Regulation of the adaptation to ER stress by KLF4 facilitates melanoma cell metastasis via upregulating NUCB2 expression

Human melanoma cell lines Me1007, Mel-RM, A375, Mel-CV, and SK-Mel-28 were obtained as previously described [21]. Studies on a panel of melanoma cell lines revealed that ER stress did not induced significantly apoptosis in Mel-RM, A375, Mel-CV, SK-Mel-28 but Me1007. Me1007 was reported to be a ER stress non-resistant melanoma cell line [22]. These cells were cultured in DMEM containing 10% FBS (ExCell Bio, Lot: FSP500) and 0.1% Savelt™ (Hanbio Co. LTD., 1:1000). The following antibodies were used in this study: antibodies against GAPDH (Santa Cruz Biotechnology, Dallas, TX, USA; SC-25778, 1:1000); PARP (Santa Cruz Biotechnology, SC-8007, 1:1000); KLF4 (Santa Cruz Biotechnology, SC-20691, 1:10 for ChIP); KLF4 (Cell Signaling Technology, #12173S, 1:500); NUCB2 (Abcam, ab229683, 1:300); KLF8 (Abcam, ab168527, 1:300); KLF5 (Proteintech, 21,017–1-AP 1:500); KLF6 (Proteintech, 14,716–1-AP 1:500); GRP78 (Santa Cruz Biotechnology, SC-13968,1:1000). Tunicamycin (TM, Lot:T7765) and thapsigargin (TG, Lot:T9033) were purchased from Sigma Chemical Co. They was dissolved in DMSO and made up in stock solutions of 3 mmol/L for tunicamycin and 1 mmol/L for thapsigargin. The cells were treated with 3 μmol/L TM or 1 μmol/L TG as the indicated times.

KLF4 and NUCB2 were constructed into pCDNA3.0-Flag vector. The lentiviral expression vector for KLF4 was constructed by inserting full-length cDNA into a pCDH vector. 5 μg plasmids were transfected into melanoma cells(1 × 10⁶) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the Lipofectamine™ 3000 Reagent Protocol; The empty vectors were used as the negative control. To generate lentivirus expressing KLF4, HEK 293 T cells grown on a 6 cm dish were transfected with 2 μg pCDH-KLF4 or control vector (pCDH), 1.5 μg psPax2, and 0.5 μg pMD2G. Twenty-four hour after the transfection, cells were cultured with DMEM containing 10% FBS for an additional 24 h. The culture medium containing lentiviral particles was centrifuged at 1000 g for 5 min. Viral particles collected in the supernatant were used for infection. In order to establish the stable cell line, the puromycin was used as a selection marker for the infected cells. The expression efficiency was evaluated by western blot analysis.

RNA interference was performed as previously described [20, 23]. The sequences targeting NUCB2–1 were: 5- CCACAGATTTAGATATGCTAA-3 and NUCB2–2 5-GCGTGAATATCATCAGGTCAT-3. KLF4–1, 5-ATCGGTCATCAGCGTCAGCAA-3. KLF4–2 5-AAGTCATCTTGTGAGTGGATAA-3.

KLF4 knockout was achieved by CRISPR/Cas9. sgRNA design and cloning were performed according to the Feng Zhang lab general cloning protocols. KLF4 sgRNAs oligos were designed based on the target site sequence (20 bp) and were flanked on the 3′ end by a 3 bp NGG PAM sequence. Using the Cas9 target design tools (http://​www.​genome-engineering.​org), we designed two sgRNAs for each target: KLF4 sg1 UP:5-CACCCGCCGGGCCAGACGCGAACG-3. DN:5-AAACCGTTCGCGTCTGGCCCGGCG-3; Sg2 UP:5-CACCGTCTTTCTCCACGTTCGCGTC-3 DN:5-AAACGACGCGAACGTGGAGAAAGAC-3. The sgRNAs were cloned into the lentiCRISPRv2 vector (Addgene). For lentivirus production, cloned lentiCRISPRv2 plasmids were co-transfected into HEK293T cells with the packaging plasmids pVSVg (AddGene 8454) and psPAX2 (AddGene 12,260). The lentivirus was harvested, and Mel-RM cells were infected with two sgRNA mixtures for KLF4. Forty-eight hours after infection, the cells were placed under puromycin selection for 2 weeks, and the single-cell-derived clones were picked, expanded and knockout of KLF4 was verified by western blot analysis.

Melanoma tissue microarrays were purchased from Alenabio (Xi’an, China), and they contained a total of 30 melanoma tissues and normal tissues. The immunohistochemistry was performed as previously described [24]. The characteristics of the patients and their tumours were collected through the review of medical records and pathologic reports. Informed consent with approval of the ethics committee of Taizhou Hospital of Zhejiang Province was obtained. All of the methods in this study were in accordance with the approved guidelines, and all of the experimental protocols were approved by the ethics committee of Taizhou Hospital of Zhejiang Province.

Sections were stained with Masson’s trichrome and H&E (haematoxylin and eosin) for histopathological examination. For immunohistochemistry, sections were subjected to antigen retrieval using microwave heating at 95 °C in citrate buffer (pH = 6.0, for KLF4 and NUCB2). The indicated antibodies specific for KLF4 (1:200) and NUCB2 (1:100) were diluted according to the manufacturer’s instructions. The degrees of immunostaining were reviewed and scored by two independent observers. The proportion of the stained cells and the extent of the staining were used as criteria of evaluation. For each case, at least 1000 tumor cells were analyzed. For each sample, the proportion of KLF4 and NUCB2-expressing cells varied from 0 to 100%, and the intensity of staining varied from weak to strong. One score was given according to the percentage of positive cells as:< 5% of the cells:1 point; 6–35% of the cells:2 point; 36–70% of the cells:3 point; > 70% of the cells: 4 point. Another score was given according to the intensity of staining as: negative staining: 1 point; weak staining (light yellow): 2 point; moderate staining (yellowish brown): 3 point; and strong staining (brown): 4 point. A final score was then calculated by multiple the above two scores. If the final score was equal or bigger than four, the protein expression in the tumor was considered high; otherwise, the protein expression in the tumor was considered low. The clinical information of patients with melanoma was provided in the Additional file 1.

The ChIP assay was performed as previously described [25].

Quantitative real-time polymerase chain reaction assay (q-RT-PCR) Total RNA was isolated using Trizol (Invitrogen). One microgram of total RNA was used to synthesize cDNA using the PrimeScript™ RT reagent kit (Takara, RR047A) according to the manufacturer’s instructions. The primers were as follows: NUCB2 up: 5- CCTGTGGAAAGTGCGAAGATAG -3, dn: 5- GCCTCCCACTCTTTATTTCCTC -3; and ACTIN up: 5-GACCTGACTGACTACCTCATGAAGAT-3, dn: 5-GTCACACTTCATGATGGAGTTGAAGG-3. KLF4 up: 5- ACCTACACAAAGAGTTCCCATC-3; dn: 5-TGTGTTTACGGTAGTGCCTG-3. KLF5 up: 5- GAAGGAGTAACCCCGATTTGG-3; dn:5- CTTCCCAGGTACACTTGTATGG-3; KLF6 up:5- CTTTAACGGCTGCAGGAAAG-3, dn 5- GGAAGTGCCTGGTTAACTCATC-3; KLF8 up: 5- CTCACCGCAGAATCCATACAG-3, dn 5- GCACCGAAAAGGCTTGATG-3.

The promoter of NUCB2 and the matching mutant were constructed into the pGL3-basic vector. The luciferase activity was measured in a 1.5-ml Eppendorf tube with a Promega Dual-Luciferases Reporter Assay kit (Promega E1980) according to the manufacturer’s protocols after transfection. Relative Renilla luciferase activity was normalized to firefly luciferase activity. The assay was performed as previously described [26, 27].

The cell migration assay was performed in a 24-well transwell plate with 8-mm polyethylene terephthalate membrane filters (Corning) separating the lower and upper culture chambers. In brief, melanoma cells were treated as indicated and plated in the upper chamber at 1 × 10³ cells per well in serum-free DMEM medium. The bottom chamber contained DMEM with 10% FBS. Cells were allowed to migrate for 24 h in a humidified chamber at 37 °C with 5% CO2. After the incubation period, the filter was removed and non-migrant cells on the upper side of the filter were detached using a cotton swab. Filters were fixed with 4% formaldehyde for 15 min, and cells located in the lower filter were stained with 0.1% crystal violet for 20 min and photographed.

Cells were counted in four randomly selected fields. Cell counts are expressed as the average number of cells per field of view. Three independent experiments were performed.

Animal studies were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals with the approval of the Animal Research Committee of Dalian Medical University. Male nude mice (4–6 weeks of age, 18–20 g) were obtained from the SPF Laboratory Animal Center of Dalian Medical University (Dalian, China) and were randomly divided into indicated groups. The mice (n = 6) in the groups were subcutaneously injected with the indicated cells or the injection was administered through the lateral tail vein. After 12 days, the tumour size was measured every 3 days by Vernier callipers and converted to TV according to the following formula: TV (mm³) = (axb²)/2, where a and b are the largest and smallest diameters, respectively. All animals were killed 4 weeks after injection, and the transplanted tumours were removed, weighed and fixed for further study. The weight of the lung and metastatic nodules were measured in the mice that were injected through the lateral tail vein. Lung was fixed with 4% formalin, and embedded in paraffin blocks. Sections of lung were stained with hematoxylin and eosin and photographed. The metastatic nodules were counted.

Caspase-3 activity was analysed using the Caspase-3 Activity Assay Kit (Roche) according to the manufacturer’s instructions. Briefly, the cell or tissue lysate was incubated with 100 μL of caspase-3 reagent at 37 °C for 1–2 h, and then the fluorescence intensity (at 370–425 nm excitation and 490–530 nm emission wavelengths) was measured using a Spectra MAX M5 spectrophotometer (Molecular Devices).

The cells were plated in 96-well plates at a density of 1000 cells in 200 μl of medium per well 24 h before the experiment. The cells were treated with TM as indicated in the figures, and the cell viability was determined using the CCK-8 kit (Cell Counting Kit-8).

To investigate the relationship between adaptation to ER stress and cell metastasis, we first compared the migratory capabilities of ER stress-sensitive melanoma cell Me1007 and ER stress-resistant melanoma cells Mel-CV, SK-Mel-28, A375 and Mel-RM. The ER stress-resistance phenotype of these melanoma cells was confirmed by the results of the CCK-8 assay (Additional file 2: Figure S1). We found that ER stress-resistant cells possessed a higher migratory capability than the ER stress-sensitive melanoma cell Me1007 (Fig. 1a and b). Subsequently, Me1007, Mel-RM, and A375 cells were treated with 3 μM tunicamycin (TM), which induced ER stress via the inhibition of glycosylation. The migratory abilities were examined using a transwell assay. As shown in Fig. 1c and d, ER stress enhanced the cell migration in resistant cells; however, migration was inhibited in Me1007 cells indicating that the adaptation to ER stress favoured cell migration in melanoma cells. To further confirm this finding, GFP-labelled Mel-RM, A375 and Me1007 cells (5 × 10⁴) were intravenously injected into nude mice who were subjected to bioluminescent imaging at 4 weeks after injection. The ER stress-resistant cells, Mel-RM and A375, exhibited a significant increase in lung metastatic abilities at approximately 4 weeks (Fig. 1e). Consistently, histological analyses indicated a remarkable increase in the number of metastatic lesions produced by Mel-RM and A375 cells compared with that produced by Me1007 cells (Fig. 1f-h).

To illuminate the mechanism underlying the regulation of ER stress resistance and cell metastasis, Mel-RM cells were treated with 3 μM TM for the indicated times, and then mRNA expression profiles were obtained by mRNA microarray analysis. The results revealed that more than 2100 upregulated and 2500 downregulated genes (FC > 2) were obtained in Mel-RM cells that were treated with 3 μM TM compared with that of control cells (Fig. 2a and c and Additional file 3: Table S1). Among the altered genes, we found that the KLF family genes KLF4, KLF5, KLF6 and KLF8 were changed in response to ER stress, and KLF4 was markedly upregulated under ER stress (Fig. 2b and d), which was confirmed by q-RT-PCR and western blot (Fig. 2e and f). To determine which gene may be involved in regulating ER stress resistance and cell metastasis, the expression levels of these genes were analysed in the ER stress non-resistant cell line Me1007 after 3 μM TM treatment. We found that compared with ER stress-resistant cells, the induction of KLF4 by ER stress disappeared in Me1007 cells, and the basic expression level of KLF4 was downregulated in Me1007 cells (Fig. 2g-i). However, the alteration of KLF5, KLF6 and KLF8 by ER stress were similar with the ER stress resistant cells. To further confirm this finding, the expression levels of KLF4 were first assessed in A375 and SK-Mel 28 cells using q-RT-PCR and western blot. Consistently, the protein and mRNA levels of KLF4 were elevated under 3 μM TM treatment (Fig. 2j-m). Then, we used 1 μM thapsigargin (TG), a Ca²⁺-ATPase inhibitor, to induce ER stress and the protein and mRNA levels of KLF4 were analysed using western blot and q-RT-PCR. Similar with 3 μM TM treatment, KLF4 was significantly increased in response to ER stress induced by 1 μM TG (Additional file 4: Figure S2a and b). Thus, these data implied that KLF4 was a ER stress-induced gene and may contribute ER stress resistance of melanoma.

Given that KLF4 enhanced melanoma adaptation to ER stress, we first knocked down KLF4,KLF5 and KLF8 expression using shRNAs in Mel-RM and A375 cells. Then, these cells were treated with 3 μM TM, and cell apoptosis was determined using western blot and the CCK-8 assay. As shown in Fig. 3a-d and Additional file 5: Figure S3a-b, the inhibition of KLF4 not KLF5 and KLF8 enhanced cell apoptosis and reduced cell viability. In subsequent transwell assays, the migratory capabilities of Mel-RM and A375 cells with KLF4 knockdown were apparently decreased in response to ER stress (Fig. 3e and f). To further verify this finding, we then overexpressed KLF4 in Me1007 cells. Consistent with data from the knockdown studies, Me1007 cells overexpressing KLF4 decreased cell apoptosis and enhanced cell migratory abilities under ER stress (Fig. 3g-j). Taken together, these data suggest that KLF4 plays an important role in regulating melanoma resistance to ER stress and facilitating cell metastasis.

To uncover the molecular mechanism underlying the regulation of ER stress resistance by KLF4, we generated KLF4 knockout (KO) Mel-RM cells using CRISPR/Cas9 technology. Gene expression profiles in KLF4 WT and KO Mel-RM cells with or without 3 μM TM treatment were obtained using RNA sequencing analysis (Fig. 4a). Among the altered genes, we found that KLF4 KO significantly suppressed NUCB2 upregulation under ER stress, and the decrease was recovered by KLF4 overexpression (Fig. 4b-e). VEGF was used as a positive control, which was indicated to be a transcriptional gene of KLF4 [28] (Additional file 6: Figure S4a). Subsequently, the expression level of NUCB2 was analysed in Me1007 cells with or without KLF4 overexpression under 3 μM TM treatment. We found that NUCB2 was not induced by ER stress in Me1007 cells; however, in KLF4-overexpressing cells, the expression level of NUCB2 was increased, indicating that NUCB2 was mediated by KLF4 (Fig. 4f and g). To further confirm it, the expression level of NUCB2 was detected using q-RT-PCR and western blot in Mel-RM and A375 cells with or without KLF4 or KLF5 or KLF8 knockdown. Consistently, KLF4 not KLF5 and KLF8 knockdown suppressed the NUCB2 increase by ER stress (Fig. 4h-k and Additional file 6: Figure S4b-e). Collectively, these data validate that KLF4 upregulated NUCB2 expression in response to ER stress.

To identify the KLF4 binding regions on the NUCB2 promoter, we first cloned the upstream sequence of NUCB2 and different truncations by PCR. Then, we inserted them into the pGL3-based luciferase reporter plasmids that were named P1-P3 (Fig. 5a). We subsequently transfected them into Mel-RM cells with or without 3 μM TM treatment. As shown in Fig. 5b, the luciferase activities of P1 and P3 were increased in Mel-RM cells under ER stress treatment; however, the increase was abolished when P2 was transfected, indicating that the region (− 1000 to 0 bp) was a key region for the promotion of NUCB2 under ER stress. To further verify whether the region was essential for KLF4, the truncation P3 was transfected into Mel-RM cells with or without KLF4 knockout. We found that the loss of KLF4 abolished the increase of the luciferase activity of P3 by ER stress (Fig. 5c). Similar results were gained in Mel-RM and A375 cells with or without KLF4 knockdown (Fig. 5d-e).

KLF4 is a zinc finger-type transcription factor that usually binds to the GC-rich element of the promoters [29]. To seek the potential KLF4 binding sites, we inspected the sequence of P3 using JASPAR software and found two putative KLF4-binding sites on the NUCB2 promoter. To verify that these potential KLF4-binding sites are indeed responsive to KLF4, a series of pGL3-based luciferase reporter plasmids named BS1, BS1M, BS2 and BS2M were generated (Fig. 5f). These plasmids were individually transfected into Mel-RM cells with or without 3 μM TM treatment. As shown in Fig. 5g and h, the luciferase activity of BS1, but not BS1M, BS2, and BS2M, was significantly increase in KLF4 WT Mel-RM cells under ER stress, and the increase disappeared when KLF4 was knocked out, indicating that the first binding site was a positive KLF4 binding site on the NUCB2 promoter. In addition, the subsequent chromatin immunoprecipitation (ChIP) assays showed that the chromatin fragments, corresponding to the putative KLF4-binding sites, were specifically present in anti-KLF4 immunoprecipitates from Mel-RM cells, and the bond was increased under ER stress, which was diminished by KLF4 knockout (Fig. 5i-j).

To determine whether the promotion of KLF4 on the adaptation to ER stress and cell metastasis was dependent on NUCB2, we first knocked down NUCB2 in Mel-RM cells, and then the cells were treated with 3 μM TM. Compared with the control cells, deficiency in NUCB2 promoted ER stress-induced apoptosis and decreased cell migration, which was consistent with the role of KLF4 in melanoma cells (Fig. 6a-b). Whereafter, we overexpressed NUCB2 into KLF4 KO Mel-RM cells and found that the effects of KLF4 depletion on melanoma adaptation to ER stress and metastasis were reversed by NUCB2 overexpression (Fig. 6e-g).

To further identify the effects of KLF4 on the adaptation to ER stress and cell metastasis by regulating NUCB2 in vivo, NUCB2 was overexpressed into KLF4 KO Mel-RM cells, and the expression levels of KLF4 and NUCB2 were detected using western blot (Additional file 7: Figure S5). First, the cells were subcutaneously injected into nude mice. Compared with control cells, the loss of KLF4 decreased tumour growth and increased cell apoptosis; however, the phenotypes were reversed by NUCB2 overexpression (Fig. 6h-l). The cells were then injected intravenously into the nude mice, and the migratory abilities of these cells were assessed in vivo. As shown in Fig. 6m-o, the deficiency of KLF4 decreased lung metastatic abilities of melanoma cells, which was reversed by NUCB2 overexpression. Taken together, these data indicate that the effects of KLF4 on melanoma adaptation to ER stress and metastasis were dependent on NUCB2.

To further confirm the biological importance of the KLF4-NUCB2 axis in melanoma, the protein levels of KLF4 and NUCB2 in melanoma tissues and normal tissues were analysed using immunohistochemical staining (Fig. 7a). We found that the relative expression levels of KLF4 and NUCB2 were significantly increased in melanoma tissues, and the protein level of KLF4 was positively correlated with NUCB2 in melanoma tissues (Fig. 7b-d).