Background
Methods
Study participants
Assay for bacterial analysis in saliva
Primer set | Sequence (5′ to 3′) | Size (bp) | Detection Limit (No. of cells) | Reference |
---|---|---|---|---|
P. gingivalis | TGT AGA TGA CTG ATG CTG AAA ACC | 197 | 5 | (17) |
ACG TCA TCC CCA CCT TCC TC | ||||
T. denticola | AAG GCG GTA GAG CCG CTC A | 311 | 10 | (18) |
AGC CGC TGT CGA AAA GCC CA | ||||
T. forsythia | GCG TAT GTA ACC TGC CCG CA | 641 | 25 | (15) |
TGC TTC AGT GTC AGT TAT ACC T | ||||
P. intermedia
| TTTGTTGGGGAGTAAAGCGGG | 575 | 25 | (15) |
TCAACATCTCTGTATCCTGCGT |
Periodontal tissue examination and oral health behavior
Laboratory testing of serum for lipid profile and other general health information
Statistical methods
Results
Prevalence of periodontal bacteria | Periodontal pathogenic burden | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Variable name | Total |
P. gingivalis
|
T. denticola
|
T. forsythia
|
P. intermedia
| |||||||
Yes | No | Yes | No | Yes | No | Yes | No | Low | Moderate | High | ||
No. (%)
| ||||||||||||
Total | 385 (100.0) | 224(58.2) | 161(41.8) | 230(59.7) | 155(40.3) | 285(74.0) | 100(26.0) | 203(52.7) | 182(47.3) | 46(11.9) | 230(59.7) | 109(28.3) |
Age (y) | ||||||||||||
50−59 |
51 (13.2)
|
20(8.9)
|
31 (19.3)
| 30 (13.0) | 21 (13.5) | 37 (13.0) | 14 (14.0) | 27 (13.3) | 24 (13.2) | 5 (10.9) | 39 (17.0) | 7 (6.4) |
60 −69 |
108 (28.1)
|
64 (28.6)
|
44 (27.3)
| 68 (29.6) | 40 (25.8) | 86 (30.2) | 22 (22.0) | 57 (28.1) | 51 (28.0) | 10 (21.7) | 64 (27.8) | 34 (31.2) |
70−82 |
226 (58.7)
|
140 (62.5)
|
86 (53.4)
| 132 (57.4) | 94 (60.6) | 162 (56.8) | 64 (64.0) | 119 (58.6) | 107 (58.8) | 31 (67.4) | 127 (55.2) | 68 (62.4) |
p-value |
0.01
| 0.72 | 0.29 | 1.00 | 0.07 | |||||||
Gender | ||||||||||||
Male | 176 (45.7) | 108 (48.2) | 68 (42.2) | 106 (46.1) | 70 (45.2) | 136 (47.7) | 40 (40.0) | 98 (48.3) | 78 (42.9) | 16 (34.8) | 107 (46.5) | 53 (48.6) |
Female | 209 (54.3) | 116 (51.8) | 93 (57.8) | 124 (53.9) | 75 (54.8) | 149 (52.3) | 60 (60.0) | 105 (51.7) | 104 (57.1) | 30 (65.2) | 123 (53.5) | 56 (51.4) |
p-value | 0.25 | 0.86 | 0.18 | 0.30 | 0.27 | |||||||
Smoking | ||||||||||||
Current | 31 (8.1) | 18 (9.2) | 13 (9.1) | 16 (7.7) | 15 (11.5) | 22 (8.6) | 9 (10.8) |
15 (8.2)
|
16 (10.3)
|
2 (5.1)
|
23 (11.5)
|
6 (6.0)
|
Former | 100 (26.0) | 64 (32.7) | 36 (25.2) | 67 (32.1) | 33 (25.4) | 82 (32.0) | 18 (21.7) |
65 (35.5)
|
35 (22.4)
|
7 (17.9)
|
55 (27.5)
|
38 (38.0)
|
Never | 208 (54.0) | 114 (58.2) | 94 (65.7) | 126 (60.3) | 82 (63.1) | 152 (59.4) | 56 (67.5) |
103 (56.3)
|
105 (67.3)
|
30 (76.9)
|
122 (61.0)
|
56 (56.0)
|
p-value | 0.31 | 0.27 | 0.19 |
0.03
|
0.05
| |||||||
Drinking | ||||||||||||
Current | 144 (37.4) | 90 (45.9) | 54 (37.8) | 88 (42.1) | 56 (43.1) | 115 (44.9) | 29 (34.9) | 77 (42.1) | 67 (42.9) | 13 (33.3) | 87 (43.5) | 44 (44.0) |
Former | 19 (4.9) | 11 (5.6) | 8 (5.6) | 13 (6.2) | 6 (4.6) | 14 (5.5) | 5 (6.0) | 9 (4.9) | 10 (6.4) | 2 (5.1) | 12 (6.0) | 5 (5.0) |
Never | 176 (54.0) | 95 (48.5) | 81 (56.6) | 108 (51.7) | 68 (52.3) | 127 (49.6) | 49 (59.0) | 97 (53.0) | 79 (50.6) | 24 (61.5) | 101 (50.5) | 51 (51.0) |
p-value | 0.31 | 0.82 | 0.28 | 0.80 | 0.77 | |||||||
Exercise (times/week) | ||||||||||||
None | 110 (28.6) | 57 (29.2) | 53 (37.1) | 68 (32.7) | 42 (32.3) | 84 (32.9) | 26 (31.3) | 65 (35.7) | 45 (28.8) | 16 (41.0) | 59 (29.5) | 35 (35.4) |
≤ Twice | 228 (59.2) | 138 (70.8) | 90 (62.9) | 140 (67.3) | 88 (67.7) | 171 (67.1) | 57 (68.7) | 117 (64.3) | 111 (71.2) | 23 (59.0) | 141 (70.5) | 64 (64.6) |
p-value | 0.13 | 0.94 | 0.79 | 0.18 | 0.29 | |||||||
Brushing frequency (times/day) | ||||||||||||
Once | 75 (19.5) | 40 (21.1) | 35 (26.7) | 46 (22.5) | 29 (24.8) | 58 (23.4) | 17 (23.3) | 43 (23.9) | 32 (22.7) | 9 (28.1) | 41 (21.6) | 25 (25.3) |
Twice | 163 (42.3) | 96 (50.5) | 67 (51.1) | 102 (50.0) | 61 (52.1) | 127 (51.2) | 36 (49.3) | 93 (51.7) | 70 (49.6) | 15 (46.9) | 101 (53.2) | 47 (47.5) |
≥ 3 times | 83 (21.6) | 54 (28.4) | 29 (22.1) | 56 (27.5) | 27 (23.1) | 63 (25.4) | 20 (27.4) | 44 (24.4) | 39 (27.7) | 8 (25.0) | 48 (25.3) | 27 (27.3) |
p-value | 0.32 | 0.68 | 0.94 | 0.81 | 0.58 | |||||||
Flossing frequency | ||||||||||||
None | 142 (36.9) | 80 (41.7) | 62 (45.9) | 93 (45.4) | 49 (40.2) | 109 (43.6) | 33 (42.9) | 81 (45.0) | 61 (41.5) | 16 (47.1) | 78 (40.0) | 48 (49.0) |
≥ Once/week | 55 (14.3) | 35 (18.2) | 20 (14.8) | 29 (14.1) | 26 (21.3) | 43 (17.2) | 12 (15.6) | 28 (15.6) | 27 (18.4) | 5 (14.7) | 37 (19.0) | 13 (13.3) |
≥ Once/day | 130 (33.8) | 77 (40.1) | 53 (39.3) | 83 (40.5) | 47 (38.5) | 98 (39.2) | 32 (41.6) | 71 (39.4) | 59 (40.1) | 13 (38.2) | 80 (41.0) | 37 (37.8) |
p-value | 0.64 | 0.24 | 0.91 | 0.73 | 0.85 | |||||||
Periodontitis by CPI* | ||||||||||||
Periodontitis(−) | 195 (54.2) |
105 (48.8)
|
90 (62.1)
|
100 (44.4)
|
95 (70.4)
|
133 (48.5)
|
62 (72.1)
|
89 (45.2)
|
106 (65.0)
|
27 (75.0)
|
127 (58.5)
|
41 (38.3)
|
Periodontitis(+) | 165 (45.8) |
110 (51.2)
|
55 (37.9)
|
125 (55.6)
|
40 (29.6)
|
141 (51.5)
|
24 (27.9)
|
108 (54.8)
|
57 (35.0)
|
9 (25.0)
|
90 (41.5)
|
66 (61.7)
|
p-value |
0.01
|
<.01
|
<.01
|
<.01
|
<.01
| |||||||
mean ± sd
| ||||||||||||
Age (y) | 69.2 ± 7.8 | 69.8 ± 7.2 | 68.4 ± 8.4 | 69.1 ± 7.9 | 69.3 ± 7.7 | 68.9 ± 7.8 | 70.1 ± 7.6 | 69.3 ± 7.8 | 69.1 ± 7.83 |
71.0 ± 8.0
a
|
68.3 ± 7.9
b
|
70.3 ± 7.2b
a
|
p-value | 0.08 | 0.78 | 0.18 | 0.72 |
0.05
| |||||||
CPI | 1.7 ± 1.6 | 1.8 ± 1.6 | 1.5 ± 1.5 |
2.1 ± 1.5
|
1.1 ± 1.5
|
1.9 ± 1.5
|
1.1 ± 1.5
|
2.0 ± 1.5
|
1.3 ± 1.5
|
1.0 ± 1.5
a
|
1.6 ± 1.
5a
|
2.2 ± 1.5
b
|
p-value | 0.08 |
<.01
|
<.01
|
<.01
|
<.01
| |||||||
No. of present teeth | 20.9 ± 7.8 | 20.8 ± 7.1 | 21.1 ± 8.7 |
21.7 ± 6.4
|
19.8 ± 9.4
| 21.2 ± 7.1 | 20.1 ± 9.5 | 21.6 ± 6.8 | 20.1 ± 8.8 | 18.8 ± 11.0 | 21.2 ± 7.6 | 21.2 ± 6.5 |
p-value | 0.70 |
0.03
| 0.32 | 0.06 | 0.22 | |||||||
DFMT index | 18.0 ± 7.1 | 18.1 ± 7.0 | 17.8 ± 7.2 | 18.2 ± 6.8 | 17.6 ± 7.4 | 18.1 ± 7.0 | 17.5 ± 7.1 | 17.7 ± 6.8 | 18.3 ± 7.4 | 18.1 ± 8.1 | 18.0 ± 6.8 | 17.9 ± 7.1 |
p-value | 0.75 | 0.38 | 0.43 | 0.38 | 0.43 |
Exposures | No. (%) | High-density lipoprotein | Triglycerides | Low-density lipoprotein | Total cholesterol |
---|---|---|---|---|---|
mean ± SD | mean ± SD | mean ± SD | mean ± SD | ||
P. gingivalis
| |||||
Yes | 196 (57.8) | 60.7 ± 14.6 | 108.9 ± 64.9 | 123.3 ± 28.1 | 205.8 ± 30.4 |
No | 143 (42.2) | 63.0 ± 17.3 | 101.6 ± 50.7 | 120.0 ± 29.2 | 203.3 ± 32.8 |
p-value | 0.21 | 0.26 | 0.30 | 0.47 | |
T. denticola
| |||||
Yes | 209 (61.7) |
59.8 ± 15.0
| 110.1 ± 65.0 | 121.9 ± 27.0 | 203.7 ± 30.2 |
No | 130 (38.3) |
64.8 ± 16.8
| 98.9 ± 48.4 | 121.8 ± 31.1 | 206.4 ± 33.4 |
p-value |
0.00
| 0.07 | 0.96 | 0.45 | |
T. forsythia
| |||||
Yes |
256 (75.5)
|
60.7 ± 15.7
|
108.7 ± 64.3
| 121.8 ± 28.5 | 204.3 ± 30.6 |
No |
83 (24.5)
|
64.7 ± 15.9
|
97.0 ± 39.5
| 122.0 ± 28.9 | 206.0 ± 34.1 |
p-value |
0.05
|
0.05
| 1.00 | 0.66 | |
P. intermedia
| |||||
Yes | 183 (54.0) |
59.9 ± 15.6
| 110.6 ± 67.2 | 122.4 ± 27.5 | 204.4 ± 29.9 |
No | 156 (46.0) |
63.9 ± 15.8
| 100.3 ± 48.2 | 121.2 ± 29.8 | 205.1 ± 33.3 |
p-value |
0.02
| 0.11 | 0.68 | 0.84 | |
Periodontal pathogenic burden | |||||
Low | 39 (11.5) |
66.2 ± 16.1a
| 97.1 ± 44.3 | 124.1 ± 27.7 | 209.7 ± 30.2 |
Moderate | 200 (59.0) |
63.3 ± 16.2a
| 102.1 ± 51.9 | 119.7 ± 29.5 | 203.4 ± 32.8 |
High | 100 (29.5) |
56.7 ± 13.8b
| 116.8 ± 75.4 | 125.3 ± 26.9 | 204.7 ± 31.4 |
p-value |
<.01
| 0.08 | 0.19 | 0.51 | |
Groups based on combination of bacterial burden and periodontitis | |||||
Periodontitis(−) and low | 27 (7.0) |
69.5 ± 15.4
a
|
89.6 ± 43.8
a
| 128.8 ± 31.2 | 216.1 ± 30.5 |
Periodontitis(−) and moderate | 127 (33.0) |
64.9 ± 16.0
a
|
91.9 ± 41.0
a
| 119.4 ± 28.7 | 202.7 ± 30.7 |
Periodontitis(−) and high | 41 (10.6) |
64.1 ± 13.1
a
|
92.5 ± 39.7
a
| 123.8 ± 19.3 | 206.4 ± 22.3 |
Periodontitis(+) and low | 9 (2.3) |
63.4 ± 13.1
a
|
107.0 ± 49.1
a
| 112.7 ± 16.4 | 197.5 ± 28.4 |
Periodontitis(+) and moderate | 90 (23.4) |
61.9 ± 16.6
ab
|
113.8 ± 63.2
ab
| 118.4 ± 31.0 | 203.0 ± 35.6 |
Periodontitis(+) and high | 66 (17.1) |
52.8 ± 12.7
b
|
131.5 ± 87.1
b
| 125.8 ± 30.7 | 204.8 ± 32.95 |
p-value |
<.01
|
<.01
| 0.38 | 0.52 |
Means of serum lipids | ||||||
---|---|---|---|---|---|---|
Model 1 | Model 2 | Model 3 | ||||
MEAN ± SD | LSM | MEAN ± SD | LSM | MEAN ± SD | LSM | |
High-density lipoprotein (mg/dL) | ||||||
Periodontal pathogenic burden | ||||||
Low |
66.2 ± 16.1
| 65.4 |
68.1 ± 14.9
| 66.4 |
68.1 ± 14.9
| 66.1 |
Moderate |
63.3 ± 16.2
| 63.4 |
63.6 ± 16.3
| 63.1 |
63.5 ± 16.3
| 63.0 |
High |
56.7 ± 13.8
| 56.9 |
56.8 ± 13.9
| 58.2 |
57.3 ± 13.8
| 58.9 |
P for trend > 0.05 | P for trend = 0.07 | P for trend = 0.05 | ||||
Adjusted R2 = 0.10 | Adjusted R2 = 0.18 | Adjusted R2 = 0.19 | ||||
Triglycerides (mg/dL) | ||||||
Periodontal pathogenic burden | ||||||
Low | 97.1 ± 44.3 | 100.6 | 93.6 ± 44.8 | 100.0 | 93.6 ± 44.8 | 101.0 |
Moderate | 102.1 ± 51.9 | 101.4 | 101.5 ± 52.7 | 102.9 | 101.8 ± 53.1 | 103.7 |
High | 116.8 ± 75.4 | 116.8 | 117.6 ± 75.8 | 112.9 | 115.9 ± 76.1 | 109.6 |
P for trend > 0.05 | P for trend > 0.05 | P for trend > 0.05 | ||||
Adjusted R2 = 0.05 | Adjusted R2 = 0.12 | Adjusted R2 = 0.14 | ||||
Low-density lipoprotein (mg/dL) | ||||||
Periodontal pathogenic burden | ||||||
Low | 124.1 ± 27.7 | 123.4 | 125.1 ± 29.1 | 123.5 | 125.1 ± 29.1 | 122.9 |
Moderate | 119.7 ± 29.5 | 119.6 | 119.0 ± 29.7 | 118.9 | 119.5 ± 29.8 | 119.3 |
High | 125.3 ± 26.9 | 125.8 | 125.1 ± 27.1 | 125.7 | 124.9 ± 27.6 | 126.0 |
P for trend > 0.05 | P for trend > 0.05 | P for trend > 0.05 | ||||
Adjusted R2 = 0.14 | Adjusted R2 = 0.03 | Adjusted R2 = 0.03 | ||||
Total Cholesterol (mg/dL) | ||||||
Periodontal pathogenic burden | ||||||
Low | 209.7 ± 30.2 | 208.9 | 211.9 ± 30.6 | 209.9 | 211.9 ± 30.6 | 209.2 |
Moderate | 203.4 ± 32.8 | 203.2 | 202.8 ± 32.9 | 202.6 | 203.3 ± 32.8 | 203.1 |
High | 205.4 ± 29.2 | 206.1 | 205.5 ± 29.5 | 206.5 | 205.4 ± 30.1 | 206.8 |
P for trend > 0.05 | P for trend > 0.05 | P for trend > 0.05 | ||||
Adjusted R2 = 0.04 | Adjusted R2 = 0.03 | Adjusted R2 = 0.02 |