Regulatory T cells from patients with end-stage organ disease can be isolated, expanded and cryopreserved according good manufacturing practice improving their function

Peripheral blood (20–60 mL) was obtained from 14 LT and 9 KT patients. Patients characteristics are outlined in Table 1. Patient selection for GMP Tregs isolation/expansion was based on the following inclusion criteria: (1) age ≥ 18 years; (2) diagnosis of end-stage kidney disease in waiting list for living donor kidney transplantation or diagnosis of end-stage liver disease in waiting list for liver transplantation. Exclusion criteria included: (1) HIV, HBV, HCV positivity; (2) syphilis antibody positivity; (3) combined transplant; (4) concurrent uncontrolled infection. Patient selection for in vitro experiments were as above described except virus positivity. Peripheral blood (20–60 mL) and buffy-coat (30 mL) were also obtained from age and sex matched healthy controls. Human studies were conducted in accordance with the Declaration of Helsinki and approved by the local ethical Committee (232/2015/O/Tess by Investigation Drug Service, Azienda Ospedaliero-Universitaria di Bologna). Informed consent was obtained from all the subject prior to enrollment into the study.

Enumeration by flow cytometry of circulating Treg (CD4+CD25+CD127−FoxP3+) was carried out in the peripheral blood (PB) of selected KT and LT patients (n = 7 and n = 10, respectively) and of healthy controls (n = 9). The conjugated monoclonal antibodies used are shown in Additional file 1: Table S1. Surface marker staining was performed for 15 min at room temperature. For intracellular staining, anti-human FoxP3 (PCH101) Staining Set PE Kit was used (eBiosciences), according to the manufacturer’s instructions. Isotype control rat IgG2 PE was used as a control. Briefly, cells were stained for surface markers CD4, CD25 and CD127, washed once in PBS and then fixed/permeabilized. After washing, cells were incubated with anti-human FoxP3 antibody for 30 min at 4 °C in the dark. A lysis buffer (Becton–Dickinson) was used in order to lysate red blood cells. The phenotype of Tregs was analyzed by flow cytometry FACSCantoII (Beckton Dickinson). Data were analyzed using the FACSDiva software (Becton–Dickinson). The percentage of positive cells was calculated by subtracting the value of the appropriate isotype controls. The absolute number of positive cells per µL was calculated as follows: percentage of positive cells × white blood cell count (WBC)/100.

EDTA-anticoagulated peripheral blood (60 mL) was collected from 4 LT patients, 2 KT patients and buffy-coat (30 mL) from 5 controls. Peripheral blood mononuclear cells (PBMC) were then isolated by Ficoll-Hystopaque density gradient centrifugation.

Isolation: freshly isolated CD8−CD25+ T cells were purified from PBMC by negative selection of CD8+ T cells followed by positive selection of CD25+ T cells using specific Miltenyi-Biotec Beads (CD8 microbeads human and CD25 microbeads II human) with MidiMACS separator and a purity (CD4+CD25+) of > 90%.

Expansion: freshly isolated cells were plated at 1 × 10⁶/mL cells and activated with anti-CD3/CD28 coated beads (Invitrogen, Paisley, UK; Miltenyi Biotech) at a 4:1 bead:cell ratio at day 0 and then 1:1 bead:cell ratio weekly. Cells were expanded in culture media (TECSMacs GMP medium, Miltenyi Biotech) 5% human AB plasma containing rapamycin (100 nM) (Rapamune^®, Wyeth, USA) for 21 days at 37 °C and 5% CO₂. IL-2 (1000 IU/mL, Proleukin^®, Novartis, UK) was added at day 4 post-activation and replenished every 2 days. Cells were restimulated with beads every 7 days. After 21 days of culture, beads were magnetically removed and the cells washed in TECSMacs GMP medium. After washings, fresh beads, rapamycin and IL-2 were added. Expanded cells were used for further analysis at each time of re-stimulation up until day 21 of expansion.

Phenotypic characterization were performed on day 0, 7, 14, 21 of cultures for ex vivo expansion and after cryopreservation/thawing by flow cytometry as above described. Surface marker staining was performed in order to asses the content of Tregs and contaminant cells [monocytes (CD14+), B (CD19+) and T cells (CD8+), NK cells (CD56+), Th17 cells (CD196+CD161+)] present at each time point of culture (Additional file 1: Table S1).

The highly conserved Treg-specific demethylation region (TSDR) within the human FOXP3 gene is demethylated exclusively on Tregs and not in any other blood-cell types. Specific DNA methylation of the Treg FOXP3 is referred to intron 1, as previously identified [23]. DNA methylation of FOXP3 gene (CNS2 region) of expanded cells (day + 21), either freshly isolated or after cryopreservation/thawing, was evaluated for a total of 6 subjects (3 patients: 1 KT and 2 LT patients; and 3 controls). Genomic DNA was extracted from purified Tregs using the AllPrep DNA/RNA Mini Kit (QIAGEN, Hilden, Germany). 500 ng of DNA was bisulphite-converted using the EZ DNA Methylation Kit (Zymo Research Corporation, Orange, CA) according to manufacturer’s instructions, except for the thermal conditions of the conversion (21 cycles of 55 °C for 15 min and 95 °C for 30 s). Bisulphite-treated DNA was eluted in 100 μL of water. DNA methylation analysis of the genomic region chrX:49,117,049–49,117,467 within FOXP3 gene body was performed by EpiTYPER assay (Sequenom, San Diego, CA), a quantitative method based on mass spectrometry that allows to evaluate methylation level at single CpG sites/groups of adjacent CpG sites (CpG units). Ten ng of bisulphite-treated DNA were PCR-amplified and processed following manufacture’s instructions. The bisulphite specific primers were: FOXP3 forward, AGGAAGAGAGATTTGTTTGGGGGTAGAGGATTTA; FOXP3 reverse, CAGTAATACGACTCACTATAGGGAGAAGGCTCAAAAAAAACCAAATCTTCAAAACT.

For each gene, CpG sites with missing values in more than the 20% of the samples were removed, as well as samples with missing values in more than the 20% of CpG sites. The R package massArray was used to test if bisulphite conversion reaction run to completion [24]. For all samples analysed bisulphite conversion was from 98.9 to 100%.

The T cells were used as autologous responder cells for in vitro suppression assays. The suppressive activity of freshly isolated and expanded cells were tested by co-culturing CD8−CD25− T cells, labeled with 5 µM carboxyfluorescein succinimidyl ester (CFSE, Invitrogen), with serial dilutions of freshly isolated (CD8−CD25+ T cells) and ex vivo expanded autologous Tregs in the presence of CD3/CD28 GMP beads at ratio previously shown by us (in house experiments) to be effective in dose–response experiments (1:10 CD8−CD25− T cells to bead ratio) in RPMI-1640 medium containing 10% FBS, 1% penicilline/streptomycine and l-glutamine (1%) for 5 days at 37 °C and 5% CO₂. Proliferation was analyzed by flow cytometry. The percentage of proliferative CD8−CD25− T cells in the absence of Tregs was taken as 100% proliferation.

The GMP manufacturing was performed in the Cell Factory of Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, certified in compliance with European GMP regulations by the Italian Drug Agency (authorization number aM-51/2018).

Steady state leukapheresis from 2 patients (1 KT and 1 LT patient) were processed using GMP-compliant devices and reagents (Additional file 1: Figure S1A). The subjects were evaluated for venous accesses suitability. Leukapheresis was carried out by the COM.TEC^® (Fresenius Kabi AG, Bad Homburg, Germany) cell separator. The treatment of two blood volumes was set up as the procedure end-point. ACD-A was used for anticoagulation at a ratio of 1:14–1:13. For prophylaxis of citrate-related hypocalcemia, calcium gluconate was administered intravenously during the leukapheresis.

CD8−CD25+ cells were purified using the CliniMACS System (Miltenyi Biotec, Bergisch Gladbach, Germany) according to GMP procedures and following manufacturer’s instructions. Briefly, we performed a sequential two-step process based on the magnetic depletion of CD8+ T cells, followed by a positive selection of CD25+ cells after an over night storage, using monoclonal antibodies anti-CD8 (Miltenyi Biotec) and anti-CD25 (Miltenyi Biotec), as described in the CliniMACS user manual for cell preparation, magnetic labelling, and selection.

Forty millions of CD8−CD25+ cells were expanded in vitro in gas-permeable culture bags (MACS GMP Cell Expansion Bags and MACS GMP Cell Differentiation Bags, Miltenyi Biotec) for 3 weeks in complete medium, consisting of TexMACS Medium (Miltenyi Biotec) supplemented with 100 nM rapamycin (Miltenyi Biotec), 5% allogeneic human heat-inactivated AB plasma, 500–1000 UI/mL IL-2 (Proleukin, Novartis Pharmaceuticals Canada Inc, Dorval, Quebec, Canada). On day 0, 7 and 14, anti-CD3/CD28 beads (MACS GMP ExpAct Treg Beads, Miltenyi Biotec) were added at different beads:cells ratio 4:1, 1:1, 1:1 respectively.

At day 21 all the cultured cells were collected and the beads were removed using the CliniMACS device, according to manufacturer’s instructions. Cells were counted by an automated and validated method (Nucleocounter System, Chemometec, Allerød, Denmark). The Treg markers were evaluated by flow cytometry (BD FACSCanto II, BD Bioscience, San Jose, CA, USA) using the following antibodies: CD45 APC-H7 (BD Bioscience), CD4 FITC (BD Bioscience), CD25 APC (BD Bioscience), CD127 PE-Cy7 (BD Bioscience) and FoxP3 PE (eBioscience, San Diego, CA, USA).

Negative fraction (CD8−CD25− T cells) after GMP selection at day 0 and the final product after GMP expansion at day 21, were cryopreserved and thawed as above described.

Freshly isolated fractions (CD8−CD25+ and CD8−CD25− T cells) and expanded cells (after 7, 14 and 21 days of expansion) were washed and cryopreserved with 10% DMSO (CRYOSERV, Mylan Institutionals, Canonsburg, PA, USA), 10% HSA (HAS; Kedrion, Lucca, Italy) in a saline solution (B. Braun, Melsungen, AG, Germany) using a controlled-rate freezer. The frozen units were transferred and stored immediately to vapor-phase liquid nitrogen into dedicated tanks. All the cellular fractions were thawed at 37 °C and the viability, phenotype and suppressive function were assessed as above described.

NOD scid gamma (NSG) female mice (6–7 weeks of age) were purchased from Charles River (Calco, Italy). All animals were housed under specific pathogen-free conditions in compliance with guidelines of the San Raffaele Institutional Animal Care and Use Committee (IACUC number: 632). Mice were maintained for at least 5 days in the animal facility for acclimatization before transplantation. To promote the engraftment of transplanted cells injected intraperitoneally, all mice were conditioned with total body irradiation (1.75 cGy) on day 1. Of note, day 1 of the study is considered the day of transplant. All groups of mice, transplanted as well as control mice, were monitored for 7 weeks. Clinical signs of GVHD (e.g., hunched back, fur loss, skin inflammation) were monitored daily. Body weight was monitored throughout the duration of the study. Animals showing marked clinical signs as of distress, loss of weight equal to or greater than 20% of their starting weight were immediately sacrificed.

To establish whether the expanded Tregs could counteract acute GVHD, a xeno-GvHD model was induced by intraperitoneally transfer of human autologous CD8−CD25− T cells from 1 LT and 1 KT patient into mice. Both CD8−CD25− T cells and expanded Tregs were injected within 30 min from thawing (Additional file 1: Figure S1B). Specifically, human CD8−CD25− T cells (6 × 10⁶) from LT or KT patients were injected with (simultaneous injection) or without autologous Treg (6 × 10⁶) at a Treg: CD8−CD25− T cells ratio of 1:1. Timing of Treg infusion is crucial. In our model Tregs were infused at the time of T effector transplantation.

To assess the in vivo persistence of human cells, transplanted mice were bled 4 weeks after transplantation and sacrificed 7 weeks after transplantation. Phenotype analysis of injected cells and of peripheral blood at 4 weeks (± 3 days) after transplantation and of PB and spleen at 7 weeks (± 3 days) after transplantation was performed (Additional file 1: Figure S1C). Following a Fc blocking step, cell surface staining was performed with anti-mouse CD45 and anti-human CD4, CD3, CD25, FoxP3 mAbs at 1:100 dilution in staining buffer (PBS, 2% FCS, 0.1% NaN3) (list of mAbs is in Additional file 1: Table S1). To detect FoxP3, cells were treated and stained with the FoxP3 fixation/permeabilization kit according to the manufacturer’s instructions (eBioscience). Samples were acquired on a BD FACSCanto II flow cytometer. Manual analysis of flow cytometry data was performed with FCS Express V4 (DeNovo Software, Glendale, CA).

Statistical analyses were performed using GraphPad Prism (GraphPad Prism 5.0 soft-ware, SanDiego CA, USA), and data are presented as mean ± standard error of the mean (SEM). For all experiments involving multiple comparisons, analysis of variance (ANOVA) followed by a Dunnett’s post hoc test was used. For those who involved comparisons between two groups, Student’s t-test was used. The level of significance was set at p ≤ 0.05.

We firstly enumerated circulating CD4+CD25+CD127−FoxP3+ Tregs in End-Stage Organ Disease patients and controls. The mean absolute numbers of circulating Tregs from LT (19.8 ± 10/mL) and KT (18.8 ± 7/mL) patients was not significantly different from that of healthy controls (17 ± 4/mL) (p = NS; Additional file 1: Figure S2).

Starting from 60 mL of PB (patients) and 30 mL of buffy-coat (healthy controls), CD8 depletion with subsequent CD25+ enrichment of PBMCs yielded a median of 3.7 × 10⁶ nucleated cells (range 1.28–8.8 × 10⁶) in healthy controls, 1.47 × 10⁶ nucleated cells (range 5.3 × 10⁵–2.56 × 10⁶) in LT patients and 1.77 × 10⁶ nucleated cells (range 8.5 × 10⁵–2.7 × 10⁶) in KT patients. The freshly isolated CD8−CD25+ T cells were 2.0 ± 1.2, 1.9 ± 1.3 and 2.6% ± 0.7 of the PBMCs, respectively, with no significant differences between patients/controls (p = NS) (data not shown). The Fig. 1a shows the gating strategy for identification of CD4+CD25+CD127−FoxP3+ Tregs which represented more than 80% of the cells (range 70–96%) within the CD8−CD25+ population. The median Treg purity (CD4+CD25+CD127−FoxP3+ cells) was 72% (range 50–84) and 55% (range 40–70) in LT and KT patients, respectively and 65% (range 54–80) in healthy controls (Fig. 1b). No significant difference was observed between patients and controls (p = NS). On day 0, contaminating cells in healthy controls were CD19+ B cells (16%, range 14.8–17), Th17 cells (4.7%, range 0.7–6.9) and CD14+ monocytes (6.3%, range 0.8–11.4). In LT and KT patients, contaminating cells were mainly CD19+ B cells (6.8%, range 1.1–8.4; 5.4%, range 1.9–8.9, respectively) and Th17 cells (7.3%, range 1.4–12.8; 11.8%, range 10.3–13.3, respectively). Natural Killer cells and monocytes content was always very low (below 1%) (Fig. 1c). By comparing patients and controls, Th17 cells were significantly increased in KT cells as compared with LT or healthy controls (p ≤ 0.05 vs. LT patients; p ≤ 0.05 vs. healthy controls). In addition, CD19+ cells were significantly reduced in both patient groups as compared with the normal counterparts (p ≤ 0.05 for LT patients; p ≤ 0.05 for KT patients).

After 21 days, Tregs expanded a median of 197-folds (range 26–567) in LT patients, 266-folds (range 233–300) in KT patients and 559-folds (range 342–826) in healthy controls (Fig. 2a). Differences between patients and controls were not statistically significant. Starting from freshly isolated 500 × 10³ cells, the final yield was a median of 255 × 10⁶ (range 171 × 10⁶–413 × 10⁶) nucleated cells in healthy controls, 48 × 10⁶ (range 30 × 10⁶–284 × 10⁶) nucleated cells in LT patients and 133 (range 116 × 10⁶–150 × 10⁶) nucleated cells in KT patients (data not shown). Treg purity (CD4+CD25+CD127−FoxP3+) increased significantly during expansion (Fig. 2b) in healthy donors and KT patients (p ≤ 0.05). Contaminating cells, namely B cells, Th17 cells and monocytes decreased below 1% in healthy controls and LT patients and below 3% in KT patients (Fig. 2c).

When cryopreserved/thawed 21 days expanded Tregs were analyzed, the mean percentage of viable cells was always more than 75% with no significant differences between patients and controls (Fig. 2d). The mean percentage of CD4+CD25+CD127−FoxP3+ cells was always > 80% (Fig. 2e).

When functional assays were performed, freshly isolated cells (CD8−CD25+ T cells) from the three groups exerted a limited (healthy controls and LT patients) or poor (KT patients) suppressive effect toward autologous CD8−CD25− T cells proliferation in vitro (Fig. 3a). After 21 days of in vitro expansion, flow cytometry analysis demonstrated that, according to the increased T regulatory phenotype, Tregs from patients/controls had significant suppressive activity (Fig. 3b), which was not modified by cryopreservation/thawing (Fig. 3c).

All together these data demonstrate that our small scale Treg isolation and expansion protocol from LT and KT patients lead to functional Tregs which are suitable for cell therapy. Moreover, cryopreservation/thawing does not impair phenotype/function of the expanded Tregs.

Figure 4a shows that in males the locus, which is localized on X chromosome, displayed low DNA methylation values (CpG sites ranging from 0.08 to 0.44). As expected, in females CpG sites had higher methylation values (ranging from 0.24 to 0.73) due to X chromosome inactivation We evaluated DNA methylation differences at day + 21 in freshly isolated and cryopreserved/thawed expanded cells in patients and controls separately using paired t-test. The large majority of CpG sites was not significant, and intra-individual difference between the two groups were generally small, spanning between − 0.13 and 0.23. The only exception was the CpG_3 among controls (p-value: 0.002), but, also in this case, the difference between the freshly isolated and the cryopreserved/thawed cells was small, ranging from 0.06 to 0.07 (Fig. 4b).

To investigate whether GMP expanded Tregs from 1 KT and 1 LT patient have inhibitory function in vivo after thawing, we used a xenograft model of lethal GVHD. Specifically, irradiated NSG mice were injected with cryopreserved/thawed CD8−CD25− T cells either alone or in combination with autologous expanded cryopreserved/thawed Tregs at 1:1 ratio to assess their ability to ameliorate GVHD (Additional file 1: Figure S1). The rationale for this design is that early infusion of Tregs allows the cells to prevent T effector activation. After the immunomagnetic selection and expansion of 40 millions of freshly isolated CD8−CD25+ cells under GMP condition, we obtained 4.3 × 10⁹ total cells (107.1-fold expansion) for the KT patient and 4.6 × 10⁹ total cells (115.2-fold expansion) for the LT patient. Before expansion the percentage of CD45+/CD4+/CD25+ cells was 84.9% and 53.9% in KT and LT patient whereas, at the end of expansion, the percentage of CD45+/CD4+/CD25+ cells increased up to 98.3% and 89.2% respectively. At day 21 CD45+/CD4+/CD25+/CD127−/FoxP3+ cells were 79.2% and 84.4% respectively (data not shown).

Tregs were then thawed and characterized for the phenotype and in vitro function. As shown in Fig. 5a, b, the thawed Tregs were more than 80% CD4+CD25+CD127−FoxP3+ and highly suppressive.

Mice receiving KT CD8−CD25− T cells lost weight and all succumbed to GVHD by day 40. In contrast, mice receiving KT CD8−CD25− T cells and autologous Tregs showed delayed disease-associated weight loss and slightly increased survival rate (by day 48 17% of mice receiving CD8−CD25− T cells with Tregs from the KT patient survived versus 0% for mice receiving CD8−CD25− T cells only; p = NS) (Fig. 6a, b). Similar results were obtained with cells from the LT patient: by day 48 58% of mice receiving CD8−CD25− T cells with Tregs from the LT patient survived versus 12.5% for mice receiving CD8−CD25− T cells only (p = NS; Fig. 6c, d).

To assess human cells engraftment in PB, animals were bled after 4/7 weeks and the percentages of human CD45+ cells in blood was determined (Fig. 7). The gating strategy is shown in Fig. 7a. No human CD45+ cells were identified in the PB of mice after infusion of Tregs alone from KT or LT patients. Conversely, a wide distribution of human CD45+ cells was observed in the PB of mice after transplant of CD8−CD25− T cells alone or CD8−CD25− T cells plus Treg infusion (Fig. 7b, c).

To assess the biodistribution of infused human cells, spleen and PB cells of mice were stained with anti-human CD45, CD3, CD4, FoxP3 monoclonal antibodies after 7 weeks from transplant. The gating strategy is shown in Fig. 8a. By comparing PB and spleen, a higher mean percentage of human CD45+ cells was observed in the spleen versus PB of the mice after receiving CD8−CD25− T cells plus Treg of LT patients (p < 0.003; Fig. 8b). Of note, the majority of the human CD45+ cells were CD3+CD4+ in the blood/spleen of mice after receiving KT or LT cells (Fig. 8c). Human FoxP3+ Tregs were identified in the CD3+CD4+ fraction of PB and spleen of the two groups of mice without differences between KT and LT cells (Fig. 8d).