Skip to main content
Erschienen in: BMC Cardiovascular Disorders 1/2018

Open Access 01.12.2018 | Research article

Relationship of cardiovascular disease risk factors and noncoding RNAs with hypertension: a case-control study

verfasst von: Shiying Chen, Rong Chen, Tingxing Zhang, Shaowei Lin, Zhou Chen, Bi Zhao, Huangyuan Li, Siying Wu

Erschienen in: BMC Cardiovascular Disorders | Ausgabe 1/2018

Abstract

Background

The present study sought to explore the relationship of common cardiovascular disease risk factors and noncoding RNAs with essential hypertension (EH).

Methods

A total of 402 EH patients and 402 gender- and age-frequency matched healthy controls were enrolled in this study. Each participant received a questionnaire survey, physical examination and laboratory tests. Quantitative real-time polymerase chain reaction (qPCR) was performed to assess relative expression levels of six noncoding RNAs (NR_027032, NR_034083, NR_104181, miR-126, miR-143 and miR-145) in peripheral blood leucocytes. Multiple logistic regression analysis was used to estimate the risk of having EH between hypertensive and non-hypertensive patients.

Results

Analysis showed that participants with anxiety, high body mass index, abdominal obesity and family history of hypertension had higher risk for EH, whereas those with bland diet and occupational physical activities had lower risk for EH. qPCR assays showed that NR_027032 (P = 0.015) and NR_034083 (P = 0.004) were significantly reduced in EH patients compared with controls, whereas NR_104181 (P = 0.007), miR-143 (P = 0.005) and miR-145 (P = 0.015) were significantly elevated.
After controlling the cardiovascular risk factors, multivariate analysis showed that lower expression levels of NR_034083 and higher expression levels of NR_104181 and miR-143 were risk factors for EH.

Conclusions

EH is a result of environmental and epigenetic factors. Strikingly, NR_034083, NR_104181 and miR-143 may be correlated with the risk for EH development; therefore, epigenetic markers could be used to measure hypertension levels to help elucidate the pathogenesis of EH.
Abkürzungen
BMI
Body mass index
DBP
Diastolic blood pressure
EH
Essential hypertension
lncRNA
Long noncoding RNA
miRNA
MicroRNA
ncRNA
Noncoding RNA
SAS
Self-rating anxiety scale
SBP
Systolic blood pressure
SDS
Self-rating depression scale
WC
Waist circumference

Background

Hypertension, a leading risk factor for global cardiovascular disease, contributes to half of coronary heart disease and approximately two-thirds of cerebrovascular disease burdens [1]. While the pathogenesis of hypertension remains ambiguous, hypertension is generally believed to be a complex and multifactorial disease. Recent studies have revealed the relevance of noncoding RNAs with the pathogenesis of hypertension, supporting the importance of epigenomic regulation in hypertension progress [2, 3].
Currently, epigenetic regulators of hypertension mainly include long noncoding RNAs (lncRNAs), microRNAs (miRNAs) and DNA methylation [4]. LncRNAs have been recognised as critical regulators in the development of hypertension [5, 6]. Previous cell experiments have shown that NR_027032 regulates the function of vascular endothelial cells and is thought to be involved in vascular development, cell cycle, chromatin modification and DNA damage response genes [7]. NR_034083 is believed to regulate the proliferation, migration and phenotypic changes of vascular smooth muscle cells by regulating cell responses mediated by angiogenesis II [8]. NR_104181 has been shown to mediate rolling adhesion in Ca2+ and Ca2+ + Mg2+ and firm adhesion in Mg2+ and Mn2+, mimicking the two key steps in leucocyte accumulation in the inflamed vasculature [9].
MiRNAs are involved in a variety of biological processes, including cellular proliferation, apoptosis and differentiation [10, 11]. As the most highly enriched miRNA in endothelial cells, miR-126 can modulate human vascular endothelial phenotype in vitro and is required for the maintenance of vascular integrity and angiogenesis in vivo with a zebrafish model [12]. These findings were further confirmed by in vivo experiments with transgenic mice [10]. MiR-143 and miR-145 are co-transcribed in multipotent murine cardiac progenitors before becoming localised to smooth muscle cells and have been shown to cooperatively regulate the proliferation of vascular smooth muscle cells in transgenic mouse models [11, 13].
Despite the important role of noncoding RNAs (ncRNAs, including lncRNAs and miRNAs) in the development of hypertension, their relative contributions to hypertension remain largely unknown. Previous studies in humans have demonstrated that miRNAs (miR-126, miR-143 and miR-145) are differentially expressed in hypertensive patients and healthy individuals, though the expression levels of these miRNAs are not consistent among different reports [1416]. There have been no previous studies on the expression levels of lncRNAs in hypertensive patient population samples. Thus, the goal of this study was to explore the relationship of cardiovascular disease risk factors and ncRNAs with essential hypertension (EH) in the population and propose countermeasures for this disease.

Methods

Study subjects

From November 2014 to June 2016, we performed a hospital-based case-control study on EH in Fujian Province, China. Participants were recruited from the First Affiliated Hospital of Fujian Medical University and the Affiliated People’s Hospital of Fujian University of Traditional Chinese Medicine. A total of 402 EH patients were included in the final analysis. Meanwhile, 402 healthy controls were randomly selected from the physical examination population in the same hospitals, and were frequency-matched by gender and age (±3 years) with cases. The disease-free status was ascertained according to the results of physical examination. Furthermore, 80 of the 402 EH patients and 80 of the 402 control individuals were selected by stratified random sampling method to donate venous blood samples for ncRNA expression analysis by quantitative real-time polymerase chain reaction (qPCR). Inclusion criteria for cases included patients with at least three consecutive records of systolic blood pressure ≥ 140 mmHg and/or diastolic blood pressure ≥ 90 mmHg or patients that have received antihypertensive medications for more than 3 months (European Society of Hypertension-European Society of Cardiology Guidelines, 2003). Inclusion criteria for controls included healthy individuals that have systolic blood pressure and diastolic blood pressure < 140 and < 90 mmHg, respectively. Exclusion criteria included a known history of leucopenia, thrombocytopenia or severe hepatic or renal dysfunction and evidence of an inflammatory or malignant disease. The protocol was approved by the ethics committee of Fujian Medical University School. Written informed consent was obtained from all patients and controls.

Questionnaire survey

The participants completed the questionnaire themselves following instructions given by the researchers. The completed questionnaire was checked by the researchers to ensure that all questions have been answered appropriately. Questions covered demographic characteristics (e.g. gender, age, marital status, education level and occupation), lifestyle habits (e.g. tobacco smoking, alcohol drinking, diet, exercise, anxiety and depression levels) and family history of hypertension. Smokers were defined as individuals who smoked cigarettes more than once a day consecutively for more than 6 months or smoked more than 100 cigarettes cumulatively [17]. Alcohol drinkers were defined as subjects who had consumed any alcoholic beverage at least once per week for a minimum of 6 months [17]. A bland diet was defined as light food with no or very little oil, sugar, salt and spicy ingredients [17]. Occupational physical activities were classified into three categories depending on the intensity, duration and frequency of the participant’s physical activity at work. Light occupational physical activity was defined as 75% of the time for sitting or standing and 25% of the time for standing activities, such as office workers, salesmen and hotel waiters; moderate occupational physical activity was defined as 25% of the time for sitting or standing and 75% of the time for special activities, such as students’ daily activities, driving and electrical installation; and heavy occupational physical activity was defined as 40% of the time for sitting or standing and 60% of the time for special occupation activities, such as non-mechanised farming, dancing and mining [17]. The participants’ personality was classified into four types: participants with type A personality were defined as those who were always in a rush, highly productive, impulsive, stubborn and impatient; participants with type B personality were defined as those who were always in a soothing and self-regulating state; participants with type C personality were defined as those who always suppressed their emotions and had too much negative emotional experience; and participants with type D personality were defined as those who had the tendency to experience increased negative emotions most of the time and not share these emotions with others because of fear of rejection or disapproval [17]. Active exercise was defined as exercise lasting for at least 20 min once a week, whereas passive exercise was defined as exercise lasting less than 20 min once a week or no exercise at all [17]. Anxiety and depression were self-rated according to a previous report [17]. The self-rating anxiety scale (SAS) was defined as follows: < 50 normal, 50–59 mild anxiety, 60–69 moderate anxiety and ≥ 70 severe anxiety. The self-rating depression scale (SDS) was defined as follows: < 53 normal, 53–62 mild anxiety, 63–73 moderate anxiety and ≥ 74 severe anxiety.

Physical examination

Systolic and diastolic blood pressure, height, weight and waist circumference (WC) were measured. Before blood pressure measurement, each subject was asked to not smoke, drink any beverage with caffeine or exercise for at least half an hour. After resting in a sitting position for 5 min, brachial blood pressure was measured three times with an interval of 2 min; the average of three readings was used for analysis [17]. Body mass index (BMI) was calculated as weight (kg) divided by the square of height in meters (m2) and categorised into four scales: < 18.5 underweight, 18.5–24.0 normal, 24.0–28.0 overweight and ≥ 28.0 obesity [17]. WC was classified into two categories: the waist of males < 85 cm or waist of females < 80 cm was considered normal, whereas waist of males ≥85 cm or waist of females ≥80 cm was considered abdominal obesity [17].

Blood samples

Blood samples were collected in a K2-EDTA-coated tube (BD Biosciences, California, USA) and centrifuged at 400 g for 10 min to remove plasma. According to the manufacturer’s instructions for the Lymphocyte Separation Medium (Hao Yang Biological Manufacture Co., Ltd., Tianjin, China), blood samples were carefully transferred into a new RNA-free tube for a second centrifugation at 400 g for 20 min to obtain the peripheral blood leucocytes and then stored at − 80 °C prior to RNA extraction. All blood samples were subjected to only one freeze-thaw cycle.

RNA extraction and qPCR

Total RNA was extracted from peripheral blood leucocytes using TRIzol reagent (Invitrogen, California, USA) and dissolved in RNase-free water. RNA extracts were quantified using NanoDrop 2000 instrument (Thermo Scientific, USA). The integrity of the RNA was determined by agarose gel electrophoresis. Reverse transcription of quantified RNA was performed using PrimeScript RT Reagent Kit with gDNA Eraser (lncRNAs) or the PrimeScript RT Reagent Kit (miRNAs) (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. qPCR was performed on the LightCycler 480 real-time PCR system (Roche, Switzerland) with the SYBR® Premix Ex Taq™ II kit (Takara Bio Inc., Shiga, Japan). Amplification curves were obtained by 40 cycles of 95 °C for 30 s, 95 °C for 5 s and 60 °C for 34 s, whereas dissolution curves were obtained by one cycle of 95 °C for 15 s, 60 °C for 1 min and 95 °C for 15 s. The Ct value was the fractional cycle number at which the fluorescence exceeded the given threshold. GAPDH and U6 were used as internal controls. The reverse primer used for miRNA was a universal downstream primer. LncRNA and miRNA expression levels were calculated using the 2-△△CT method [18]. The primers used for qPCR are listed in Table 1.
Table 1
List of the primers used for real time-PCR experiments
Noncoding RNAs
Oligo Name
Sequence (5′ to 3′)
GAPDH
Forward primer
GGACTCATGACCACAGTCCATGCC
Reverse primer
TCAGGGATGACCTTGCCCACAG
NR_027032
Forward primer
GTCCTCCACTCCACCTCAAA
Reverse primer
TGAGTTCCTGATCGTGTCCA
NR_034083
Forward primer
GGCTTCTAATCCGCCCTATC
Reverse primer
CAATGACCCAAGGCAAATTC
NR_104181
Forward primer
CCATTCAGCTTTCACCATGTGC
Reverse primer
ACCTTCAGGCGAGTCCAGATT
U6
Forward primer
GCTTCGGCAGCACATATACTAA
Reverse primer
AACGCTTCACGAATTTGCGT
miR-126
RT primer
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT
Forward primer
GCGGCGGTCGTACCGTGAGTAA
miR-143
RT primer
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAGCTA
Forward primer
GCGGCGGTGAGATGAAGCACTG
miR-145
RT primer
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAT
Forward primer
GCGGCGGGTCCAGTTTTCCCAG
Universal downstream primer
Reverse primer
ATCCAGTGCAGGGTCCGAGG

Statistical analysis

All data were analysed using SPSS 22.0 (SPSS Inc., Chicago, IL, USA). Comparisons between the case and control groups were performed using a Z-test or Chi-square analysis. Multiple factor logistic regression was used to analyse whether lncRNAs and miRNAs were influencing factors of EH. All tests were two sided and a P value < 0.05 was considered statistically significant.

Results

Characteristics of the study population

Associations between demographic characteristics and EH are shown in Table 2. No significant difference was found in the general demographic characteristics between the case and control groups, including gender, age, marital status, education and occupation (all P > 0.05), indicating that the frequency matching was adequate. Associations between risk factors and EH are shown in Table 3. Compared with controls, EH patients had a lower bland diet rate (61.2% versus 75.6%, χ 2 test, P <  0.001), higher abdominal obesity rate (84.0% versus 64.7%, χ 2 test, P <  0.001) and higher family history of hypertension rate (47.0% versus 19.5%, χ 2 test, P <  0.001). Significant differences were found between cases and controls in the occupational physical activities, personality types, anxiety levels and body mass indices.
Table 2
Demographic characteristics of hypertensive patients and control subjects
Characteristics
Hypertensive patients
(n = 402)
Controls (n = 402)
χ 2
P
Gender
Male
187 (46.5)
187 (46.5)
0.000
1.000
Female
215 (53.5)
215 (53.5)
  
Age group (years)
<  45
22 (5.5)
22 (5.5)
0.000
1.000
45–65
216 (53.7)
216 (53.7)
  
≥ 65
164 (40.8)
164 (40.8)
  
Marital status
Single
4 (1.0)
2 (0.5)
0.850
0.660
Married
363 (90.5)
369 (91.8)
  
Divorce/widowed
34 (8.5)
31 (7.7)
  
Education level
Elementary degree and below
148 (36.8)
133 (33.2)
3.178
0.365
Secondary degree
101 (25.1)
123 (30.7)
  
Senior/technical secondary degree
104 (25.9)
99 (24.7)
  
Associate degree and above
49 (12.2)
46 (11.5)
  
Occupation
Worker
69 (17.3)
77 (19.2)
0.646
0.886
Farmer
29 (7.3)
26 (6.5)
  
Retired personnel
181 (45.3)
177 (44.0)
  
Other occupation
121 (30.3)
122 (30.3)
  
Data are presented as n (%)
Table 3
Comparison of risk factors between hypertensive patients and healthy controls
Risk factors
Hypertensive patients (n = 402)
Controls (n = 402)
χ 2
P
Smoking
Yes
87 (21.6)
102 (25.4)
1.556
0.212
No
315 (78.4)
300 (74.6)
  
Drinking
Yes
55 (13.7)
55 (13.7)
0.000
1.000
No
347 (86.3)
347 (86.3)
  
Bland diet
Yes
246 (61.2)
304 (75.6)
19.360
<  0.001
No
156 (38.8)
98 (24.4)
  
Occupational physical activities
Light
187 (46.5)
143 (35.6)
10.451
0.005
Moderate
160 (39.8)
200 (49.8)
  
Heavy
55 (13.7)
59 (14.7)
  
Exercise
< once/week
211 (52.5)
197 (49.0)
3.157
0.206
1–2 times/week
14 (3.5)
24 (6.0)
  
≥ 3 times/week
177 (44.0)
181 (45.0)
  
Personality type
A type
139 (34.6)
88 (21.9)
17.436
0.001
B type
234 (58.2)
284 (70.6)
  
C type
22 (5.5)
26 (6.5)
  
D type
7 (1.7)
4 (1.0)
  
Anxiety level
Normal
227 (56.5)
290 (72.3)
23.534
<  0.001
Mild
140 (34.8)
95 (23.7)
  
Moderate
31 (7.7)
15 (3.7)
  
Severe
4 (1.0)
1 (0.2)
  
Depression level
Normal
241 (60.0)
251 (62.4)
1.670
0.684
Mild
119 (29.6)
104 (25.9)
  
Moderate
40 (10.0)
44 (10.9)
  
Severe
2 (0.5)
3 (0.7)
  
Body mass index
<  18.50
8 (2.0)
23 (5.7)
46.103
<  0.001
18.50–23.99
159 (39.6)
231 (57.5)
  
24.00–27.99
177 (44.0)
127 (31.6)
  
≥ 28.00
58 (14.4)
21 (5.2)
  
Abdominal obesity
Yes
336 (84.0)
260 (64.7)
39.221
<  0.001
No
64 (16.0)
142 (35.3)
  
Family history of hypertension
Yes
189 (47.0)
78 (19.5)
68.349
<  0.001
No
213 (53.0)
322 (80.5)
  
Data are presented as n (%)

LncRNAs and MiRNAs were differentially expressed in hypertensive patients and controls

When lncRNA levels between hypertensive patients and controls were compared, we found that NR_027032 (Z-test = − 2.439, P = 0.015) and NR_034083 (Z-test = − 2.890, P = 0.004) were significantly reduced, whereas NR_104181 (Z-test = − 2.685, P = 0.007) was significantly elevated in hypertensive patients compared with controls (Table 4). When miRNA levels between hypertensive patients and controls were compared, we found that miR-143 (Z-test = − 2.797, P = 0.005) and miR-145 (Z-test = − 2.436, P = 0.015) were up-regulated in hypertensive patients compared with controls, whereas miR-126 level (Z-test = − 1.679, P = 0.093) was not significantly different between hypertensive patients and controls (Table 4).
Table 4
Relative expression levels of lncRNAs and miRNAs in hypertensive patients and healthy controls (P 50 (P 25, P 75 ))
RNAs
Hypertensive patients (n = 80)
Controls (n = 80)
Z-test
P
NR_027032
0.839 (0.402, 1.485)
1.312 (0.493, 1.923)
−2.439
0.015
NR_034083
0.714 (0.513, 1.100)
0.940 (0.693, 1.588)
−2.890
0.004
NR_104181
1.946 (0.880, 3.013)
1.253 (0.568, 2.275)
−2.685
0.007
miR-126
1.751 (0.854, 2.904)
1.229 (0.548, 2.340)
−1.679
0.093
miR-143
1.796 (0.644, 3.470)
1.013 (0.420, 1.984)
−2.797
0.005
miR-145
1.708 (0.758, 2.945)
1.022 (0.585, 2.064)
−2.436
0.015

NR_034083 was a protective factor for EH whereas NR_104181 and miR-143 were risk factors

We used EH as the dependent variable (0 = no, 1 = yes) and bland diet, occupation physical activities, personality type, anxiety level, BMI, abdominal obesity and family history of hypertension as independent variables for multivariate logistic regression analysis (assignment results are shown in Table 5, wherein personality type and BMI were used as dummy variables). After adjusting the demographic and environmental factors, logistic analysis showed that lower expression levels of NR_034083 (OR = 0.528, 95% CI = 0.322–0.866) were a protective factor against hypertension, whereas higher expression levels of NR_104181 (OR = 1.651, 95% CI = 1.164–2.342) and miR-143 (OR = 1.538, 95% CI = 1.182–2.000) were risk factors (Table 6).
Table 5
Multivariate analysis variables and assignment
Variables
Assignment
0
1
2
3
Bland diet
No
Yes
  
Occupational physical activities
Light
Moderate
Heavy
 
Personality type
B type (0.0.0)
A type (1.0.0)
C type (0.1.0)
D type (0.0.1)
Anxiety level
Normal
Mild
Moderate
Severe
Body mass index
18.50–23.99 (0.0.0)
<  18.50 (1.0.0)
24.00–27.99 (0.1.0)
≥ 28.00 (0.0.1)
Abdominal obesity
No
Yes
  
Family history of hypertension
No
Yes
  
Table 6
Multivariate logistic regression analysis of factors influencing the risk of hypertension
 
OR
95% CI of OR
P value
Anxiety
2.737
1.344–5.574
0.006
Family history of hypertension
3.842
1.142–12.929
0.030
NR_104181
1.651
1.164–2.342
0.005
NR_034083
0.528
0.322–0.866
0.011
miR-143
1.538
1.182–2.000
0.001

Discussion

In this case-control study, we first assessed the effects of common cardiovascular disease risk factors on hypertension in Fuzhou, China. Our study found that anxiety, BMI, abdominal obesity and family history of hypertension were risk factors for hypertension, whereas bland diet and occupational physical activities were protective factors for hypertension. Among the common risk factors, we found that higher levels of anxiety were associated with higher risk of hypertension. Anxiety may decrease the sensitivity of pressure reflex, leading to an increase of blood vessel tension and blood pressure as has been hypothesised previously [19].
In this study, we also assessed the association of six ncRNAs with hypertension and found that NR_027032 and NR_034083 were significantly reduced in hypertensive patients compared with control subjects. However, NR_104181, miR-143 and miR-145 were elevated in hypertensive patients compared with controls. After adjusting the demographic and environmental factors, multivariate analysis showed that lower expression levels of NR_034083 and higher expression levels of NR_104181 and miR-143 were risk factors for hypertension. In this study, the higher expression levels of miR-143 and miR-145 in hypertensive patients than in controls concur with previous reports from Paola Caruso et al. [14] and Santovito et al. [15] but are contradictory to the observations by Kontaraki et al. [16]. The absence of a significant difference in miR-126 expression levels between hypertensive patients and controls in our study is consistent with the report of Corsten et al. [20] but contrasts the report of Kontaraki et al. [21]. The reasons for these discrepancies are unclear but may be related to different blood samples (plasma [16], peripheral blood mononuclear cells [14, 21], peripheral blood leucocytes, peripheral total blood [20] and atherosclerotic plaques [15]), different disease processes (treated [15, 20] and untreated [16, 21] EH patients), different patient populations or undefined environmental factors. Clearly, further studies are needed to clarify these discrepancies.
Most importantly, we demonstrated for the first time that lncRNAs, similar to some miRNAs, are differentially expressed in hypertensive patients and healthy individuals, supporting their roles in the risk of human hypertension. The reduction of NR_034083 expression in hypertensive patients compared with controls suggests that this ncRNA is possibly a protective factor for hypertension. In support of this hypothesis, animal studies have demonstrated that NR_034083 is involved in negatively regulating angiotensin II [8], thereby leading to the development of hypertension. The up-regulation of NR_104181 expression in hypertensive patients suggests that this ncRNA is possibly a risk factor for hypertension, consistent with previous studies showing that NR_104181 can activate the function of lymphocytes, releasing a variety of inflammatory mediators to cause vascular dysfunction, including vasoconstriction, sodium and water retention and inhibiting the decrease of blood pressure [9, 22, 23].
Several limitations in our study need to be addressed. Firstly, recall bias was inevitable in this case-control study. However, it did not affect the ncRNA expression levels. Thus, it has a limited impact in studying epigenetic-disease association. Secondly, in the present study, blood samples collected can only present a single time point expression of lncRNAs or miRNAs. Thus, we did not look at the variability of the ncRNA expression level at different time points or under different conditions from the same individual [24]. Further mechanistic studies are needed to determine how these ncRNAs play their roles in hypertension. In addition, though the ncRNAs surveyed in this study, especially miR-126, miR-143 and miR-145, are known to be highly expressed in vascular endothelial and smooth muscle cells [14, 15], they might serve as attractive novel diagnostic biomarkers in peripheral blood leucocytes for human diseases.

Conclusions

Our findings support previous observations of the effects of common cardiovascular disease risk factors on hypertension. In addition, our study demonstrated for the first time that lncRNAs (NR_027032, NR_034083, NR_104181), similar to some miRNAs, are differentially expressed in hypertensive patients and healthy individuals, supporting their roles in the pathogenesis of EH.

Acknowledgements

The authors would like to thank the doctors and patients for their support and cooperation in sample collection and questionnaire completion.

Funding

This study was supported by the Training Project for Young- and Middle-Aged Talents of the Fujian Province’s Health System, China (grant No. 2014-ZQN-ZD-24), the Local College and University Development Foundation of the Central Government (grant No. 1003–03900130-15), and the Natural Science Foundation of Fujian Province (grant No. 2015J01674).

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
This study was approved by the ethics committee of Fujian Medical University School. Written informed consent was obtained from all patients and controls.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Whitworth JA. 2003 World Health Organization (WHO)/International Society of Hypertension (ISH) statement on management of hypertension. J Hypertens. 2003;21:1983–92.CrossRefPubMed Whitworth JA. 2003 World Health Organization (WHO)/International Society of Hypertension (ISH) statement on management of hypertension. J Hypertens. 2003;21:1983–92.CrossRefPubMed
2.
Zurück zum Zitat Yao QP, Xie ZW, Wang KX, Zhang P, Han Y, Qi YX, et al. Profiles of long noncoding RNAs in hypertensive rats: long noncoding RNA XR007793 regulates cyclic strain-induced proliferation and migration of vascular smooth muscle cells. J Hypertens. 2017;35:1195–203.CrossRefPubMed Yao QP, Xie ZW, Wang KX, Zhang P, Han Y, Qi YX, et al. Profiles of long noncoding RNAs in hypertensive rats: long noncoding RNA XR007793 regulates cyclic strain-induced proliferation and migration of vascular smooth muscle cells. J Hypertens. 2017;35:1195–203.CrossRefPubMed
3.
Zurück zum Zitat Zhang R, Sui L, Hong X, Yang M, Li W. MiR-448 promotes vascular smooth muscle cell proliferation and migration in through directly targeting MEF2C. Environ Sci Pollut Res Int. 2017;24:22294–300.CrossRefPubMed Zhang R, Sui L, Hong X, Yang M, Li W. MiR-448 promotes vascular smooth muscle cell proliferation and migration in through directly targeting MEF2C. Environ Sci Pollut Res Int. 2017;24:22294–300.CrossRefPubMed
4.
Zurück zum Zitat Roosbroeck KV, Pollet J, Calin GA. miRNAs and long non-coding RNAs as biomarkers in human diseases. Expert Rev Mol Diagn. 2013;13:183–204.CrossRefPubMed Roosbroeck KV, Pollet J, Calin GA. miRNAs and long non-coding RNAs as biomarkers in human diseases. Expert Rev Mol Diagn. 2013;13:183–204.CrossRefPubMed
5.
Zurück zum Zitat Sun L, Goff LA, Trapnell C, Alexander R, Lo KA, Hacisuleyman E, et al. Long noncoding RNAs regulate adipogenesis. Proc Natl Acad Sci U S A. 2013;110:3387–92.CrossRefPubMedPubMedCentral Sun L, Goff LA, Trapnell C, Alexander R, Lo KA, Hacisuleyman E, et al. Long noncoding RNAs regulate adipogenesis. Proc Natl Acad Sci U S A. 2013;110:3387–92.CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat Yu J, Cai Y, Liu Y, Yang Y, Chen Y, Jose PA, et al. 1A.07: genome-wide profiling of long noncoding Rna expression patterns in thoracic aorta from spontaneously hypertensive rats. J Hypertens. 2015;33(Suppl 1):e2.CrossRefPubMed Yu J, Cai Y, Liu Y, Yang Y, Chen Y, Jose PA, et al. 1A.07: genome-wide profiling of long noncoding Rna expression patterns in thoracic aorta from spontaneously hypertensive rats. J Hypertens. 2015;33(Suppl 1):e2.CrossRefPubMed
7.
Zurück zum Zitat Kurian L, Aguirre A, Sancho-Martinez I, Benner C, Hishida T, Nguyen TB, et al. Identification of novel long non-coding RNAs underlying vertebrate cardiovascular development. Circulation. 2015;131:1278–90.CrossRefPubMedPubMedCentral Kurian L, Aguirre A, Sancho-Martinez I, Benner C, Hishida T, Nguyen TB, et al. Identification of novel long non-coding RNAs underlying vertebrate cardiovascular development. Circulation. 2015;131:1278–90.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Leung A, Trac C, Jin W, Lanting L, Akbany A, Sætrom P, et al. Novel long noncoding RNAs are regulated by angiotensin II in vascular smooth muscle cells. Circ Res. 2013;113:266–78.CrossRefPubMedPubMedCentral Leung A, Trac C, Jin W, Lanting L, Akbany A, Sætrom P, et al. Novel long noncoding RNAs are regulated by angiotensin II in vascular smooth muscle cells. Circ Res. 2013;113:266–78.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Chen J, Salas A, Springer TA. Bistable regulation of integrin adhesiveness by a bipolar metalion cluster. Nat Struct Biol. 2003;10:995–1001.CrossRefPubMed Chen J, Salas A, Springer TA. Bistable regulation of integrin adhesiveness by a bipolar metalion cluster. Nat Struct Biol. 2003;10:995–1001.CrossRefPubMed
10.
Zurück zum Zitat Wang S, Aurora AB, Johnson BA, Qi X, McAnally J, Hill JA, et al. The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Dev Cell. 2008;15:261–71.CrossRefPubMedPubMedCentral Wang S, Aurora AB, Johnson BA, Qi X, McAnally J, Hill JA, et al. The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Dev Cell. 2008;15:261–71.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Owens GK, Kumar MS, Wamhoff BR. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol Rev. 2004;84:767–801.CrossRefPubMed Owens GK, Kumar MS, Wamhoff BR. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol Rev. 2004;84:767–801.CrossRefPubMed
12.
Zurück zum Zitat Fish JE, Santoro MM, Morton SU, Yu S, Yeh RF, Wythe JD, et al. miR-126 regulates angiogenic signaling and vascular integrity. Dev Cell. 2008;15:272–84.CrossRefPubMedPubMedCentral Fish JE, Santoro MM, Morton SU, Yu S, Yeh RF, Wythe JD, et al. miR-126 regulates angiogenic signaling and vascular integrity. Dev Cell. 2008;15:272–84.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, et al. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. Nature. 2009;460:705–10.PubMedPubMedCentral Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, et al. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. Nature. 2009;460:705–10.PubMedPubMedCentral
14.
Zurück zum Zitat Caruso P, Dempsie Y, Stevens HC, McDonald RA, Long L, Lu R, et al. A role for miR-145 in pulmonary arterial hypertension: evidence from mouse models and patient samples. Circ Res. 2012;111:290–300.CrossRefPubMed Caruso P, Dempsie Y, Stevens HC, McDonald RA, Long L, Lu R, et al. A role for miR-145 in pulmonary arterial hypertension: evidence from mouse models and patient samples. Circ Res. 2012;111:290–300.CrossRefPubMed
15.
Zurück zum Zitat Santovito D, Mandolini C, Marcantonio P, De Nardis V, Bucci M, Paganelli C, et al. Overexpression of microRNA-145 in atherosclerotic plaques from hypertensive patients. Expert Opin Ther Targets. 2013;17:217–23.CrossRefPubMed Santovito D, Mandolini C, Marcantonio P, De Nardis V, Bucci M, Paganelli C, et al. Overexpression of microRNA-145 in atherosclerotic plaques from hypertensive patients. Expert Opin Ther Targets. 2013;17:217–23.CrossRefPubMed
16.
Zurück zum Zitat Kontaraki JE, Marketou ME, Zacharis EA, Parthenakis FI, Vardas PE. Differential expression of vascular smooth muscle-modulating microRNAs in human peripheral blood mononuclear cells: novel targets in essential hypertension. J Hum Hypertens. 2014;28:510–6.CrossRefPubMed Kontaraki JE, Marketou ME, Zacharis EA, Parthenakis FI, Vardas PE. Differential expression of vascular smooth muscle-modulating microRNAs in human peripheral blood mononuclear cells: novel targets in essential hypertension. J Hum Hypertens. 2014;28:510–6.CrossRefPubMed
17.
Zurück zum Zitat Liu LS. 2010 Chinese guidelines for the management of hypertension. Zhonghua Xin Xue Guan Bing Za Zhi. 2011;39:579–615.PubMed Liu LS. 2010 Chinese guidelines for the management of hypertension. Zhonghua Xin Xue Guan Bing Za Zhi. 2011;39:579–615.PubMed
18.
Zurück zum Zitat Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-△△CT method. Methods. 2001;25:402–8.CrossRefPubMed Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-△△CT method. Methods. 2001;25:402–8.CrossRefPubMed
19.
Zurück zum Zitat Wang DQ, Center CE, College JM. Effect of anxiety depression on ambulatory blood pressure in elderly hypertension patients. Chin J Geriatr Heart Brain Vessel Dis. 2014;16:723–5. Wang DQ, Center CE, College JM. Effect of anxiety depression on ambulatory blood pressure in elderly hypertension patients. Chin J Geriatr Heart Brain Vessel Dis. 2014;16:723–5.
20.
Zurück zum Zitat Corsten MF, Dennert R, Jochems S, Kuznetsova T, Devaux Y, Hofstra L, et al. Circulating MicroRNA-208b and MicroRNA-499 reflect myocardial damage in cardiovascular disease. Circ Cardiovasc Genet. 2010;3:499–506.CrossRefPubMed Corsten MF, Dennert R, Jochems S, Kuznetsova T, Devaux Y, Hofstra L, et al. Circulating MicroRNA-208b and MicroRNA-499 reflect myocardial damage in cardiovascular disease. Circ Cardiovasc Genet. 2010;3:499–506.CrossRefPubMed
21.
Zurück zum Zitat Kontaraki JE, Marketou ME, Zacharis EA, Parthenakis FI, Vardas PE. MicroRNA-9 and microRNA-126 expression levels in patients with essential hypertension: potential markers of target-organ damage. J Am Soc Hypertens. 2014;8:368–75.CrossRefPubMed Kontaraki JE, Marketou ME, Zacharis EA, Parthenakis FI, Vardas PE. MicroRNA-9 and microRNA-126 expression levels in patients with essential hypertension: potential markers of target-organ damage. J Am Soc Hypertens. 2014;8:368–75.CrossRefPubMed
22.
Zurück zum Zitat Harrison DG, Gongora MC. Oxidative stress and hypertension. Med Clin N Am. 2007;93:621–35.CrossRef Harrison DG, Gongora MC. Oxidative stress and hypertension. Med Clin N Am. 2007;93:621–35.CrossRef
23.
Zurück zum Zitat Guzik TJ, Hoch NE, Brown KA, McCann LA, Rahman A, Dikalov S, et al. Role of the T cell in the genesis of angiotensin Ang II-induced hypertension and vascular dysfunction. J Exp Med. 2007;204:2449–60.CrossRefPubMedPubMedCentral Guzik TJ, Hoch NE, Brown KA, McCann LA, Rahman A, Dikalov S, et al. Role of the T cell in the genesis of angiotensin Ang II-induced hypertension and vascular dysfunction. J Exp Med. 2007;204:2449–60.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Kane NM, Meloni M, Spencer HL, Craig MA, Strehl R, Milligan G, et al. Derivation of endothelial cells from human embryonic stem cells by directed differentiation: analysis of microRNA and angiogenesis in vitro and in vivo. Arterioscler Thromb Vasc Biol. 2010;30:1389–97.CrossRefPubMed Kane NM, Meloni M, Spencer HL, Craig MA, Strehl R, Milligan G, et al. Derivation of endothelial cells from human embryonic stem cells by directed differentiation: analysis of microRNA and angiogenesis in vitro and in vivo. Arterioscler Thromb Vasc Biol. 2010;30:1389–97.CrossRefPubMed
Metadaten
Titel
Relationship of cardiovascular disease risk factors and noncoding RNAs with hypertension: a case-control study
verfasst von
Shiying Chen
Rong Chen
Tingxing Zhang
Shaowei Lin
Zhou Chen
Bi Zhao
Huangyuan Li
Siying Wu
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
BMC Cardiovascular Disorders / Ausgabe 1/2018
Elektronische ISSN: 1471-2261
DOI
https://doi.org/10.1186/s12872-018-0795-3

Weitere Artikel der Ausgabe 1/2018

BMC Cardiovascular Disorders 1/2018 Zur Ausgabe

Update Kardiologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.