Background
Hepatitis B virus (HBV) is prevalent worldwide, with an estimated 400 million people infected with HBV globally [
1]. About 350 million people have chronic HBV infections [
2]. Annually, HBV-related cirrhosis and hepatocellular carcinoma account for more than 750,000 deaths worldwide [
3]. HBV infection has a heavy economic and social burden for both HBV patients and society in general.
In addition to tests for HBV serological markers, which include HBsAg, anti-HBsAg, HBeAg, anti-HBeAg and anti-HBc, and serum alanine transaminase (ALT) and aspartate transaminase (AST) tests, quantification of HBV DNA, which reflects the viral load, could also aid in measurement and management of HBV infections. HBV DNA levels change during different phases of infection in chronically HBV infected individuals [
4]. HBV DNA measurements play a critical role in determining the phase of infection, deciding the treatment, and detecting responses to the antiviral therapy [
2]. According to the guidelines for the prevention, care, and treatment with persons with chronic hepatitis B virus from the World Health Organization and China, HBV DNA quantification is recommended in the treatment of chronic HBV infections [
5,
6].
Hepatitis B virus has a highly variable DNA genome and is divided into genotypes A– H based on the 8% sequence variations in the S region [
7]. These genotypes can be further differentiated into subgenotypes [
8]. Because HBV replicates its DNA genome through reverse transcription of pregenomic RNA and its DNA polymerase lacks proofreading activity, the mutation rate is higher than that in most of the other DNA viruses [
8‐
10]. Long-term treatment with antiviral drugs such as lamivudine and adefovir can also lead to mutations in the HBV genome. The typical mutation caused by lamivudine is a mutation in the YMDD motif of the polymerase [
11]. In addition to the common drug resistance mutations, other variations, both characterized and uncharacterized, may occur due to HBV treatment.
Unlike traditional PCR, real-time PCR, with its increased accuracy, wider linear range, and reproducibility, is widely used for the quantitative detection of HBV DNA [
12,
13]. Currently, most HBV DNA quantification reagents use one pair of primers and a single probe for a given HBV genotype test. If HBV genetic variations exist in these primer or probe regions, the actual viral load of HBV will be underestimated by the assay. Mutations in the probe region of the COBAS Amplicor test caused by lamivudine led to the underestimation of the HBV DNA level of a chronic hepatitis patient [
14].
Human immunodeficiency virus (HIV) is a genetically diverse retrovirus, and several pairs of primers and probes were helpful for its nucleic acid test [
15,
16]. Thus, two pairs of primers and probes may prevent the underestimation of HBV DNA levels caused by mutations in the primer or probe regions. A duplex real-time PCR method for HBV DNA detection has been described; however, the advantages of this method for the quantitative determination of HBV DNA have not been demonstrated [
17].
China has a moderately high prevalence of HBV infections, and the positive rate for HBsAg was 7.2% according to an epidemiological survey in conducted in 2006 [
18]. Additionally, HBV is a highly genetically varied DNA virus and there are a number of drug-resistant mutants. We speculate that it is necessary to quantify HBV DNA levels using at least two pairs of primers and probes. The aim of the study was to: 1) to validate feasibility of a duplex real-time PCR method for HBV DNA quantification; and 2) to confirm the necessity of two pairs of primers and probes for HBV DNA quantitation.
Methods
Primers and probes selection for the duplex real-time PCR
One thousand HBV complete sequences from Chinese patients were downloaded from the NCBI database, which include genotypes A, B, C, D, and G and were aligned by the DNAman software. Primers and probes were designed by Primer 5 to target the conserved sequences of the S and C regions of the HBV genome. Primers were selected by testing using EvaGreen, and primers with significant dimerization were removed. Probes with lower count (Ct) values were chosen for further experiments (data not shown). The primers and probes are listed in Table
1.
Table 1
The primers and probe sequences for the S and C regions
S-F | GATGTGTCTGCGGCGTTTTA |
S-R | GCAACATACCTTGATAGTCCAGAAGAA |
S-P | Vic-CCTCTICATCCTGCTGCTATGCCTCA-BHQ1 |
C-F | TTCCGGAAACTACTGTTGTTAGAC |
C-R | ATTGAGATTCCCGAGATTGAGA |
C-P | Fam-CCCTAGAAGAAGAACTCCCTCGCCTC-BHQ1 |
Standard materials
Plasma from a patient with a high-titer viral load was serially diluted 1:10 seven times. The plasma serial dilutions were quantified using the COBAS TaqMan HBV Test version 2 (Cobas, Switzerland). The quantified values were evaluated using the World Health Organization (WHO) Second International Standard for HBV DNA (National Institute for Biological Standards and Control, NIBSC; code 96/798, UK).
DNA extraction and detection
Template DNA was extracted from 400 μl plasma with an automatic ExiPrep Dx Viral DNA kit (Bioneer, Korea) on an ExiPrep 16 Dx according to the manufacturer’s instructions. We added the primers S-F (concentration: 0.8 μmol/μl), S-R (concentration: 0.8 μmol/μl), S-P (concentration: 0.2 μmol/μl), C-F (concentration: 0.3 μmol/μl), C-R (concentration: 0.3 μmol/μl), and C-P (concentration: 0.1 μmol/μl) into same the tube to target both the S and C regions of the HBV genome. Baorui master mix (5×; baorui, Zhuhai, China) was used for PCR reactions with the SLAN-96S Real-Time PCR System (Slan, Shanghai, China). The qPCR volume was 100 μl with 74 μl DNA template. The PCR program was: 50 °C for 2 min, 95 °C for 1 min, 95 °C for 5 s, 55 °C for 40 s, and then 60 cycles of 25 °C for 1 min.
Linearity
Serially diluted standard samples were prepared with concentrations from 2 × 108 to 2 × 101 IU/ml. Each concentration was tested in triplicate.
Limit of detection (LOD) and specificity
The WHO Second International Standard for HBV DNA was diluted to 100, 50, 20, 10, 5, and 2.5 IU/ml. Each concentration was tested 20 times. Probit analysis was used to determine the LOD of the assay. Fifty samples of HBV-negative serum or plasma were tested by the assay to analyze specificity.
Patients and plasma
Group A consisted of 104 plasma samples obtained from patients at the 302 Military Hospital of China and group B consisted of 59 plasma samples obtained from patients at Beijing ChaoYang Hospital between July 2016 and August 2016. Group C was 75 HBV DNA positive plasma samples obtained from blood banks in China. HBV DNA in Group A and Group C samples was quantitatively analyzed using the COBAS TaqMan HBV Test version 2 (CTM, v2), while samples from Group B were analyzed with the Daan real-time PCR assay. Both assays were performed according to the manufacturer’s instructions. All samples were stored at −30 °C. The institutional review board of the National Center for Clinical Laboratories approved this study. The methods in the study are in accordance with the guidelines of the Declaration of Helsinki. Written informed consent was obtained from all subjects participating in this study.
Comparison of quantitative results for HBV DNA, sequencing, and plasmid construction and validation
The samples with quantitative differences larger than 1 log
10 IU/ml between the in-house method and the CTM, v2 assay were used to amplify the full-length or pre-Core and Core regions of HBV, according to the methods described by Günther S and Lieven Stuyver, respectively [
19,
20]. The HBV PCR products from these samples were cloned into a T vector and then sequenced by Sangon Biotech Co., Ltd. (Shanghai). The concentrations of plasmid DNA were measured using a Meriton SMA6000 (Meriton, USA) and converted to copies/ml and IU/ml (1 IU = 5.82 copies). The plasmids were quantitatively measured in triplicate by the CTM, v2 assay; Daan real-time PCR assay; and the in-house method. The samples with differences in the quantitative results between the S and C regions using the in-house duplex PCR were amplified using the primers in Table
2 and sequenced. At the same time, four samples had quantitative results from the in-house assay that were similar with that of CTM, v2 assay and were also amplified and sequenced providing reference sequence controls. The alignment of these sequences was analyzed using DNAman software.
Table 2
The primers for amplification of the S and C regions
Sa-F | TCGTGTTACAGGCGGGGTTT |
Sa-R | GGCACTAGTAAACTGAGCCA |
Ca-F | CCTACTGTTCAAGCCTCCAA |
Ca-R | AATGTCCTCCTGTAAATGAATGT |
Statistical analysis
Statistical analyses were performed using SPSS software version 19.0 and Graph Prism 5.0. Pearson’s correlation coefficients and linear regression were used for correlation analysis. Bland-Altman tests were used to assess the agreement of the quantitative results of HBV DNA between the CTM, v2 assay or the Daan test and the in-house method.
Discussion
Due to the effects of genetic variations on HBV DNA quantification, we developed a duplex real-time PCR assay using two pairs of primers and probes based on conserved sequences of the S and C regions of the HBV genome. In this study, we confirmed that the quantitative results of the S and C regions were similar, but that mutations in the amplified region led to an underestimation of the C region in four samples. At the same time, the results of the duplex real-time PCR were also in good agreement with that of the Roche and Daan kits; however, underestimation of DNA levels could be present in 11 samples using the Roche kit and 3 samples using the Daan kit. This study demonstrated that commercial kits, which contained only one pair of primers and a single probe, might underestimate HBV DNA levels in some HBV specimens. It also implied that at least two pairs of primers and two probes are necessary for HBV DNA quantification, and the duplex real-time PCR can be used for this application.
In our study, we chose the Roche kit, which is widely used for HBV DNA quantification around the world and the Daan kit, which is used widely in China for analysis. The Roche kit uses one pair of primers and a single probe for a specific sample. Our study demonstrated that the Roche and Daan kits could lead to underestimation of HBV DNA levels because of the variations in the amplified region. This implies there is a defect in kits with only one pair of primers and a single probe for HBV DNA quantification. At the same time, it also demonstrated the necessity of using two pairs of primers and two probes for the quantitative detection of HBV DNA, which is highly variable. In previous studies, it was demonstrated that several primers and probes were helpful for the nucleic acid test for HIV, which is a genetically variable retrovirus [
15,
16]. In our study, we developed a duplex real-time PCR that used two pairs of primers and two probes, which were based on the S and C regions of HBV. It also showed good agreement with the Roche and Daan kits and demonstrated good correlation between results for the S and C regions and linearity, which confirms the feasibility of using the duplex real-time PCR.
On the other hand, there were several shortcomings of this study. First, the number of the samples used for the comparison of the Roche and Daan kits with the duplex real-time PCR was small. Second, the exact sequences of the primers and probes of the Roche and Daan kits were unknown. We could only perform alignment of the target region sequences of the underestimated and accordant samples and validate the sequence variation through construction of plasmids containing whole HBV DNA or an amplified region. Third, the duplex real-time PCR assay was not a validated kit and there was no internal control.
Previous studies have demonstrated that several commercial kits, which use only one pair of primers and a single probe, could not detect hepatitis C virus (HCV) samples whose sequences had mismatches with primers or probes [
21,
22]. Real-time PCR assays using two primers and probes have been developed for HCV and HIV detection [
23,
24]. HBV is a highly variable DNA virus and with many mutations that emerge with the use of antiviral drugs. It has been reported that the HBV DNA level of an patient who was put on long-term lamivudine therapy was underestimated by more than 1.5 log
10 IU/ml by the COBAS Amplicor assay because of lamivudine resistance mutations in the probe region [
14]. Sun et al. developed a duplex real-time PCR using two pairs of primers and two probes targeting the S region; however, the assay was only used to screen for HBV DNA, and it has not been demonstrated that mutations in probes or primers could affect the detection of HBV [
17]. In this study, we developed a duplex real-time PCR assay to use for HBV DNA quantification. We confirmed that mutations in primers or probes could lead to the underestimation of HBV DNA levels in both the duplex real-time PCR assay and the Roche kit. The mutations in the forward and reverse primers targeting the C region in our in-house duplex real-time PCR led to the underestimation of DNA levels. The mutations T1938A, T1961G, and C1962G were also observed in the samples with HBV DNA levels determined by the Roche kit to be more than 1 log
10 IU/ml lower than determined by the duplex real-time PCR, which is consistent with a previous study [
25]. At the same time, we also found 3 out of 59 HBV samples were underestimated by the Daan kit. There are about one third of 350 million HBV carriers living in China. The natural polymorphisms in many HBV sample may be complex and drug resistance mutations, which may emerge with antiviral drug usage. Thus, the commercial kits using only one pair of primers and a single probe may underestimate the HBV DNA levels of samples that have mismatches with primers/probes. As several pairs of primers and probes are used to detect HCV and HIV, we developed a duplex real-time PCR assay to try to solve the underestimation problem. The duplex real-time PCR assay showed good linearity and agreement with the Roche and Daan kits. This demonstrated that a real-time PCR assay containing at least two pairs of primers and probes could avoid underestimation in HBV samples.
Accurate HBV DNA quantification plays a critical role in determining the phase of infection, deciding the treatment, and detecting responses to antiviral therapy [
2]. We found that HBV DNA levels could be underestimated by commercial kits in Chinese HBV-infected patients. If the commercial kits used two or more pairs of primers and probes for HBV quantification, the probability of underestimating the DNA levels would significantly drop. At the same time, if manufacturers published the sequences of primers and probes in commercial kits, it allow for better determination of the problem when patient HBV DNA level underestimation occurred.
Acknowledgments
We thank Professor Haibin Wang from 302 military hospital of China for his assistance during this study.