Background
Cancer is a multifactorial and dynamic disease that continues to be a challenge to treat [
1]. The development of effective tumor therapeutics significantly depends on reliable in vitro screening systems. The absence of reliable in vitro screening models that could recapitulate key aspects of tumor microenvironment such as drug resistance and phenotypic changes to cells is an impediment to the reliable translation of in vitro findings into in vivo clinical models. This poor in vitro-in vivo correlation is one factor that has an adverse impact on drug development costs, which are currently projected to exceed $1.5 billion for each single drug that gains approval [
2]. Therefore, there is a need to develop in vitro models that can more accurately reflect the in vivo environment and in vivo efficacy. Towards this long-term objective, 3-D aggregates of tumor cells, commonly referred to as tumor spheroids, are an attractive alternative to 2-D cell culture [
3] as they can reproduce many aspects of the tumor microenvironment including paracrine effects, cell-cell interactions, and extracellular matrix deposition [
4‐
6]. Furthermore, 3-D cell culture can recapitulate many of the environmental factors that induce metabolic and oxidative stress in cells within tumors, such as oxygen and nutritional gradients, hypoxia, and the formation of a necrotic core [
3]. 3-D spheroids additionally have the potential to reduce the time and costs associated with translation of laboratory findings into animal models, [
7] and are also compatible with the next generation high throughput screening technologies [
8,
9].
It is well established that tumors are heterogeneous in both cellularity (epithelial, vascular, immune cells, and fibroblasts) and extracellular matrix (ECM) composition [
1]. Multicellular tumor spheroid models currently described in the literature are typically generated using either the primary cells from tumor explants or tumor cell lines, and in some instances are co-cultured with fibroblasts or endothelial cells [
3,
10,
11]; therefore placing greater emphasis on the interaction between epithelial cells and stromal cells. In this context a tri culture system composed of human breast cancer epithelial cells, fibroblasts and endothelial cells has been described for high-throughput screening [
12]. However, the stroma of a solid tumor has in addition to vascular cells and immune cells, tumor-associated fibroblasts, which are believed to be derived from mesenchymal stem cells (MSCs) [
13]. There is also evidence that MSCs may serve as precursor to the stromal cells in epithelial tumors [
14]. MSCs, in addition to acting as support cells provide physical cues and soluble cues for angiogenesis [
15], are also assumed to have an immunomodulatory role and help in driving an aggressive and drug resistant tumor phenotype [
16,
17]. It has been shown that MSCs are actively recruited by tumors to aid in their growth and formation and it has been postulated that MSCs have the capacity to aid in the formation of the cancer niche [
18], and their recruitment facilitates metastasis in prostate tumors [
19]. For example, the co-injection of MSCs with melanoma cells has been demonstrated to promote allogeneic tumor formation by suppressing the host immune response [
20]. These observations prompted us to characterize spheroids derived from lung epithelial adenocarcinoma cells (A549) when co-cultured with human MSCs and human pulmonary microvascular endothelial cells (HPMEC). The rationale to include endothelial cells in the spheroid formation was to test the hypothesis that MSCs additionally might play a role in sustaining endothelial cells in the harsh nutrition depleted environment of tumor cores. To the best of our knowledge this is the first study to characterize multicellular spheroids of epithelial, MSCs, and endothelial cells. This multicellular spheroid system, which we have termed
synthetic
tumor Micro
environment
mimics (STEMs), exhibits many traits of mature tumor environments including a necrotic core devoid of epithelial cells, induction of drug resistance markers, and resistance to chemotherapeutics.
Methods
Cell culture experiments
The A549 cell line was provided by the BIOSS toolbox (Centre for Biological Signalling Studies, University of Freiburg) and was genotyped and verified by Labor für DNA Analytik (Freiburg, Germany). A549 was cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10 % fetal bovine serum (FBS) (Life Technologies, Germany), and 100 U/mL penicillin-streptomycin (PAN Biotech, Germany). The cells were cultured to 70–80 % confluency before being trypsinized for spheroid formation. Human pulmonary microvascular endothelial cells (HPMEC) were procured from ScienCell (USA) and cultured in endothelial cell growth medium (ScienCell, USA) supplemented with 5 % FBS and 50 U/mL penicillin-streptomycin. Human marrow-derived mesenchymal stem cells were kindly provided by Dr. Andrea Barbero and were obtained from patients under consent in accordance to the regulations of the institution’s ethical committee (University Hospital Basel; Ref Number of local ethical committee: 78/07). MSCs were sub-cultured in alpha-MEM containing 10 % FBS, 1 % penicillin-streptomycin, and 5 ng/ml fibroblast growth factor-2 (FGF2). HEK293 cells (a cell line derived from Human embryonic kidney cells) were obtained from BIOSS Toolbox (University of Freiburg, Germany), were genotyped and verified by Labor für DNA Analytik (Freiburg, Germany). They were sub-cultured in DMEM with 10 % FBS.
Transduction of A549 cells and HPMECs
Preparation of the viral particles
Lentiviral particles were produced in HEK293 cells. HEK293 cells (1x106 cells/well) were seeded in a 6-well plate and allowed to attach overnight, and then incubated with the lentiviral vector and packing vectors in presence of polyethyleneimine (PEI, MW 25Kda, Sigma, Germany) as the transfection agent. 5 μg of DNA (4:3:1 of transfer vector (GFP: pGIPZ (Openbiosystems, RHS4346), RFP: pTRIPZ RFP ires Not1 (BIOSS Toolbox, University of FReiburg)), packaging coding vector (pCMV-dR8.74, Addgene, Plasmid #22036)) and envelope coding vector (pMD2.G, Addgene, Plasmid #12259) were diluted in 250 μL Opti-MEM (Invitrogen, Germany) and 11.25 μl of PEI was mixed rapidly and incubated for 10 min and then added to the HEK293 cells. After 16 h, the cell medium was replaced with 2 ml of fresh medium. The following day, the culture medium was replaced with complete medium based on the target cells (DMEM or ECM) and 36 h after transfection, the medium containing viral particles was harvested and filtered using a 0.2-μm filter, and then stored at −80° Celsius until further use.
Transduction of A549 and HPMEC
A549 or HPMEC were were seeded at a density of 7x104 cells/well in a six well plate, and the cells were allowed to attach overnight, and on the following day the medium was changed and the viral particles encoding for the fluorescent protein of interest were added (RFP transduction of A549: 2 ml of viral particles; GFP transduction of HPMEC: 100 μl of viral particles). This step was repeated the following day to ensure robust transduction. After 24 h, 4 μg/ml of puromycin was added to select the transduced cells, and the dead cells were removed during medium change.
Preparation of STEMs
Spheroids were prepared using the hanging drop method (Fig.
1a). When the cell cultures reached 70–80 % confluency, cells were harvested by trypsinization, and STEM formation was initiated by combining A549, HPMEC, and MSCs at a ratio of 5:3:2 at a total density of 25×10
3 cells/25 μl/well in a 96 well hanging drop plate (3-D Biomatrix, USA). The choice of the cell ratio was based on the observation that stromal cells in general comprise a smaller fraction of the tumor, and recent studies have shown that at an A549: MSC ratio of 3:1, MSCs exert a proliferative effect on A549 in vivo [
21]. Furthermore, it is has been shown that increased vascularity along the periphery of non-small cell lung carcinoma, of which adenocarcinoma is a subtype, is associated with tumor progression [
22]. Therefore, we chose to have a starting cell composition that was high in HPMECs. The wells of the plate were filled with 4 ml of PBS to ensure that there was no evaporation of the cell culture medium from the drop. The medium in the drop was changed every alternate day by removing 2.5 μl of medium from the culture and adding 5 μl of fresh media to the wells.
Characterization of temporal changes to the cell composition in STEMs
In order to determine the temporal changes in cell population within the STEMs, STEMs were prepared using RFP and GFP expressing A549 and HPMEC respectively, and at pre-determined time points the spheroids were dissociated and the cell population quantified using flow cytometry. Spheroids were collected on day 1, i.e., 24 h after start of the experiment, day 3, 6, 10, and 15, and then transferred into an Eppendorf tube (4 spheroids per tube, n =3) and treated with collagenase (0.3 % Sigma Aldrich, Germany) for 30 min, and kept on a shaker maintained at 37 °C. The dissociated cells were resuspended with 300 μl of fluorescence-activated cell sorting (FACS) buffer and stored on ice until the FACS analysis was performed. For each of the experimental conditions, 10,000 viable cells were counted using a Gallios flow cytometer (Beckman Coulter, USA) and the viable cell population was analyzed using Kaluza software (version 1.2, Beckman Coulter) to determine the cellular composition. Percentage of cells that were RFP positive corresponded to A549 population, percentage of cells that were GFP positive corresponded to HPMEC population, and cells that were negative for both GFP and RFP corresponded to the MSC population.
Fluorescent microscopy of STEMs
STEMs produced using fluorescent protein expressing cells were harvested on day 15 by placing a few drops of PBS through the wells, fixed with 3.7 % formaldehyde and then embedded in OCT (VWR, Germany) overnight. The STEM spheroids were then sectioned into 10 μm sections using a cryo-stat (HYRAX C20, Zeiss), transferred onto slides (Superfrost, VWR, Germany), stained with DAPI nuclear stain, and then imaged using a Zeiss Cell Observer Z1 (Carl Zeiss, Germany) fluorescent microscope. Imaging of spheroids after live/dead staining images were acquired using a Zeiss LSM 510 confocal miscrocope.
Scanning electron microscopy of STEMs
To investigate the organization of cells within the STEMs as a function of time, spheroids were harvested on day 3, 6, 10, and 15, fixed with 2.5 % glutaraldehyde, dehydrated using graded series of ethanol, and dried in a vacuum desiccator at room temperature for 2 h. The desiccated spheroids were then sputter coated with gold for 60 s before imaging using a scanning electron microscope (SEM) (FEI Quanta 250 FEG). The images were acquired at an accelerating voltage of 20 KV and chamber pressure of 1.14 × 10 Pa at three different magnifications: 400 X, 6000 X, and 12000 X.
Metabolic activity in STEMs was examined using a 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. In the MTT assay, the MTT dye is converted by cellular mitochondrial esterases into an insoluble purple colored formazan that is measured spectrophotometrically and is reflective of metabolic activity of the cell [
23]. Spheroids were harvested at day 3, 6, 10, and 15, and incubated with 0.5 mg/ ml of MTT for 3 h . Following this, the MTT solution was aspirated and 100 μl of dimethyl sulfoxide was added to dissolve the purple colored formazan crystals. Absorbance was measured at 550 nm using a Synergy HT microplate reader (Bio-TEK Instruments INC, USA) (
n = 3).
Quantification of cell viability within STEMs
The fraction of viable cells within the STEMs was assessed using two quantitative methods: trypan blue exclusion after spheroid dissociation and FACS analysis.
Trypan blue exclusion assay
Spheroids were harvested on day 3, 6, 10, and 15, and trypsinized; and the cell suspension was diluted 1:1 with Trypan blue solution (0.4 w/v %), and counted using a hemocytometer (n = 3 spheroids with 3 technical repeats). In this assay, live cells exclude the dye and remain unstained while dead cells are stained blue.
FACS analysis
The fraction of viable cells within the population of cells that were analyzed was use to determine the fraction of non-viable cells.
Visualization of live and dead cells within STEMs
Following 15 days of culture, the spheroids were harvested from the hanging drop plate by pipetting 100 μl of PBS through the wells containing spheroids into 1.5 ml microcentrifuge tubes. The spheroids were then washed with PBS and were stained using the live/dead staining kit (Life Technologies, Invitrogen, Germany) by incubating with 6.25 μl each of calcein AM (1:400) and ethidium homodimer (EthD-1) (1:100) at 37 °C for 30 min to visualize live and dead cells and regions of cell death. The spheroids were then imaged with a confocal microscope (Carl Zeiss, Germany) (n = 3).
Oxidative stress assessment in STEMs
Reactive oxygen species (ROS) generation in STEMs was compared to cells grown on 2-D tissue culture polystyrene plates (TCPS). Intracellular ROS was quantified using a fluorescent assay where the non-fluorescent dichlorofluorescein diacetate (DCFH-DA) substrate in the presence of ROS is converted into the fluorescent dichlorofluorescein (DCF). After 15 days of culture, spheroids were transferred to flat-bottomed, dark sided 96 well plates, washed with PBS once, and incubated with 100 μl DCFH-DA for 45 min at 37 °C. Fluorescence was then measured using a plate reader (Bio-TEK, USA) at λexcitation 485 nm and λemission 535 nm. Finally, the ROS values were normalized with respect to cell number determined by MTT assay (n = 7).
Visualization of hypoxia in STEMs
Spheroids were harvested after 15 days in culture, treated with 200-μM pimonidazole for 3 h , fixed with 3.7 % formaldehyde, and sectioned. Then the sections were permeabilized with 0.1 % Triton-X 100, blocked with 2.5 % goat serum, and incubated with anti-pimonidazole antibody (1:200) (Hypoxyprobe™ Red 549 kit, Hypoxyprobe, Inc., USA) overnight at 4 °C. The samples were then washed with PBS, stained with DAPI, and imaged using a Carl Zeiss microscope, Germany. Since pimonidazole does not bind to necrotic region, the regions of hypoxia can be distinguished from regions of anoxia [
24]. The scoring of regions of proliferation and hypoxia was carried out as described by Mikhail et al. [
25].
Immunohistochemistry
The expression of phenotypic markers was analyzed qualitatively using immunohistochemistry. The spheroids and their corresponding 2-D controls were fixed with 3.7 % formaldehyde, and in the case of spheroids, subsequently embedded in OCT before sectioning. The 10 μm thick sections were rehydrated, incubated with 2.5 % goat serum and 0.1 % Triton X-100 in PBS for 1 h. The samples were then incubated with primary antibody CK-18 (1:100, Abcam, Clone: E431-1), fibronectin (1:300, Abcam, Cat No. ab6584), vimentin (1:800, Sigma Aldrich, Germany, Clone V9), and CD 31 (1:100, Abcam, Cat No. ab28364). The sections were then washed with PBS, and incubated with biotinylated secondary antibodies. Color development was performed using the Vectastain Elite kit and diaminobenzidine (DAKO). The samples were then counterstained with hematoxylin and imaged using a Carl Zeiss Z1 Cell observer microscope (Germany) (n = 3).
Expression of ABC-B1 drug resistant marker in STEMs
Gene expression levels of ATP-binding cassette (ABC) sub family B member 1 (ABC B1) in STEMs were measured using real time RT-qPCR at the end of day 15. For 2-D samples, the three cell types were cultured together and RNA isolation was performed at 60–70 % confluency using RNAeasy mini kit (QIAGEN), followed by cDNA synthesis by using 250 ng of RNA (Quantitect RT kit, Qiagen). Expression of ABC-B1 was normalized using 18 s rRNA. The sequence of the primers were as follows: ABC-B1: Forward: CAGAGGGGATGGTCAGTGTT; Reverse: CCTGACTCACCACACCAATG; 18srRNA: Forward: CCTGCGGCTTAATTTGACTC; Reverse: AACTAAGAACGGCCATGCAC (n = 4).
Response of STEMs to paclitaxel and gemcitabine
Sensitivity of STEMs at the end of day 15 to escalation in paclitaxel dose (1, 10, 100, and 1000 nM) and gemcitabine (1, 10, 30, and 100 μM) was studied and compared to 2-D triculture at 60–70 % confluency. 48 h after exposure to paclitaxel and gemcitabine, the loss in cell viability was assessed using MTT assay, and the data represented as percentage change with respect to untreated cells (n = 3).
Statistical analysis
All the quantitative data are expressed as mean value ± standard deviation. Statistical analysis was carried out using student’s t-test. A p value of < 0.05 was considered as statistically significant and * represents p < 0.05, ** represents p < 0.01, and *** represents p < 0.005.
Conclusions
Synthetic tumor microenvironment mimics, STEMs, composed of human lung epithelial, human lung endothelial, and human marrow-derived mesenchymal cells, were prepared using the hanging drop method, and characterized for their cellular and matrix characteristics (morphology, cell composition, and FN, CK18, vimentin, and CD31 expression), ROS production, and expression of drug resistance marker ABC-B1. After 15 days, STEMs showed many interesting characteristics including a hypoxic core that was devoid of epithelial cells but dominated by MSCs and a small but viable population of endothelial cells appear to be closely associated with MSCs in the hypoxic core. Immunohistochemistry revealed that, while FN expression was strong throughout, discrete regions that were positive for CK-18 and vimentin were present. Additionally, cells within STEMs showed high levels of ROS and upregulation of drug-resistance phenotype associated marker such as ABC-B1. In spite of the upregulation of marker associated with MDR, no appreciable differences in cell viability were observed between STEMs and 2-D tri-cultures in response to dose escalation of paclitaxel and gemcitabine. This unexpected finding suggests that the MDR phenotype might additionally require immune modulation and soluble signals. Nevertheless, the epithelial/endothelial/MSC 3-D culture model described herein bears many unique traits associated with cancer environments, and presents a useful platform for understanding tumor biology and drug screening.
Acknowledgement
The authors would like Mr. Vincent Ahmadi, Institute for Macromolecular Chemistry and University of Freiburg for assistance with Scanning Electron Microscopy (SEM) and Dr. Pavel Salvei of the BIOSS Tool Box core facility for assistance with FACS analysis. This work was funded by the 5th INTERREG Upper Rhine program (A21 NANO@MATRIX), by the Excellence Initiative of the German Federal and State Governments Grant EXC 294 and the Helmholtz Virtual Institute on Multifunctional Biomaterials for Medicine.