression between the curve pattern groups (0.0017 ± 0.0012 vs. 0.0014 ± 0.0013, p = 0.31).

Discussion

Genetic findings of AIS have been greatly hindered by its clinical and genetic heterogeneity. Previous association studies have revealed many disease-related genes, most of which however appeared inconclusive as indicated by the following replication studies [18, 32, 33]. Carried out in different populations, replication studies have failed to validate the reported associations of ER-α, ER-β, MTNR1b, MATN1, TPH1, IGF1, MMP3, IL6 and TGF-β with AIS [18, 19, 32, 34]. To the best of our knowledge, LBX1 and PAX1 are the only two susceptible genes that could be successfully validated in Caucasians and Asians with a minimum sample size of over 3000 patients [20, 35]. The statistical power regarding the associations between these genes and AIS has reached the genome-wide significance that was defined as a p value of less than 5.0 × 10− 8. Obviously, a large sample size and a rigorous setting of statistical power are key factors to ensure reliable and reproducible findings in genetic studies.
Another difficulty of AIS genetic research lies in that the reported common variants can only explain a small amount of AIS heritability. All the susceptible variants reported by previous GWASs of AIS had an OR value between 1 and 2, leaving over 90% of the AIS heritability unexplained [2026]. Since low frequency variants with large effect sizes could be involved in the missing heritability, the role of rare variants in the development of AIS has recently become a widely investigated topic [2732]. Baschal et al. [31] performed WES in a four-generation idiopathic scoliosis (IS) family and identified the SNV p.Asn786Ser of HSPG2 gene as a novel causative variant of IS. Enrichment of this mutation was then validated in two independent cohorts composed of 241 IS patients [31]. To validate the association of HSPG2 with the development of AIS, we performed the genotyping of p.Asn786Ser in a large cohort consisted of 1752 patients and 1584 controls. No case of mutation was found in this cohort as all the subjects presented the same genotype TT. As for common variants covering HSPG2, none of the 16 SNPs had remarkably different allele frequency between the patients and the controls. Moreover, we observed comparable HSPG2 expression in the paraspinal muscles between the patients and the controls. To summarize, our findings did not support the association of HSPG2 with the susceptibility of AIS in Chinese population.
HSPG2 gene, which has 94 exons, encodes perlecan which binds to basement membrane proteins such as collagen and laminin and to cell surface receptors [36]. Homozygous HSPG2 mutations could lead to a more severe phenotype in human disease, such as Schwartz- Jampel syndrome Type 1 and Dyssegmental Dysplasia, Silverman-Handmaker Type [37, 38]. Schwartz-Jampel syndrome is reported to be associated with kyphoscoliosis [39]. Baschal et al. [31] therefore speculated that haploinsufficiency of HSPG2 may be associated with a progressive IS and acted as a potential contributor to the phenotype. Aiming to clarify the relationship between HSPG2 and phenotypes of the patients, we classified patients into different subgroups according to the curve pattern or the curve severity. We found that HSPG2 expression was not associated with either the curve severity or the curve pattern. Herein, it appeared that HSPG2 had no effect on the phenotype of the AIS patients.
It is unlikely for the current study to have false-negative results as our sample size is large enough to detect the potential mutation. The susceptibility genes of AIS may play important roles in the diagnosis and therapy of AIS in the future. We believe that the role of HSPG2 in the development of AIS still needs further investigation. The primary limitation of our study lies in that we did not sequence all the exons of HSPG2. It cannot be excluded that enrichment of other mutations of HSPG2 could play a role in AIS. Besides, the function of p.Asn786Ser should be investigated through in-vivo cellular experiment to clarify its role in AIS.

Conclusions

HSPG2 gene was not associated with the susceptibility or the phenotypes of AIS in the Chinese population. In future study, functional studies of p.Asn786Ser is warranted to clarify whether this variant can regulate the expression of HSPG2. The whole HSPG2 gene can be sequenced in more AIS patients to identify potentially causative mutations.

Acknowledgements

We gratefully acknowledge the support of all doctors in our department.

Funding

The data collection was supported by the Natural Science Foundation of China (No. 81501849, No.81661168013, No.81171672, No.81772304 & No. 81501932), the experiments and data analysis were supported by Natural Science Foundation of Jiangsu Province (BK20150099), and Nanjing Medical Science and technology development Foundation (Grant No. YKK15059).

Availability of data and materials

The raw data is available from the corresponding author upon reasonable request.
Approved by the Institutional Review Board (IRB)/Independent Ethics Committee (IEC) of Nanjing Drum Tower Hospital (The Affiliated Drum Tower Hospital of Nanjing University Medical School) at Zhongshan Road 321, Nanjing 210,008, China. All subjects provided informed consent to take part in the study. Written informed consent was obtained from the parents of the participants in this study that are under 18 years old.
Not applicable.

Competing interests

The corresponding author Zezhang Zhu is a member of the Editorial Board of BMC Musculoskeletal Disorders.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Murray DW, Bulstrode CJ. The development of adolescent idiopathic scoliosis. Eur Spine J. 1996;5(4):251–7.CrossRef Murray DW, Bulstrode CJ. The development of adolescent idiopathic scoliosis. Eur Spine J. 1996;5(4):251–7.CrossRef
2.
Zurück zum Zitat Kouwenhoven JW, Castelein RM. The pathogenesis of adolescent idiopathic scoliosis: review of the literature. Spine. 2008;33(26):2898–908.CrossRef Kouwenhoven JW, Castelein RM. The pathogenesis of adolescent idiopathic scoliosis: review of the literature. Spine. 2008;33(26):2898–908.CrossRef
3.
Zurück zum Zitat Xu L, Qiu X, Sun X, Mao S, Liu Z, Qiao J, Qiu Y. Potential genetic markers predicting the outcome of brace treatment in patients with adolescent idiopathic scoliosis. Eur Spine J. 2011;20(10):1757–64.CrossRef Xu L, Qiu X, Sun X, Mao S, Liu Z, Qiao J, Qiu Y. Potential genetic markers predicting the outcome of brace treatment in patients with adolescent idiopathic scoliosis. Eur Spine J. 2011;20(10):1757–64.CrossRef
4.
Zurück zum Zitat Wei-Jun W, Xu S, Zhi-Wei W, Xu-Sheng Q, Zhen L, Yong Q. Abnormal anthropometric measurements and growth pattern in male adolescent idiopathic scoliosis. Eur Spine J. 2012;21(1):77–83.CrossRef Wei-Jun W, Xu S, Zhi-Wei W, Xu-Sheng Q, Zhen L, Yong Q. Abnormal anthropometric measurements and growth pattern in male adolescent idiopathic scoliosis. Eur Spine J. 2012;21(1):77–83.CrossRef
5.
Zurück zum Zitat Wang S, Qiu Y, Ma Z, Xia C, Zhu F, Zhu Z. Expression of Runx2 and type X collagen in vertebral growth plate of patients with adolescent idiopathic scoliosis. Connect Tissue Res. 2010;51(3):188–96.CrossRef Wang S, Qiu Y, Ma Z, Xia C, Zhu F, Zhu Z. Expression of Runx2 and type X collagen in vertebral growth plate of patients with adolescent idiopathic scoliosis. Connect Tissue Res. 2010;51(3):188–96.CrossRef
6.
Zurück zum Zitat Guyot MA, Agnani O, Peyrodie L, Samantha D, Donze C, Catanzariti JF. Cervicocephalic relocation test to evaluate cervical proprioception in adolescent idiopathic scoliosis. Eur Spine J. 2016;25(10):3130–6.CrossRef Guyot MA, Agnani O, Peyrodie L, Samantha D, Donze C, Catanzariti JF. Cervicocephalic relocation test to evaluate cervical proprioception in adolescent idiopathic scoliosis. Eur Spine J. 2016;25(10):3130–6.CrossRef
7.
Zurück zum Zitat Sun X, Qiu Y, Zhu Z. Variations of the position of the cerebellar tonsil in adolescent idiopathic scoliosis with severe curves: a MRI study. Stud Health Technol Inform. 2006;123:565–70.PubMed Sun X, Qiu Y, Zhu Z. Variations of the position of the cerebellar tonsil in adolescent idiopathic scoliosis with severe curves: a MRI study. Stud Health Technol Inform. 2006;123:565–70.PubMed
8.
Zurück zum Zitat Morcuende JA, Minhas R, Dolan L, Stevens J, Beck J, Wang K, Weinstein SL, Sheffield V. Allelic variants of human melatonin 1A receptor in patients with familial adolescent idiopathic scoliosis. Spine. 2003;28(17):2025–8 discussion 2029.CrossRef Morcuende JA, Minhas R, Dolan L, Stevens J, Beck J, Wang K, Weinstein SL, Sheffield V. Allelic variants of human melatonin 1A receptor in patients with familial adolescent idiopathic scoliosis. Spine. 2003;28(17):2025–8 discussion 2029.CrossRef
9.
Zurück zum Zitat Miller NH, Mims B, Child A, Milewicz DM, Sponseller P, Blanton SH. Genetic analysis of structural elastic fiber and collagen genes in familial adolescent idiopathic scoliosis. J Orthop Res. 1996;14(6):994–9.CrossRef Miller NH, Mims B, Child A, Milewicz DM, Sponseller P, Blanton SH. Genetic analysis of structural elastic fiber and collagen genes in familial adolescent idiopathic scoliosis. J Orthop Res. 1996;14(6):994–9.CrossRef
10.
Zurück zum Zitat Miller NH. Genetics of familial idiopathic scoliosis. Clin Orthop Relat Res. 2007;462:6–10.CrossRef Miller NH. Genetics of familial idiopathic scoliosis. Clin Orthop Relat Res. 2007;462:6–10.CrossRef
11.
Zurück zum Zitat Miller NH, Justice CM, Marosy B, Doheny KF, Pugh E, Zhang J, Dietz HC 3rd, Wilson AF. Identification of candidate regions for familial idiopathic scoliosis. Spine. 2005;30(10):1181–7.CrossRef Miller NH, Justice CM, Marosy B, Doheny KF, Pugh E, Zhang J, Dietz HC 3rd, Wilson AF. Identification of candidate regions for familial idiopathic scoliosis. Spine. 2005;30(10):1181–7.CrossRef
12.
Zurück zum Zitat Xu L, Xia C, Sun W, Qin X, Qiu Y, Zhu Z. Genetic polymorphism of NUCKS1 is associated with the susceptibility of adolescent idiopathic scoliosis. Spine. 2017;42(21):1629–34. Xu L, Xia C, Sun W, Qin X, Qiu Y, Zhu Z. Genetic polymorphism of NUCKS1 is associated with the susceptibility of adolescent idiopathic scoliosis. Spine. 2017;42(21):1629–34.
13.
Zurück zum Zitat Xu L, Huang S, Qin X, Mao S, Qiao J, Qian BP, Qiu Y, Zhu Z. Investigation of the 53 markers in a DNA-based prognostic test revealing new predisposition genes for adolescent idiopathic scoliosis. Spine. 2015;40(14):1086–91.CrossRef Xu L, Huang S, Qin X, Mao S, Qiao J, Qian BP, Qiu Y, Zhu Z. Investigation of the 53 markers in a DNA-based prognostic test revealing new predisposition genes for adolescent idiopathic scoliosis. Spine. 2015;40(14):1086–91.CrossRef
14.
Zurück zum Zitat Mao S, Xu L, Zhu Z, Qian B, Qiao J, Yi L, Qiu Y. Association between genetic determinants of peak height velocity during puberty and predisposition to adolescent idiopathic scoliosis. Spine. 2013;38(12):1034–9.CrossRef Mao S, Xu L, Zhu Z, Qian B, Qiao J, Yi L, Qiu Y. Association between genetic determinants of peak height velocity during puberty and predisposition to adolescent idiopathic scoliosis. Spine. 2013;38(12):1034–9.CrossRef
15.
Zurück zum Zitat Inoue M, Minami S, Nakata Y, Kitahara H, Otsuka Y, Isobe K, Takaso M, Tokunaga M, Nishikawa S, Maruta T, et al. Association between estrogen receptor gene polymorphisms and curve severity of idiopathic scoliosis. Spine. 2002;27(21):2357–62.CrossRef Inoue M, Minami S, Nakata Y, Kitahara H, Otsuka Y, Isobe K, Takaso M, Tokunaga M, Nishikawa S, Maruta T, et al. Association between estrogen receptor gene polymorphisms and curve severity of idiopathic scoliosis. Spine. 2002;27(21):2357–62.CrossRef
16.
Zurück zum Zitat Qiu XS, Tang NL, Yeung HY, Qiu Y, Qin L, Lee KM, Cheng JC. The role of melatonin receptor 1B gene (MTNR1B) in adolescent idiopathic scoliosis--a genetic association study. Stud Health Technol Inform. 2006;123:3–8.PubMed Qiu XS, Tang NL, Yeung HY, Qiu Y, Qin L, Lee KM, Cheng JC. The role of melatonin receptor 1B gene (MTNR1B) in adolescent idiopathic scoliosis--a genetic association study. Stud Health Technol Inform. 2006;123:3–8.PubMed
17.
Zurück zum Zitat Ryzhkov II, Borzilov EE, Churnosov MI, Ataman AV, Dedkov AA, Polonikov AV. Transforming growth factor beta 1 is a novel susceptibility gene for adolescent idiopathic scoliosis. Spine. 2013;38(12):E699–704.CrossRef Ryzhkov II, Borzilov EE, Churnosov MI, Ataman AV, Dedkov AA, Polonikov AV. Transforming growth factor beta 1 is a novel susceptibility gene for adolescent idiopathic scoliosis. Spine. 2013;38(12):E699–704.CrossRef
18.
Zurück zum Zitat Takahashi Y, Matsumoto M, Karasugi T, Watanabe K, Chiba K, Kawakami N, Tsuji T, Uno K, Suzuki T, Ito M, et al. Lack of association between adolescent idiopathic scoliosis and previously reported single nucleotide polymorphisms in MATN1, MTNR1B, TPH1, and IGF1 in a Japanese population. J Orthop Res. 2011;29(7):1055–8.CrossRef Takahashi Y, Matsumoto M, Karasugi T, Watanabe K, Chiba K, Kawakami N, Tsuji T, Uno K, Suzuki T, Ito M, et al. Lack of association between adolescent idiopathic scoliosis and previously reported single nucleotide polymorphisms in MATN1, MTNR1B, TPH1, and IGF1 in a Japanese population. J Orthop Res. 2011;29(7):1055–8.CrossRef
19.
Zurück zum Zitat Liu Z, Tang NL, Cao XB, Liu WJ, Qiu XS, Cheng JC, Qiu Y. Lack of association between the promoter polymorphisms of MMP-3 and IL-6 genes and adolescent idiopathic scoliosis: a case-control study in a Chinese Han population. Spine. 2010;35(18):1701–5.CrossRef Liu Z, Tang NL, Cao XB, Liu WJ, Qiu XS, Cheng JC, Qiu Y. Lack of association between the promoter polymorphisms of MMP-3 and IL-6 genes and adolescent idiopathic scoliosis: a case-control study in a Chinese Han population. Spine. 2010;35(18):1701–5.CrossRef
20.
Zurück zum Zitat Zhu Z, Xu L, Leung-Sang Tang N, Qin X, Feng Z, Sun W, Zhu W, Shi B, Liu P, Mao S, et al. Genome-wide association study identifies novel susceptible loci and highlights Wnt/beta-catenin pathway in the development of adolescent idiopathic scoliosis. Hum Mol Genet. 2017;26(8):1577–83. Zhu Z, Xu L, Leung-Sang Tang N, Qin X, Feng Z, Sun W, Zhu W, Shi B, Liu P, Mao S, et al. Genome-wide association study identifies novel susceptible loci and highlights Wnt/beta-catenin pathway in the development of adolescent idiopathic scoliosis. Hum Mol Genet. 2017;26(8):1577–83.
21.
Zurück zum Zitat Zhu Z, Tang NL, Xu L, Qin X, Mao S, Song Y, Liu L, Li F, Liu P, Yi L, et al. Genome-wide association study identifies new susceptibility loci for adolescent idiopathic scoliosis in Chinese girls. Nat Commun. 2015;6:8355.CrossRef Zhu Z, Tang NL, Xu L, Qin X, Mao S, Song Y, Liu L, Li F, Liu P, Yi L, et al. Genome-wide association study identifies new susceptibility loci for adolescent idiopathic scoliosis in Chinese girls. Nat Commun. 2015;6:8355.CrossRef
22.
Zurück zum Zitat Sharma S, Londono D, Eckalbar WL, Gao X, Zhang D, Mauldin K, Kou I, Takahashi A, Matsumoto M, Kamiya N, et al. A PAX1 enhancer locus is associated with susceptibility to idiopathic scoliosis in females. Nat Commun. 2015;6:6452.CrossRef Sharma S, Londono D, Eckalbar WL, Gao X, Zhang D, Mauldin K, Kou I, Takahashi A, Matsumoto M, Kamiya N, et al. A PAX1 enhancer locus is associated with susceptibility to idiopathic scoliosis in females. Nat Commun. 2015;6:6452.CrossRef
23.
Zurück zum Zitat Ogura Y, Kou I, Miura S, Takahashi A, Xu L, Takeda K, Takahashi Y, Kono K, Kawakami N, Uno K, et al. A functional SNP in BNC2 is associated with adolescent idiopathic scoliosis. Am J Hum Genet. 2015;97(2):337–42.CrossRef Ogura Y, Kou I, Miura S, Takahashi A, Xu L, Takeda K, Takahashi Y, Kono K, Kawakami N, Uno K, et al. A functional SNP in BNC2 is associated with adolescent idiopathic scoliosis. Am J Hum Genet. 2015;97(2):337–42.CrossRef
24.
Zurück zum Zitat Kou I, Takahashi Y, Johnson TA, Takahashi A, Guo L, Dai J, Qiu X, Sharma S, Takimoto A, Ogura Y, et al. Genetic variants in GPR126 are associated with adolescent idiopathic scoliosis. Nat Genet. 2013;45(6):676–9.CrossRef Kou I, Takahashi Y, Johnson TA, Takahashi A, Guo L, Dai J, Qiu X, Sharma S, Takimoto A, Ogura Y, et al. Genetic variants in GPR126 are associated with adolescent idiopathic scoliosis. Nat Genet. 2013;45(6):676–9.CrossRef
25.
Zurück zum Zitat Takahashi Y, Kou I, Takahashi A, Johnson TA, Kono K, Kawakami N, Uno K, Ito M, Minami S, Yanagida H, et al. A genome-wide association study identifies common variants near LBX1 associated with adolescent idiopathic scoliosis. Nat Genet. 2011;43(12):1237–40.CrossRef Takahashi Y, Kou I, Takahashi A, Johnson TA, Kono K, Kawakami N, Uno K, Ito M, Minami S, Yanagida H, et al. A genome-wide association study identifies common variants near LBX1 associated with adolescent idiopathic scoliosis. Nat Genet. 2011;43(12):1237–40.CrossRef
26.
Zurück zum Zitat Sharma S, Gao X, Londono D, Devroy SE, Mauldin KN, Frankel JT, Brandon JM, Zhang D, Li QZ, Dobbs MB, et al. Genome-wide association studies of adolescent idiopathic scoliosis suggest candidate susceptibility genes. Hum Mol Genet. 2011;20(7):1456–66.CrossRef Sharma S, Gao X, Londono D, Devroy SE, Mauldin KN, Frankel JT, Brandon JM, Zhang D, Li QZ, Dobbs MB, et al. Genome-wide association studies of adolescent idiopathic scoliosis suggest candidate susceptibility genes. Hum Mol Genet. 2011;20(7):1456–66.CrossRef
27.
Zurück zum Zitat Patten SA, Margaritte-Jeannin P, Bernard JC, Alix E, Labalme A, Besson A, Girard SL, Fendri K, Fraisse N, Biot B, et al. Functional variants of POC5 identified in patients with idiopathic scoliosis. J Clin Invest. 2015;125(3):1124–8.CrossRef Patten SA, Margaritte-Jeannin P, Bernard JC, Alix E, Labalme A, Besson A, Girard SL, Fendri K, Fraisse N, Biot B, et al. Functional variants of POC5 identified in patients with idiopathic scoliosis. J Clin Invest. 2015;125(3):1124–8.CrossRef
28.
Zurück zum Zitat Buchan JG, Alvarado DM, Haller GE, Cruchaga C, Harms MB, Zhang T, Willing MC, Grange DK, Braverman AC, Miller NH, et al. Rare variants in FBN1 and FBN2 are associated with severe adolescent idiopathic scoliosis. Hum Mol Genet. 2014;23(19):5271–82.CrossRef Buchan JG, Alvarado DM, Haller GE, Cruchaga C, Harms MB, Zhang T, Willing MC, Grange DK, Braverman AC, Miller NH, et al. Rare variants in FBN1 and FBN2 are associated with severe adolescent idiopathic scoliosis. Hum Mol Genet. 2014;23(19):5271–82.CrossRef
29.
Zurück zum Zitat Justice CM, Bishop K, Carrington B, Mullikin JC, Swindle K, Marosy B, Sood R, Miller NH, Wilson AF. Evaluation of IRX genes and conserved noncoding elements in a region on 5p13.3 linked to families with familial idiopathic scoliosis and kyphosis. G3 (Bethesda, Md). 2016;6(6):1707–12.CrossRef Justice CM, Bishop K, Carrington B, Mullikin JC, Swindle K, Marosy B, Sood R, Miller NH, Wilson AF. Evaluation of IRX genes and conserved noncoding elements in a region on 5p13.3 linked to families with familial idiopathic scoliosis and kyphosis. G3 (Bethesda, Md). 2016;6(6):1707–12.CrossRef
30.
Zurück zum Zitat Haller G, Alvarado D, McCall K, Yang P, Cruchaga C, Harms M, Goate A, Willing M, Morcuende JA, Baschal E, et al. A polygenic burden of rare variants across extracellular matrix genes among individuals with adolescent idiopathic scoliosis. Hum Mol Genet. 2016;25(1):202–9.CrossRef Haller G, Alvarado D, McCall K, Yang P, Cruchaga C, Harms M, Goate A, Willing M, Morcuende JA, Baschal E, et al. A polygenic burden of rare variants across extracellular matrix genes among individuals with adolescent idiopathic scoliosis. Hum Mol Genet. 2016;25(1):202–9.CrossRef
31.
Zurück zum Zitat Baschal EE, Wethey CI, Swindle K, Baschal RM, Gowan K, Tang NL, Alvarado DM, Haller GE, Dobbs MB, Taylor MR, et al. Exome sequencing identifies a rare HSPG2 variant associated with familial idiopathic scoliosis. G3. 2014;5(2):167–74.CrossRef Baschal EE, Wethey CI, Swindle K, Baschal RM, Gowan K, Tang NL, Alvarado DM, Haller GE, Dobbs MB, Taylor MR, et al. Exome sequencing identifies a rare HSPG2 variant associated with familial idiopathic scoliosis. G3. 2014;5(2):167–74.CrossRef
32.
Zurück zum Zitat Xu L, Xia C, Zhu W, Feng Z, Qin X, Sun W, Qiu Y, Zhu Z. Lack of association between AKAP2 and the susceptibility of adolescent idiopathic scoliosis in the Chinese population. BMC Musculoskelet Disord. 2017;18(1):368.CrossRef Xu L, Xia C, Zhu W, Feng Z, Qin X, Sun W, Qiu Y, Zhu Z. Lack of association between AKAP2 and the susceptibility of adolescent idiopathic scoliosis in the Chinese population. BMC Musculoskelet Disord. 2017;18(1):368.CrossRef
33.
Zurück zum Zitat Qiu XS, Lv F, Zhu ZZ, Qian BP, Wang B, Yu Y, Qiu Y. Lack of association between the CHL1 gene and adolescent idiopathic scoliosis susceptibility in Han Chinese: a case-control study. BMC Musculoskelet Disord. 2014;15:38.CrossRef Qiu XS, Lv F, Zhu ZZ, Qian BP, Wang B, Yu Y, Qiu Y. Lack of association between the CHL1 gene and adolescent idiopathic scoliosis susceptibility in Han Chinese: a case-control study. BMC Musculoskelet Disord. 2014;15:38.CrossRef
34.
Zurück zum Zitat Xu L, Sun W, Qin X, Qiu Y, Zhu Z. The TGFB1 gene is associated with curve severity but not with the development of adolescent idiopathic scoliosis: a replication study in the Chinese population. BMC Musculoskelet Disord. 2016;17:15.CrossRef Xu L, Sun W, Qin X, Qiu Y, Zhu Z. The TGFB1 gene is associated with curve severity but not with the development of adolescent idiopathic scoliosis: a replication study in the Chinese population. BMC Musculoskelet Disord. 2016;17:15.CrossRef
35.
Zurück zum Zitat Nada D, Julien C, Samuels ME, Moreau A. A replication study for association of LBX1 locus with adolescent idiopathic scoliosis in French-Canadian population. Spine. 2017;43(3):172–8 Nada D, Julien C, Samuels ME, Moreau A. A replication study for association of LBX1 locus with adolescent idiopathic scoliosis in French-Canadian population. Spine. 2017;43(3):172–8
36.
Zurück zum Zitat Costell M, Gustafsson E, Aszodi A, Morgelin M, Bloch W, Hunziker E, Addicks K, Timpl R, Fassler R. Perlecan maintains the integrity of cartilage and some basement membranes. J Cell Biol. 1999;147(5):1109–22.CrossRef Costell M, Gustafsson E, Aszodi A, Morgelin M, Bloch W, Hunziker E, Addicks K, Timpl R, Fassler R. Perlecan maintains the integrity of cartilage and some basement membranes. J Cell Biol. 1999;147(5):1109–22.CrossRef
37.
Zurück zum Zitat Stum M, Davoine CS, Vicart S, Guillot-Noel L, Topaloglu H, Carod-Artal FJ, Kayserili H, Hentati F, Merlini L, Urtizberea JA, et al. Spectrum of HSPG2 (Perlecan) mutations in patients with Schwartz-Jampel syndrome. Hum Mutat. 2006;27(11):1082–91.CrossRef Stum M, Davoine CS, Vicart S, Guillot-Noel L, Topaloglu H, Carod-Artal FJ, Kayserili H, Hentati F, Merlini L, Urtizberea JA, et al. Spectrum of HSPG2 (Perlecan) mutations in patients with Schwartz-Jampel syndrome. Hum Mutat. 2006;27(11):1082–91.CrossRef
38.
Zurück zum Zitat Ladhani NN, Chitayat D, Nezarati MM, Laureane MC, Keating S, Silver RJ, Unger S, Velsher L, Sirkin W, Toi A, et al. Dyssegmental dysplasia, Silverman-Handmaker type: prenatal ultrasound findings and molecular analysis. Prenat Diagn. 2013;33(11):1039–43.CrossRef Ladhani NN, Chitayat D, Nezarati MM, Laureane MC, Keating S, Silver RJ, Unger S, Velsher L, Sirkin W, Toi A, et al. Dyssegmental dysplasia, Silverman-Handmaker type: prenatal ultrasound findings and molecular analysis. Prenat Diagn. 2013;33(11):1039–43.CrossRef
39.
Zurück zum Zitat Mukaihara K, Godai K, Yamada T, Hasegawa-Moriyama M, Kanmura Y. Successful airway management using a MultiViewScope handle with a stylet scope in a patient with Schwartz-Jampel syndrome. JA Clin Rep. 2016;2(1):36.CrossRef Mukaihara K, Godai K, Yamada T, Hasegawa-Moriyama M, Kanmura Y. Successful airway management using a MultiViewScope handle with a stylet scope in a patient with Schwartz-Jampel syndrome. JA Clin Rep. 2016;2(1):36.CrossRef
Metadaten
Titel
Rare variant of HSPG2 is not involved in the development of adolescent idiopathic scoliosis: evidence from a large-scale replication study
verfasst von
Chao Xia
Leilei Xu
Bingchuan Xue
Fei Sheng
Yong Qiu
Zezhang Zhu
Publikationsdatum
01.12.2019
Verlag
BioMed Central
Erschienen in
BMC Musculoskeletal Disorders / Ausgabe 1/2019
Elektronische ISSN: 1471-2474
DOI
https://doi.org/10.1186/s12891-019-2402-x

Weitere Artikel der Ausgabe 1/2019

BMC Musculoskeletal Disorders 1/2019 Zur Ausgabe

Arthropedia

Grundlagenwissen der Arthroskopie und Gelenkchirurgie. Erweitert durch Fallbeispiele, Videos und Abbildungen. 
» Jetzt entdecken

Update Orthopädie und Unfallchirurgie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.