Introduction
Human toll-like receptors (TLRs), firstly identified in mammalian immune cells, are a family of type I transmembrane proteins comprised of an extracellular domain with a leucine-rich repeat region and an intracellular domain homologous to that of the human interleukin (IL)-1 receptor [
1]. TLRs have a powerful capacity to innate immune responses [
2] through recognition of pathogen-associated molecular patterns (PAMP) expressed by bacteria and viruses, and host-derived PAMPs [
3]. Until now, 11 types of mammalian homologues have been identified and characterized [
4].
Recently, new evidence has revealed that TLRs exist in many mouse [
5] and human tumors [
6‐
9], such as lung cancer, prostate cancer, neuroblastoma and breast cancer [
10]. Although the TLR profile varies in different tumor cells, current evidence indicates that the expression of TLRs and signaling cascade are functionally associated with tumor growth, progression, and invasion. For example, TLR2 signaling has been shown to promote lung cancer cell growth and resistant of apoptosis [
11]; TLR3 can directly trigger apoptosis in human cancer cells, such as breast cancer cells [
12], TLR2 and TLR9 can promote invasiveness and metastasis through metalloproteases and integrins [
13,
14].
Breast cancer is one of the common tumors occurring in women which is incurable and ultimately claims the life of the patient with complications. Thus, there is a need for new and effective breast cancer therapies. As TLRs are widely expressed on tumor cells and play important roles in the initiation and progression of cancer, they may thus serve an important target and have an effective perspective on breast cancer treatment.
Therefore, in this study, we aimed to determine which TLRs were expressed in human breast cancer cell line MDA-MB-231 and whether TLR4 played a functional role in the growth and progression of MDA-MB-231. A plasmid vector pGenesil-1 was developed to express a panel of siRNAs directed against TLR4. We planned to exploit the fact that small-interfering RNA (siRNA) can specifically inhibit gene expression with high efficiency [
15] and use it as an experimental tool to dissect the cellular pathways that lead to uncontrolled cell proliferation of breast cancer.
Materials and methods
Cell line and cell culture
Human breast cancer cell line MDA-MB-231 was purchased from the cell bank of Academia Sinica (Taipei, Taiwan). MDA-MB-231 was grown without antibiotics in 5% CO2 at 37°C in RPMI-1640 (Gibco, CA, USA) containing 10% FBS.
Qualitative RT-PCR
Total RNA was extracted using TRIzol reagent (Invitrogen, CA, USA) and the first-strand cDNA was synthesized according to the manufacturer's instructions using 4 μg total RNA with an oligo-dT primer and the myeloblastosis virus (MLV) reverse transcriptase (Promega, WI, USA). The PCR primers for TLRs (from TLR1 to TLR10) and GAPDH were intron-spanning, and are listed in Table
1. PCR products were analyzed on 1-2% (wt/vol) agarose gels containing 0. 5 μg/ml ethidium bromide and were visualized under UV light.
Table 1
PCR primers of human TLRs
TLR1 | For: TCTGGTACACGCATGGTC | 517 bp |
| Rev: ATGGGTGGGAAACTGAAT | |
TLR2 | For: AACTTACTGGGAAATCCTTAC | 264 bp |
| Rev: AAAAATCTCCAGCAGTAAAAT | |
TLR3 | For: GCATTTGTTTTCTCACTCTTT | 131 bp |
| Rev: TTAGCCACTGAAAAGAAAAAT | |
TLR4 | For: CGAGGAAGAGAAGACACCAGT | 106 bp |
| Rev: CATCATCCTCACTGCTTCTGT | |
TLR5 | For: AGCTTCAACTATATCAGGACA | 383 bp |
| Rev: TGGTTGGAGGAAAAATCTAT | |
TLR6 | For: CTTCCATTTTGTTTGCCTTAT | 123 bp |
| Rev: AGCGGTAGGTCTTTTGGAAC | |
TLR7 | For: AAACTCCTTGGGGCTAGATG | 149 bp |
| Rev: AGGGTGAGGTTCGTGGTGTT | |
TLR8 | For: CTGTGAGTTATGCGCCGAAGA | 246 bp |
| Rev: TGGTGCTGTACATTGGGGTTG | |
TLR9 | For: CGCCCTGCACCCGCTGTCTCT | 168 bp |
| Rev: CGGGGTGCTGCCATGGAGAAG | |
TLR10 | For: AGAAGAAAGGGAACTGATGAC | 279 bp |
| Rev: CCTGCCAGTAAATACCAAGT | |
GAPDH | For: GGATTTGGTCGTATTGGG | 205 bp |
| Rev: GGAAGATGGTGATGGGATT | |
Real-time RT-PCR
Real-time RT-PCR was performed to detect TLRs gene expression. The 50 μl reaction mixture contained 45 μl DEPC-H
2O, 1.0 μl cDNA (1:100 dilution), 2.0 μl (10 μM) of each primer and freeze-dried powder of the AccuPower Greenstar
® qPCR premix. The thermal cycle profile for PCR was as follows: 94°C for 5 min, 40 cycles of PCR (94°C for 30 sec; 55°C for 30 sec; 72°C for 30 sec). The fluorescence was digitally collected after each cycle of 72°C for 30 sec. After PCR, the samples were subjected to a temperature ramp with continuous fluorescence monitoring for melting curve analysis. BIONEER Exicycler™ analysis software (Bioneer Corp., Daejeon, Korea) was used to obtain the Ct values. 2
-ΔΔ CT method [
16] was used to analyze the relative expression of each TLR in MDA-MB-231.
TLRs protein expression analysis
To detect the cell protein expression of TLRs, 106 cultured MDA-MB-231 were prefixed and permeabilized. Then, the cells were stained with 3 μl purified anti-human TLR4 antibody (Santa Cruz Biotechnology, CA, USA) at 4°C for 30 min away from light. After washing twice with 1×PBS, the cells were incubated with 2 μl PE-conjugated goat anti-rabbit IgG mAb (Santa Cruz Biotechnology) at 4°C for 30 min away from light, followed by an additional two washes with 1×PBS. Finally, the stained cells in 500 μl 1×PBS were analyzed by using a flow cytometer (FACScalibur; Becton Dickinson (BD), NJ, USA), and the data were processed with BD CellQuest software. The negative control was performed by omitting the anti TLR4 antibody.
Immunofluorescence analysis
Cells cultured overnight were fixed with alcohol for 30 min and blocked in 1×PBS (pH 7.4) solution with 3% BSA overnight at 4°C in a hydrated box. Anti-TLR4 antibody was added at a 1:100 dilution (Santa Cruz Biotechnology) and allowed to incubate overnight at 4°C in a hydrated box. After washing three times, fluorescent secondary antibody (Santa Cruz Biotechnology) was added at a 1:100 dilution. The cells were again washed three times with 1×PBS, and counter-stained with DAPI. Fluorescence was analyzed by fluorescence microscope (DMI4000B; Leica, IL, USA). Adobe Photoshop 9.0 software (CA, USA) was used for subsequent image processing.
RNA interference
Cells were transiently transfected with a GFP expressing plasmid pGsil-1 (Genesil, Wuhan, China) containing silencing RNA (siRNA) directed against TLR4. The three pieces of small interfering oligonucleotide specific for human TLR4 have been listed in Table
2 . Briefly, 2×10
5 cells were seeded in 6-well dishes and cultured overnight until 60% to 70% confluency was reached. Transfections were performed using Lipofectamine™ 2000 reagent (Invitrogen) per the manufacturer's instructions. Cells were transfected with 4 μg plasmid DNA (TLR4AsiRNA, TLR4BsiRNA, TLR4CsiRNA, vector pGenesil-1 and ScrambledsiRNA) using 8 μl transfection reagent. After 48 h of transfection, fluorescence of cells was observed by a fluorescence microscope. Then, cells were seeded for FCM and immunofluorescence assay. Supernatant was collected to test the inflammatory cytokines secreted by the cells.
Table 2
sequences of siRNA against TLR4
TLR4A | a a c t t g t a t t c a a g g t c t g g c | 1023-1044 |
TLR4B | a a g g c t t a c t t t c a c t t c c a a | 1374-1395 |
TLR4C | a a c t c c c t c c a g g t t c t t g a t | 1921-1942 |
MTT assay
Cells were seeded into 96-well culture plates (6×103/well, 5 wells repeated), allowed to adhere overnight, and then transfections were performed according to the manufacturer's instructions. After 48 h, the transfected cells were collected (0 h) or allowed to continue in culture for 24 h, 48 h, or 72 h. At the end of each treatment, cells were incubated with 5 mg/mL MTT (Sigma Chemical Co., MO, USA) for 4 h and then mixed with dimethyl sulfoxide after the supernatant was removed. The dye absorption (A) was quantitated using an automatic microplate spectrophotometer (340 st; Anthos Zenyth, Salzburg, Austria) at 490 nm.
Human inflammatory cytokine assay
IL-6 and IL-8 presence in the supernatant of transfected cells were detected according to the instruction of human inflammatory cytokine kit (BD™ Cytometric Bead Array (CBA)). FACScan flow cytometer (BD) was used to analyze samples.
Statistical Analysis
GraphPad Prism software (CA, USA) was used to perform statistical comparisons between different values. Data were expressed as the means ± standard deviation (SD) with n = 3. Statistical significances were determined by Student's t- test and ANOVA, differences were considered significant at a P value of less than 0.05.
Discussion
Recently, much attention has been paid to TLRs and their potential role in different cancers. However, investigations of TLRs and breast cancer are limited. Merrell.
et al. [
10] showed that TLR9 protein is expressed in human breast cancer cells and clinical breast cancer samples. Stimulation of TLR9-expressing breast cancer cells with the TLR9 agonistic CpG oligonucleotides dramatically increased their
in vitro invasion capacity in both Matrigel assays and three-dimensional collagen cultures. Ilvesaro.
et al. [
18] suggested that TLR9 expression was increased in breast cancer and that CpG oligonucleotide-induced cellular invasion was mediated via TLR9 and TRAF6, independent of MyD88. Xie.
et al. [
19] showed that TLR2 was highly expressed in MDA-MB-231 cells as compared with the MCF-7 breast cancer cell line, and concluded it played a critical role in the cell invasion properties of these cells.
From these studies, we know that TLR9 and TLR2 play a key role in breast cancer proliferation and metastasis. However, the conclusions from different studies are discordant. The growth, proliferation and metastasis of breast cancer are complex and dynamic processes and are likely to be associated with the actions (and interplay) of several TLRs. Not only TLR9 and TLR2, but also other TLRs are involved in the process of breast cancer development. We need to systematically explore the TLR expression profiles of breast cancer cells in order to investigate the relationship between TLRs and the growth, progression and survival of breast cancer cells.
We found that TLRs including TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and TLR10 were widely expressed in MDA-MB-231 at both the mRNA and protein levels. Real-time PCR analysis and flow cytometry detection showed that TLR4 was the highest expressed. However, the results of TLRs expression of MDA-MB-231 were different from the conclusions of Xie.
et al [
19].
People have reported that TLR4 is an important member of TLRs and has been shown to be present in tumors, such as ovarian cancer [
17], prostate cancer cell [
20] and colorectal cancer cell [
21,
22]. The activation of TLR4 expressed on tumor cells may promote tumor growth and resistant of apoptosis. Kelly.
et a1 [
17] found that activation of TLR4 signaling promotes the growth and chemoresistance of epithelial ovarian cancer cells. Blockage of TLR4 signaling has been shown to delay tumor growth and prolong the survival of animals [
23,
24]. In contrast, in a two-stage chemical carcinogenesis mouse model, in which inflammation mediated the promotion phase of lung cancer, the presence of a functional TLR4 was shown to inhibit lung carcinogenesis, suggesting a protective role of TLR4 in this model of cancer [
25]. Therefore, we firstly selected TLR4 to explore whether it was able to either promote or suppress the growth of human breast cancer cell line MDA-MB-231.
Because of the high expression of TLR4 in MDA-MB-231, we choosed RNAi to knockdown the expression of TLR4 to observe the biological character of silenced cells. Three specific pieces of siRNAs successfully decreased TLR4 gene expression and TLR4AsiRNA was the most efficient recombinant plasmid. Functional analysis in our study revealed that the abrogation of TLR4 expression inhibited growth and proliferation strongly. TLR4 played a positive role in the progression of breast cancer cells.
Previous studies have reported that when tumor cells are stimulated with lipopolysaccharides (LPS), the ligand for TLR4, the proinflammatory factors such as nitric oxide, IL-6 and IL-12 are expected to be released from tumor cells, attracting and activating inflammatory cells. Moreover, these factors are known to contribute to the resistance of tumor cells to cytotoxic T lymphocyte (CTL) and natural killer cell (NKC) attack and facilitate evasion from immune surveillance[
5]. In our study, TLR4 knockdown
in vitro lead to TLR4-related inflammatory cytokines being markedly depressed and so it could weaken the ability to the resistance of MDA-MB-231 to CTL and NKC attack and facilitate evasion from immune surveillance. This occurrence
in vitro may indicate us that TLR4 knockdown
in vivo could inhibit the growth and promote the death of breast tumors.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
HY participated in study design, carried out most of the experiments, and drafted the manuscript. HQZ participated in its design and coordination. PF participated in FCM analysis. XNZ assisted with cell culture. HYW carried out the molecular genetic studies. XFX carried out the Immunofluorescence analysis. HYS participated in statistical analysis. XMZ conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.