Background
In recent years, a new class of naturally occurring, small, non-coding RNAs called microRNAs (miRNAs) have been discovered in plants and animals [
1‐
3]. Unlike protein-coding mRNAs, miRNAs are first transcribed as long primary transcripts in the nucleus, and then cleaved to produce stem-loop-structured precursor molecules (pre-miRNAs) by Drosha [
4]. Pre-miRNAs are then exported to the cytoplasm, where the RNase III enzyme Dicer further processes them into mature miRNAs (~22 nucleotides). Mature miRNAs negatively regulate gene expression at the post-transcriptional level. Through specific targeting of the 3'-untranslationed regions (3'UTR) of multicellular eukaryotic mRNAs, miRNAs downregulate gene expression by degrading target mRNAs or repressing their translation [
5,
6]. Since miRNAs bind the 3'UTR of target genes through partial sequence homology, miRNAs could control as much as 30% of all protein-coding genes [
7].
An accumulating body of evidence has revealed critical functions for miRNAs in diverse biological processes, such as proliferation, apoptosis, and cell differentiation [
8,
9]. Thus, deregulation of miRNA expression may lead to a variety of disorders including many types of cancers [
10]. Previous studies have identified cancer-specific miRNAs in many kinds of cancers, including ovarian cancer [
11], lung cancer [
12], breast cancer [
13], hepatocellular carcinoma [
14], and brain cancer [
15,
16]. In addition, miRNA genes are frequently located near genomic breakpoints [
16] or are affected by copy number alterations [
17]. Also, factors involved in miRNA biosynthesis may be dysregulated in human tumors [
18,
19]. Furthermore, a recent study described aberrant hypermethylation as a mechanism for miRNA genes including miR-9 inactivation and downexpression in human breast cancer [
20]. Meanwhile, another study provided evidence that miR-9 acts as a tumor suppressor gene in recurrent ovarian cancer [
21].
Gastric cancer is the second most common cause of cancer death in the world [
22], and adenocarcinoma is the most common type of gastric cancer. In this study, we detected differential expression of miR-9 in human gastric adenocarcinoma and adjacent normal tissues through quantitative RT-PCR, and hypothesized miR-9 as a tumor suppressor. Consistent with this hypothesis, we observed that overexpression of miR-9 inhibited the growth of the gastric adenocarcinoma cell line MGC803
in vitro and
in vivo. Subsequently, we predicted and confirmed that the tumor-related transcription factor NF-κB1 was a direct target of miR-9 and was negatively regulated by miR-9 at the post-transcriptional level. Finally, in MGC803 cells, suppression of NF-κB1 expression by specific small interfering RNA (siRNA) could also inhibit MGC803 cell growth, while ectopic expression of NF-κB1 could rescue MGC803 cell from growth inhibition caused by miR-9.
Methods
Clinical Specimen and RNA Isolation
Nine pairs of gastric samples, including nine human gastric adenocarcinoma tissue samples and nine matched normal gastric tissue samples, were obtained from the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and the National Foundation of Cancer Research (TBF of TMUCIH & NFCR) with patients' informed consent. The category of gastric samples was confirmed by pathological analysis. The large RNA and small RNA of tissue samples were isolated using mir Vana™ miRNA Isolation Kit (Ambion) according to the manufacturer's instructions.
Cell Culture and Transfection
The human gastric adenocarcinoma cell line MGC803 was grown in RPMI 1640 (GIBCO) supplemented with 10% fetal bovine serum, 100 IU/ml of penicillin and 100 μg/ml of streptomycin, incubated at 37°C in a humidified chamber supplemented with 5% CO2. Transfection was performed with Lipofectamine 2000 Reagent (Invitrogen) following the manufacturer's protocol. Spiked RFP-expressing vector was used to monitor transfection efficiency.
Construction of Expression Vectors
To construct the pcDNA3/pri-miR-9 (pri-miR-9) expressing vector, we first amplified a 386-bp DNA fragment carrying pri-miR-9 from genomic DNA using the following PCR primers: miR-9-sense, 5'-CGGAGATCT TTTCTCTCTTCACCCTC-3', and miR-9-antisense, 5'-CAAGAATTC GCCCGAACCAGTGAG-3'. The amplified fragment was cloned into the pcDNA3.1 (+) at the BglII and EcoRI sites.
To construct the pSilencer/si-NF-κB1 (si-NF-κB1) vector, a 70-bp double-strand fragment was obtained via annealing reaction using two single-strands designed by Deqor (at
http://cluster-1.mpi-cbg.de/Deqor/deqor.html): NF-κB1-Top, 5'-GATCCCGCCTGAACAAATGTTTCATTTGGTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTTTTGGAAA -3'; and NF-κB1-Bot, 5'-AGCTTTTCCAAAAAAGCCTGAACAAATGTTTCATTTGGCTCTTGACCAAATGAAACATTTGTTCAGGCGG -3'. The fragment was then cloned into pSilencer 2.1 at the BamHI and Hind III sites.
To construct the NF-κB1 ectopic expression vector, the whole coding sequence of NF-κB1 without the 3'UTR was amplified by PCR from cDNA library of MGC803 cells. The PCR primers were as follows: NF-κB1-sense, 5'-CGGAATTC ACCATGGCAGAAGATGATCC -3'; and NF-κB1-antisense, 5'-GTCAGCTCGAG AAATTTTGCCTTCTAGAGGTC -3'. The amplified fragment was cloned into the pcDNA3.1 (+) at the EcoRI and XhoI sites.
Cell Proliferation Assay
Cells were seeded in 96-well plate at 4 000 cells per well the day before transfection. The cells were transfected with pri-miR-9 or control vector at a final concentration of 5 ng/μl as described above. To detect the dose-dependent effects, we gradually increased concentration of pri-miR-9 from 0 ng/μl to 15 ng/μl. To examine the time-dependent effects of si-NF-κB1 on MGC803 cells, MTT assay was used to measure the viable, proliferating cells at 24, 48, and 72 h after transfection. The absorbance at 570 nm was measured using a μQuant Universal Microplate Spectrophotometer (Bio-tek Instruments).
After transfection, cells were counted and seeded in 12-well plates (in triplicate) at 100 cells per well. Fresh culture medium was replaced every 3 days. Colonies were counted only if they contained more than 50 cells, and the number of colonies was counted from the 6th day after seeding and then the cells were stained using crystal violet. The rate of colony formation was calculated with the equation: colony formation rate = (number of colonies/number of seeded cells) ×100%.
In vivo Tumor Xenograft Studies
To establish the stable miR-9-overexpression cell line and the control cell line, MGC803 cells were transfected with pcDNA3/pri-miR-9 (pri-miR-9) or pcDNA3 (control), followed by selection for 20-30 days in complete medium supplemented with 800 μg/ml of G418 (Invitrogen). Single colonies were picked and amplified, and the expression level of miR-9 was detected by real-time RT-PCR. The stable miR-9-overexpression MGC803 cells or control cells were inoculated with 4 × 106 cells per site bilaterally on the axillary fossae of female athymic nude mice aged 6-8 weeks. Tumor size was monitored by measuring the length and width with calipers, and volumes were calculated with the formula: (L × W 2) × 0.5, where L is the length and W is the width of each tumor. The mice used in this experiment were maintained under specific pathogen-free conditions and handled in accordance with NIH Animal Care and Use Committee regulations.
MiRNA Target Prediction
MiRNA predicted targets were predicted using the algorithms TargetScan, PicTar, and miRBase Targets. To identify the genes commonly predicted by the three different algorithms, results of predicted targets were intersected using MatchMiner.
Fluorescent Reporter Assay
The EGFP expression vector pcDNA3/EGFP was constructed as previously described [
23]. The 3'-untranslated region of NF-κB1 mRNA containing the miR-9 binding site was amplified by PCR using the following primers: NF-κB1 sense, 5'-CGC
GGATCC TCAACAAAATGCCCCATG-3'; and NF-κB1 antisense, 5'-CG
GAATTC AGTTAAATCGAGAATGATTCAGGCG-3'. The amplified fragment was cloned into pcDNA3/EGFP at BamHI and EcoRI sites at downstream of the EGFP coding region. Also, four nucleotides at the miR-9 seed sequence binding site of the NF-κB1 3'UTR were deleted using PCR side-directed mutagenesis assay. The two additional primers used in the mutation were as follows: NF-κB1 MS, 5'-CCACACCGTGTAACAACCCTAAAATTCCAC-3'; and NF-κB1 MA, 5'-GGAATTTTAGGGTTGTTACACGGTGTGG-3'. The fragment of NF-κB1 3'UTR mutant was similarly cloned into the pcDNA3/EGFP at the same sites.
MGC803 cells were transfected with pri-miR-9 or control vector pcDNA3 in 24-well plates, and then with the reporter vector pcDNA3/EGFP- NF-κB1 3'UTR or pcDNA3/EGFP- NF-κB1 3'UTRmut on the next day. The vector pDsRed2-N1 (Clontech) expressing RFP was spiked in and used for normalization. The intensities of EGFP and RFP fluorescence were detected with Fluorescence Spectrophotometer F-4500 (HITACHI).
Quantitative RT-PCR
To detect the relative level of NF-κB1 transcript, real-time RT-PCR was performed. Briefly, a cDNA library was generated through reverse transcription using M-MLV reverse transcriptase (Promega) with 2 μg of the large RNA extracted from gastric tissue samples or MGC803 cells. The cDNA was used for the amplification of NF-κB1 gene and the β-actin gene was used as an endogenous control for the PCR reaction. PCR was performed under the following conditions: 94°C for 4 min followed by 40 cycles of 94°C for 1 min, 56°C for 1 min, 72°C for 1 min. PCR primers were: NF-κB1 sense and NF-κB1 antisense were as above; β-actin sense, 5'-CGTGACATTAAGGAGAAGCTG-3'; and β-actin antisense, 5'-CTAGAAGCATTTGCGGTGGAC-3'.
To detect the mature miRNA level, stem-loop RT-PCR assay was performed [
24]. Briefly, 2 μg of small RNA was reverse transcribed to cDNA using M-MLV reverse transcriptase (Promega) with the following primers: miR-9-RT, 5'-GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACTCATACAG-3'; and U6-RT, 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC-3', which can fold to a stem-loop structure. The cDNA was used for the amplification of mature miR-9 and an endogenous control U6 snRNA for all PCR reactions. PCR primers were: miR-9-Fwd, 5'-GCCCGCTCTTTGGTTATCTAG-3'; U6-Fwd, 5'-TGCGGGTGCTCGCTTCGGCAGC-3', and a universal downstream primer Reverse, 5'-CCAGTGCAGGGTCCGAGGT-3'. PCR cycles were as follows: 94°C for 4 min, followed by 40 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 40 s. SYBR Premix Ex Taq™ Kit (TaKaRa) was used following the manufacturer's instructions, and the real-time PCR was performed and analyzed by 7300 Real-Time PCR system (ABI). All primers were purchased from AuGCT Inc.
Western Blot
MGC803 cells were transfected and lysed 48 h later with RIPA lysis buffer and proteins were harvested. All proteins were resolved on 10% SDS denatured polyacrylamide gel and then transferred onto a nitrocellulose membrane. Membranes were incubated with anti-NF-κB1 antibody or anti-GAPDH antibody with blotto overnight at 4°C. The membranes were washed and incubated with horseradish peroxidase (HRP) conjugated secondary antibody. Protein expression was assessed by enhanced chemiluminescence and exposure to chemiluminescent film. Lab Works™ Image Acquisition and Analysis Software (UVP) was used to quantify band intensities. Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich.
Statistical Analysis
Data are expressed as means ± standard deviation (SD), and P ≦ 0.05 is considered as statistically significant by Students-Newman-Keuls test.
Discussion
In the last few years, several studies have shown the dysregulation of miRNAs in various types of cancers [
30‐
32]. Identification of cancer-specific miRNAs and their targets is critical for understanding their role in tumorigenesis and may be important for defining novel therapeutic targets [
33‐
35]. Here, we focused on the role of miR-9 in the pathogenesis of human gastric adenocarcinoma. First, we examined miR-9 expression in gastric adenocarcinoma and matched normal gastric tissues by real-time RT-PCR assay as previously described [
24]. This method uses a stem-loop reverse transcription primer and specially designed PCR primers to ensure the specificity of miRNA amplification. Meanwhile, U6 snRNA was also detected for normalization of expression in different samples. We discovered that from a total of nine pairs of matched advanced gastric adenocarcinoma tissue samples, the level of miR-9 was downregulated in tumor tissues compared to the matched normal tissues.
Several studies on the role of miR-9 deregulation in human oncogenesis have been reported. The aberrant hypermethylation study was done using the comprehensive methylation analysis approach, with breast cancer, normal breast tissues, and breast cancer cell lines as references. They found that the epigenetic inactivation of miR-9-1 in human breast cancer was due to aberrant hypermethylation, and found a strong correlation between hypermethylation of miR-9-1 and concomitant downregulation [
20]. Interestingly, taking advantage of miRNA expression analysis and real-time TaqMan PCR, it was also found that miR-9 expression was decreased in recurrent ovarian cancer tissues compared to primary cancer tissues [
21]. In addition, miR-9, miR-148a, and miR-34b/c were also underwent specific hypermethylation-associated silencing in cancer cells compared with normal tissues [
36]. Hence, the high frequency of aberrant regulation of miR-9 in different types of cancer tissues and cells suggests that downregulation of miR-9 might play an important role in oncogenesis.
It has been presumed that miRNAs suppressed in cancers may normally function as tumor suppressor genes. Therefore, we hypothesized that miR-9 is a growth inhibition factor in human gastric adenocarcinoma. Since miR-9 expression is decreased in cancer tissues, we expected that overexpression of miR-9 would result in the arrest of cell growth. Using the MTT assay, we found that MGC803 cells transfected with the miR-9 overexpression vector (pri-miR-9) exhibited decreased growth compared to control cells. We also found that the anti-proliferative activity of pri-miR-9 transfection was dose-dependent. Cell independent growth activity, which is inconspicuous in normal cells, is a typical characteristic of malignant transformed cells. In colony formation assay, we observed that the colony formation activity of MGC803 cells transfected with pri-miR-9 was significantly inhibited. Furthermore, we found that the growth rate of tumors derived from MGC803 cells transfected with pri-miR-9 in SCID mice was lower than that of control tumors. Hence, these results indicate that gastric adenocarcinoma cells transfected with pri-miR-9 showed deletion of malignant phenotypes, suggesting a role for miR-9 in the growth suppression of cancer cells.
It was unclear as to how miR-9 affects cell growth and proliferation, because little is known about the physiologic targets of miR-9. Although bioinformatic tools may help to reveal putative mRNA targets of miRNAs, experimental procedures are required for their validation. Only a few studies have identified oncogenes whose level of expression is regulated by miRNAs. For instance, members of the let-7 miRNA family can negatively regulate all three members of the RAS oncogene family [
27], and miR-15a/miR-16-1 can target and regulate BCL2 in B-cell CLL cells [
25]. These findings support the idea that miRNA dysregulation may be involved in cancer pathogenesis. In this study, we show that miR-9 targets the NF-κB1 mRNA, thus revealing a potential mechanism associated with gastric tumorigenesis.
Experimental evidence indicated that NF-κB1 is a target of miR-9. First, the ability of miR-9 to regulate NF-κB1 expression is likely direct, because it binds to the 3'UTR of NF-κB1 mRNA with complementarity to the miR-9 seed region. Second, the EGFP fluorescence intensity of EGFP- NF-κB1-UTR was specifically responsive to miR-9 overexpression. Third, mutation of the miR-9 binding site abolished the effect of miR-9 on the regulation of EGFP fluorescence intensity. Fourth, we observed an inverse correlation between the expression of miR-9 and NF-κB1 in gastric adenocarcinoma tissues. Finally, endogenous NF-κB1 expression, both mRNA and protein, is decreased in pri-miR-9-treated MGC803 cells, suggesting that miR-9 may regulate NF-κB1 protein expression by inducing mRNA degradation and/or translational suppression.
The NF-κB1 gene encodes a 105 kD protein, which can undergo cotranslational processing by the 26S proteasome to produce the 50 kD protein. In fact, NF-κB1 is a member of the Rel/NF-κB transcription factor family, which plays important roles in the regulation of immune responses, embryo and cell lineage development, cell-cycle progression, inflammation, and oncogenesis [
37‐
39]. Moreover, the positive rate of NF-κB1 in diffuse large B-cell lymphoma (DLBCL) was 63% (39/62), but none was expressed in reactive proliferation lymph node. However, NF-κB1 can positively regulate the expression of VEGF in DLBCL [
40]. In addition, suppression of NF-κB expression can downregulate the expression of VEGF, thereby inhibiting the invasion and metastasis of tumors [
41]. In this study, knockdown of NF-κB1 suppressed the growth of MGC803 cells, which was consistent with the results of miR-9 overexpression. Ectopic expression of NF-κB1 could also rescue MGC803 cells from growth inhibition caused by miR-9. However, the underlying mechanisms by which NF-κB1 affects gastric cancer cell growth remain to be established.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
LMG and HYW performed the experimental work. ML and HT conceived of the study and participated in its design and coordination. XL analyzed and interpreted the data. TL helped to draft the manuscript. All authors read and approved the final manuscript.