Background
The initiation of embryo implantation requires the differentiation of maternal endometrium into a special physiological state to accept embryo adhesion, which is called the receptive state [
1]. During the transition from a non-receptive state to a receptive state, the components of the endometrium, including the epithelium and stroma, undergo significant changes. As the first contact between the maternal and embryonic tissue, luminal epithelium is thought to play a key role in the establishment of receptivity [
2,
3]. Non-receptive endometrial epithelial cells (EECs) exhibit polarized characteristics of typical epithelial cells, with distinct apical and basolateral domains. Cells are tightly interconnected through multiple types of junctional complexes (such as tight junctions, adherens junctions, desmosomes) and form a two-dimensional sheet [
4]. Meanwhile, the apical surface of non-receptive EECs is covered with actin-containing microvilli and does not exhibit adhesive properties [
5]. These features of epithelial cells make the luminal epithelium a barrier for blastocyst adhesion and invasion. However, during the receptive phase, EECs experience a loss of polarity, and the cell-cell adhesion becomes weak. Moreover, the configuration of the cells transit from a columnar shape to a cuboidal shape, and microvilli on the surface retreat, which makes the apical membrane flat in favor of embryo attachment [
2,
6]. Accumulating evidence suggests that the remodeling of junctional complexes and the reorganization of actin cytoskeleton are key factors that regulate morphological changes in cells, and cytoskeletal regulators, such as Rho-family GTPases as well as their regulators contribute significantly in this process [
7,
8]. However, little is known about how these cytoskeleton regulators behave during epithelial transformation in establishing uterine receptivity.
The Rho family small GTPases serve as molecular switches that regulate multiple cellular functions, including various cytoskeleton-related events and gene transcription. The Rho GTPase-activating proteins (RhoGAPs) are one of the major classes of regulators of Rho GTPases found in all eukaryotes that are crucial in cell cytoskeletal organization, proliferation, differentiation, adhesion [
8,
9]. ARHGAP19 is a member of the RhoGAP family and participates in the regulation of epithelial morphogenesis [
10], whether it is involved in the epithelial transformation during the establishment of uterine receptivity remains unknown. In this study, we unraveled the expression pattern of ARHGAP19 in mouse uteri during early pregnancy and human EEC lines. Through manipulating ARHGAP19 expression in EECs, we showed that upregulating ARHGAP19 promotes the transition of EECs from a non-receptive phenotype to a receptive phenotype by regulating the remodeling of junctional complex and cytoskeletal structures. In addition, we also found that the expression of ARHGAP19 was regulated by miR-192-5p. These results suggest that ARHGAP19 may be involved in the establishment of endometrial receptivity by regulating epithelial morphology.
Methods
Animal treatments and ethical considerations
Healthy ICR mice were purchased from the Laboratory Animal Center of Zhejiang University (Hangzhou, Zhejiang, China) and housed in an environment with a controlled light cycle (12 h light/ 12 h darkness) and free access to food and water. Males (8 to 10-week old) and females (6 to 8-week old) were caged in the evening (6:00 p.m.) at a ratio of 1:1 to induce mating, and the morning of vaginal plug visualization was designated as day 1 of pregnancy (D1). Uteri from D1, D4, D5 were collected for RNA and protein evaluation. Implantation sites (IMS) on D5 were visualized by intravenous injection of 0.1 ml of 1% Chicago blue (Sigma, St Louis, MO, USA) [
11], and the uterine tissue between two implantation sites was designated as inter-implantation sites (IIS). On the designated day, mice were euthanized through cervical dislocation [
12] to collect uteri. For each experiment, uteri from three to five mice in the same group were set as biological replicates.
All protocols were approved by the Institutional Animal Care and Use Committee of Zhejiang University (ZJU20190151).
Cell culture and transfection
The human endometrial adenosquamous carcinoma cell line HEC-1-A, Ishikawa, and the human embryo kidney (HEK) 293 T cell line (HEK293T) were purchased from the Cell Bank of Chinese Academy of Science (Shanghai, China) and cultured in plastic flasks with 5% CO2 in air at 37 °C. HEC-1-A cells were seeded in McCoy’s 5A medium (Invitrogen, Carlsbad, CA, USA) and Ishikawa and HEK293T cells were seeded in DMEM medium (Invitrogen). All the medium used were supplied with 10% FBS, 100 U penicillin, and 100 µg streptomycin (Invitrogen). Transfection of ARHGAP19 cDNA (2 µg), miR-192-5p mimics (50 nM, GenePharma, Shanghai, China), or inhibitors (100 nM, GenePharma) was performed using Lipofectamine 2000 (Invitrogen). Cells were collected 48 h after transfection for further study.
In vivo injection of miRNA agomirs
Females on D3 of pregnancy (8:00 a.m.) were anesthetized and a surgery was performed to expose the uterus. 10 nmol/5 ul miR-192-5p agomir (GenePharma) was injected into one uterine horn, and the contralateral uterine horn was injected with an equal amount of scrambled control. Mice were sacrificed on D5 of pregnancy, and the uterine horns were collected separately for protein detection.
RNA extraction and RT-qPCR
Total RNA was extracted from the uteri and endometrial cells using TRIzol (Invitrogen) according to manufacturer’s instructions. The quantity of RNA was examined using a NanoDrop2000 instrument (Thermo Fisher Scientific, Waltham, MA, USA). For mRNA detection, total RNA (2 µg) cDNA was synthesized using a FastKing gDNA Dispelling RT SuperMix kit (TIANGEN BIOTECH, Beijing, China). Gene expression was assessed by qPCR with 2 µl of the synthetized cDNA using a Real Universal Color PreMix (SYBR Green) kit (TIANGEN BIOTECH). For miRNA detection, total RNA (1 µg) was used to synthesize cDNA using a miRcute Plus miRNA First-Strand cDNA kit (TIANGEN BIOTECH) and miR-192-5p was qualified by qPCR using miRcute Plus miRNA qPCR (SYBR Green) kit (TIANGEN BIOTECH). The qPCR reactions were performed on a StepOnePlus™ Real-Time PCR System (Applied Biosystems Inc., Foster City, CA, USA). GAPDH/U6 were set as the normalizing control. Relative quantities were calculated using the 2
−△△CT method. The sequences of all primers used are listed in Table
1.
Table 1
Primer sequences for RT-qPCR
U6 | NR_004394.1 | TTCGTGAAGCGTTCCATATTTT |
miR-192-5p | NR_029720.1 | CUGACCUAUGAAUUGACAGCC |
GAPDH | NM_001256799 | F: CTGGGCTACACTGAGCACC |
R: AAGTGGTCGTTGAGGGCAATG |
Gapdh | NM_008084 | F: AGGTCGGTGTGAACGGATTTG |
R: TGTAGACCATGTAGTTGAGGTCA |
ARHGAP19 | NM_032900 | F: TGTGATCTGCAATGATTCTTCCC |
R: TTGCTGACCACCAACTCAGTG |
Arhgap19 | NM_001163495 | F: CACAAGGCTTATTGATTTGCCG |
R: TTTCTTTCCGCTTGAGAGACATT |
VIL1 | NM_007127 | F:GGCAAGAGGAACGTGGTAGC |
R:CGGTCCATTCCACTGGATGA |
Western blot analysis
Protein lysates were derived from tissues and cultured cells using RIPA buffer supplemented with 1 mM phenylmethylsulfonyl fluoride (Beyotime Biotechnology, Shanghai, China). The protein concentrations were detected using an Enhanced BCA Protein Assay Kit (Beyotime Biotechnology). The lysates were subjected to 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to PVDF membranes (MilliporeSigma, Burlington, MA, USA). The membranes were then blocked in 5% non-fat milk powder in PBS-Tween and incubated with primary antibodies against ARHGAP19 (1:500, sc-398428, Santa Cruz Biotechnology, Santa Cruz, CA, USA), E-cadherin (1:2000, A3044, ABclonal Technology, Wuhan, China) overnight at 4 °C. After washing with PBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5000, ABclonal Technology) for 2 h at 37 °C and visualized by chemiluminescent detection using an ECL kit (Beyotime Biotechnology).
Immunofluorescence
Cells were fixed with 4% paraformaldehyde for 30 min and then permeabilized with 0.3% Triton X -100 (Beyotime Biotechnology) in PBS. After blocking with 4% BSA for 1 h at room temperature, samples were incubated with primary antibody against E-cadherin (1:100, A3044, ABclonal Technology) or OCLN (1:100, Santa Cruz Biotechnology) overnight at 4 °C. An Alexa Fluor® 594-conjugated Goat polyclonal was used as the secondary antibody (1:500, ABclonal Technology). Nuclear staining was performed with DAPI (Beyotime Biotechnology) after which the cells were imaged using a Zeiss LSM780 confocal microscope system (Zeiss).
Scanning electron microscopy (SEM)
HEC-1-A cells were fixed in 2.5% glutaraldehyde and post-fixed in 1% osmium tetroxide. After washing the samples with PBS, they were dehydrated with a series of incubations in ethanol. Dehydration was continued by incubations in 95% ethanol, followed by absolute ethanol. SEM analysis of the cell surface was performed using an ultra-high-resolution scanning electron microscope (SU8010, Hitachi, Japan) at the Analysis Center of Agrobiology and Environmental Sciences, Zhejiang University (China).
Dual-luciferase activity assay
A total of 6 × 104 HEK293T cells were seeded in 24-well dishes 24 h before transfection. 500 ng pmirGLO vectors containing wild-type or mutant fragment of Arhgap19 3’UTR (Promega, Madison, WI, USA), 50 nM miR-192-5p or scrambled control were co-transfected using Lipofectamine 2000 (Invitrogen). Luciferase activities of cellular extracts were measured 48 h after transfection by using a Dual-Luciferase Reporter Assay System (Promega). Efficiency of transfection was normalized using Renilla luciferase activity. Details for cloning target 3’UTR are as follows: a 589 bp fragment from mouse Arhgap19 3’UTR was amplified with 5’ primer 5’- GAGCATGGAGGTGTGTGATCT-3’ and 3’ primer 5’- GTCTATTCTGCACTGGATCACAG-3’. Mutated constructs were synthesized with the predicted miR-192-5p binding sites modified (wild-type: 5′ TAGGTCA 3′; mutant 5′ GCTTTCA 3′).
Statistics
All experiments were presented as means ± SDs. Statistical differences between the two groups was analyzed using the two-tailed unpaired Student’s t-test. Comparison among multiple groups was conducted using One-way analysis of variance (ANOVA) followed by Dunnett’s test. Statistical significance was defined as P < 0.05.
Discussion
In preparation for embryo implantation, the endometrial epithelium undergoes remarkable configuration changes, with morphological and functional alterations occurring in the plasma membrane both apically and basolaterally. These changes ultimately led to reduced cell polarity and enhanced apical adhesiveness, facilitating embryo adhesion and invasion [
2]. Remodeling of junctional complexes and reorganization of the cytoskeleton play fundamental roles in regulating cell morphogenesis; however, surprisingly, little research has been done on the role of cytoskeletal regulators during the epithelial transformation in early pregnancy. In this study, we unravel the role of a cytoskeleton-associated protein ARHGAP19 in manipulating the morphological transformation of EECs in establishing receptivity.
ARHGAP19 belongs to the RhoGAP family, which promotes the GTPase activity for intrinsic GTP hydrolysis, thus inactivated Rho protein activity [
9]. At present, functional studies on ARHGAP19 are quite limited, but based on its expression pattern, that is, highly expressed in fetal tissues and some specific cell types (such as hematopoietic cells), it is speculated that ARHGAP19 may be involved in the regulation of developmental process [
25,
26]. Although being less-well characterized, current studies involving ARHGAP19 all suggest that it participates in the regulation of cytoskeleton-mediated morphological changes in cells. For example, ARHGAP19 has been shown to modulate cell elongation and cytokinesis in early mitosis of lymphocytes through regulating RhoA/ROCK signaling [
26]. In another study, loss-of-function of ARHGAP19 in epidermal cells was reported to induce actin cytoskeleton reorganization, alter cell polarity, and stimulate adherens junction formation [
10]. In the present study, we explored the regulatory role of ARHGAP19 in endometrial epithelial morphology. Despite a relatively low expression of ARHGAP19 in EECs, its expression in receptive and non-receptive cells showed a significant difference. By altering the level of ARHGAP19 in EECs, we found that upregulation of its expression was able to induce the non-receptive cells to acquire a partial receptive phenotype.
The most significant change at the lateral membrane of EECs in establishing receptivity is the remodeling of junction complexes [
2]. E-cadherin is a Ca
2+-dependent cell adhesion molecule expressed in the epithelial cells and plays a critical role in maintaining epithelial integrity and polarity [
4]. Downregulation of E-cadherin in EECs allows the adhesion and penetration of trophoblast cells, thus is critical for implantation initiation [
27,
28]. Consistent with the previous study [
10], we showed that ARHGAP19 induced the remodeling of adherens junction protein through repressing E-cadherin expression. Moreover, we found that ARHGAP19 overexpression led to an atypical distribution of E-cadherin in polarized EECs, i.e., randomly distributed to the whole plasma membrane domains instead of restricted to the lateral domains. The redistribution of E-cadherin may result from an altered interaction with the catenins (i.e. β-catenin and α-catenin) and actin filaments, these alterations subsequently change cell-cell adhesion [
29]. Thie et al. reported a random distribution of E-cadherin in another receptive human EEC line RL95-2. These cells usually lack the polarized structure of a typical epithelial cell and exhibit a strong tendency to pile up [
15,
18]. Interestingly, in our study, we also observed a piling-up tendency of HEC-1-A cells after ARHGAP19 overexpression, which we speculated might be related to the redistribution of E-cadherin. Besides alterations in adherens junction protein, ARHGAP19 overexpression also reduced the expression of tight junction component Occludin at the cell–cell interface. These results further strengthened the fact that ARHGAP19 induced junctional remodeling that possibly leading to the loss of epithelial polarity.
During the receptive phase, the apical membrane of EECs undergoes remarkable morphological alterations involving the retreat of actin-containing microvilli and the removal of terminal web [
21]. These phenomena are found in several species during early pregnancy and are considered as the prerequisite for embryo attachment [
2]. In the present study, we found that upregulation of ARHGAP19 was able to cause a decrease in microvilli and resulted in downregulation of the expression of the gene encoding Villin, a calcium-regulated actin-binding protein that modulates the structure and assembly of actin filaments and plays a key role in the morphogenesis of microvilli [
22,
30]. These results indicated that ARHGAP19 induces membrane- associated cytoskeletal reorganization, prompting changes in membrane morphology and allowing cells to acquire a receptive-associated phenotype.
In this study, we also found that ARHGAP19 was regulated by miR-192-5p. MiR-192 is located on chromosome 19 in mice and on chromosome 11 in humans. The mature miR-192-5p sequence is identical in mice and humans. Studies on different tissues indicate that miR-192-5p is enriched in the epithelium, and participates in determining or maintaining cell-type-specific characteristics, including epithelial differentiation and ion transportation [
31‐
33]. Our previous study [
24] showed that miR-192-5p was significantly down-regulated during the receptive and implantation phase, contrary to the trend of ARHGAP19 expression. Inhibiting miR-192-5p function in HEC-1-A cells suppress E-cadherin expression at cell-cell interface and reduced apical microvilli formation, all of which are similar to overexpression of Arhgap19. This study confirms that ARHGAP19 is a target gene of miR-192-5p. We speculate that the endometrium may release ARHGAP19 expression by downregulating miR-192-5p during early pregnancy, which in turn promotes epithelial morphological transformation.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.