Background
The melanoma-associated antigen (MAGE) is one of the well-characterized members of the CTA family that contains at least 60 closely related proteins [
1], including MAGE-A, B, C, D, E, F, G, H, L2, Necidin, I and J. According to the protein expression patterns and functions, the MAGE family has been divided into groups I and II [
2,
3]. Group I proteins, including MAGEs A, B and C, are expressed in many types of tumor tissues, but are not expressed in normal tissues [
1]. Moreover, their expression is closely correlated with aggressive clinical course, the acquisition of resistance to chemotherapy, the occurrence, and poor clinical outcomes [
1,
3,
4]. Contrast to group I proteins, Group II proteins, such as Necdin and Mage-D1, are universally expressed in all normal tissues but rarely in tumor tissues [
5]. They are more likely associated with cell growth inhibition, cell cycle arrest, apoptosis, or cell differentiation [
6]. For example, Necdin has been shown to be down-regulated in both carcinoma cell lines and primary tumors [
7-
9], suggesting Necdin is a potent tumor growth suppressor. Ectopic overexpression of Necdin in a mouse tumor cell line is reported to attenuate tumorigenicity and metastasis
in vivo [
10]. In addition, MAGE-D1 inhibited cell proliferation, migration and invasion of multiple human cancer cells [
11]. Although Group II proteins emerge as novel tumor suppressor candidates in a wide range of human cancers, their roles in cancers remain poorly defined.
Restin belongs to MAGE Group II proteins and is known as MAGE H1 [
12]. Restin was firstly cloned from the differentiated HL-60 cells induced by all-trans retinoic acid (ATRA) [
13], an apoptosis and differentiation inducer. Bioinformatics analysis showed that Restin shared 49% homology with Necdin [
14] and both of them were basic proteins. Further analysis found that Restin, Necdin and Mage-D1 had an alkaline conservative region, which is lowly expressed in tumor tissues [
14]. Above data indicated that, similar to Necdin and Mage-D1, Restin belongs to Group II proteins. Bioinformatics data from GEO profiles show that Restin is rarely expressed in a variety of cancer cells, while its expression level is pretty high in normal cells. Restin was identified as one of pro-apoptotic genes that determined the response of multiple tumor cells to CD95-mediated apoptosis [
15]. Fu HY et al. found that Restin overexpression in Hela cells promoted apoptosis [
16]. Denis Selimovic et al. disclosed that Restin overexpression induced apoptosis of melanoma cells via interacting with p75 neurotrophin receptor (p75NTR), leading to the disruption of both NF-ƘB and extracellular signal-regulated kinase (ERK) pathways [
12]. Thus, Restin may function as a tumor suppressor, which is similar to Necdin and Mage-D1. Nevertheless, little information is available on its expression patterns and functions, particularly its roles in tumorigenesis
in vitro and
in vivo.
The epithelial-mesenchymal transition (EMT) and the reverse process, termed the mesenchymal-epithelial transition (MET), play critical roles in embryogenesis, wound healing, tissue fibrosis, and carcinoma progression [
17-
20]. EMT is known to be a central mechanism responsible for invasiveness and metastasis of a variety of cancers [
19-
21]. During tumor development, epithelial cells undergo dynamic cytoskeletal rearrangement, and lose cell adhesion and epithelial components while acquiring mesenchymal and migratory phenotypes [
20,
22]. Therefore, targeting EMT may serve as an efficient strategy for the treatment of malignant and metastatic tumors.
Our present study, for the first time, demonstrated that Restin remarkably suppressed breast cancer metastasis through inhibiting EMT by controlling the expression and function of the tumor metastasis suppressor mir-200a/b via association with p73 in breast cancer cells.
Discussion
MAGE group II proteins function as putative tumor suppressors in a variety of cancers [
5,
6]. However, its clinical effects on tumor development and the underlying mechanisms are poorly characterized. Restin is a novel member of MAGE group II proteins [
12]. Selimovic et al. demonstrated Restin induced apoptosis of melanoma cells via interaction with p75 neurotrophin receptor [
12]. Wang et al. showed that p53 upregulated Restin expression at the transcriptional level [
31]. All current data hint that Restin may be involved in tumor cell growth. Nevertheless, the molecular mechanisms underlying the repression of Restin in tumor cells and its role in tumor development had not been reported yet. Here, we, for the first time, showed that Restin suppressed EMT and lung metastasis by activating the transcription of mir-200b/a via association with p73. Considering the pivotal roles of mir-200b/a and p73 in tumorigenesis, our studies provide significant insights that Restin may participate in other functions closely related to mir-200b/a and p73, such as EMT, cancer stem cells, tumor angiogenesis and drug resistance.
mir-200 family plays critical roles in tumor development and progression through inhibiting EMT and suppressing tumor invasion by directly repressing the transcription factors ZEB1 and ZEB2 [
23,
28,
32,
33]. Previous works on mir-200 regulation have largely focused on mechanisms of transcriptional inhibition, epigenetic modification and transcriptional activation of this miRNA family, and identified multiple factors regulating mir-200 expression, including ZEB1, ZEB2, HDAC, p53 family [
32]. Our study demonstrated that Restin upregulated mir-200 expression at the transcriptional level, indicating Restin may serve as a novel regulator of mir-200. However, Restin-mediated upregulation of mir-200b/a/429 was dependent on p53 binding site in its promoter, indicating p53 family members (p53, p63, p73) are involved in above process. p53 suppresses EMT by transactivating the expression of mir-200 family members in primary hepatocellular carcinomas (HCCs) and 9 HCC cell lines [
34]. Simlar to p53, p73 and p63 can directly associate with the mir-200b/a/429 promoter and activate mir-200 transcription in ovarian carcinoma cells [
35]. Although MDA-MB-231 cells or MDA-MB-157 cells possess mutant p53 or no p53 expression, Restin still activated mir-200b/a/429 transcription, indicating p53 protein may not participate in above process and Restin may not associate with p53. Our hypothesis was proven by our data showing that no endogenous interaction between Restin and p53 was found. By performing Co-IP experiment, we found that Restin can closely interact with p73. Moreover, p73 knockdown diminished Restin-mediated regulation on mir-200a/b and ZEB1/2. Thus, our observations provide new insights into the role of p53 family members in mediating Restin’s function in tumorigenicity.
Based on the chromosomal locations, the mir-200 family can be divided into two clusters: the mir-200b/a/429 cluster containing mir-200a, mir-200b and mir-429, and the mir-200c/141 cluster, which contains mir-200c and mir-141 [
32]. Although both clusters contained putative p53 binding sites, Restin drove mir-200b/a/429 transcription rather than that of mir-200c/141 via association with p73. Interestingly, a recent report found that in mammary epithelial cells, p53 serves as a transcriptional activator of mir-200c/141, but not of the mir-200b/a/429 [
36]. We speculate that the transcription of mir-200 clusters by p53 family members may be dependent on the expression level and functions of p53 family members, the promoter methylation status of mir-200 promoters or other transcriptional co-factors, which need to be further elucidated.
p53 is involved in tumor initiation as well as tumor progression [
37-
39]. However, deletions or mutations of p53 are frequently found in cancers [
39-
43]. p63 and p73 are rarely mutated in a large number of tumors examined to date [
42]. Therefore, in the absence of p53, these proteins may be involved in the control of the ZEB/mir-200 equilibrium and EMT-MET plasticity. Our data showed that Restin interacted with p73 rather than p53 and upregulated mir-200b/a expression even in p53 mutant cells. Our results shed light on the transcriptional regulation of Restin on mir-200s, which has potential therapeutic value in the development of approaches aimed at modifying mir-200s expression for the treatment of diverse forms of human cancers, especially those cancers with p53 mutation.
Restin was identified from HL-60 cells induced by all-trans-retinoic acid (ATRA). Restin expression level was undetectable in HL-60 cells, whereas its level was sharply increased upon ATRA treatment [
13,
14]. Consistently, we observed that Restin expression was pretty high in normal breast epithelial cells compared to breast cancer cells. Its expression in low-metastatic cells was higher than that in high-metastatic cells, hinting that Restin expression level is negatively related to tumor cell malignancy. Our data was supported by current evidence showing that Necdin, another member of MAGE group II proteins, was expressed at a low level in MDA-MB-468 and MDA-MB-231 cells, but exhibited much higher levle in low-metastatic MCF-7 cells [
8]. Contrast to Restin and Necdin, MAGE-A and C, belong to MAGE group I proteins, exerted an oncogenic role in breast cancer and exhibited a positive correlation with tumor malignancy [
1,
3,
4]. Considering the undetectable expression of Restin in high-metastatic MDA-MB-231 cells and the dramatic inhibition of tumor metastasis by Restin overexpression, we hypothesize that Restin may function as a tumor-suppressor in breast cancers. Our ongoing studies are being performed to detect Restin expression in normal breast tissues, para-carcinoma tissues and carcinoma tissues and to statistically analyze the association of its expression level with tumor malignant grade, tumor metastasis, relapse, and clinical prognosis, which will strongly support our hypothesis.
Materials and methods
Cell culture and reagents
MCF-7, MDA-MB-157, MDA-MB-231 and MDA-MB-451 breast cancer cells were grown in Dulbecco’s modified Eagle’s medium (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO2. MCF-10A, a spontaneously immortalized human breast epithelial cell line, was maintained in DMEM/F12 medium (Invitrogen Life Technologies, Carlsbad, CA). Human mammary epithelial cells (HMEC) were cultured in mammary epithelial cell complete medium (Invitrogen). All cell lines were obtained from the ATCC. p73 and ZEB1 siRNAs (Stealth™ siRNAs) were synthesized from Invitrogen and were dissolved in DEPC-treated H2O at a concentration of 20 pmol/μl as a stock.
Generation of Restin overexpression and knockdown stable cell lines
Restin coding region was amplified by PCR using MCF-7 cDNA as a template and inserted into PmeI restriction enzyme sites of pWPI-GFP lentivirus expression vector by using the following primers: 5’-gtacgtttaaacatgcctcgggagcgaaagag-3’ and 5’-gatcgtttaaacttaaggggcggaataacccc-3’. siRNA duplexes targeting Restin were annealed and inserted into Mlu1 and Cla1 restriction enzyme sites of pLVTHM-GFP lentivirus expression vector. Forward: 5’-cgcgtcccc ggaatcgagcaaactgaaattcaagagatttcagtttgctcgattcctttttggaaat-3’; Reverse: 5’-cgatttccaaaaaggaatcgagcaaactgaaatctcttgaatttcagtttgctcgattccgggga-3’. The PCR products were confirmed by sequencing. Lentivirus were produced according to the manufacture’s instruction. MCF-7 and MDA-MB-231 cells were seeded onn 6-well plates and transduced with 10 μl lentivirus. 24 h later, transfected cells were trypsinized and reseeded into 10-cm culture plates. We refer to these cells in the text as Control and Restin (overexpression), si-Control and si-Restin (knockdown).
Constructs
The following plasmids were bought from Addgene (Cambridge, MA). mir-200b-200a-429 promoter (Plasmid 35539: pGL3-1574/+120), mir-200c-141 (Plasmid 35534), ZEB1 3’UTR (Plasmid 35535: pCI-neo-RL-ZEB1), ZEB1 3’UTR with mutation in mir-200b seeding region (Plasmid 35537: pCI-neo-RL-ZEB1 200bmutx5). ZEB1 promoter plasmid (HPRM23421) was bought from GeneCopoeia (Rockville, MD). 2000 bp of mir-200c–141 promoter region was amplified and inserted into pGL3 vector using Nhe I and Bgl II sites. A series of mir-200 promoter truncations were amplified by using mir-200 promoter plasmid (pGL3-1574/+120) as a template and cloned into the pGL3-basic (Promega) reporter using Nhe I and Bgl II sites. The primer sequences were as follows: pGL3-1000/+120: forward, 5’-gtgctagcGAAAACCGTGGGGTCCGCTG-3’; pGL3-200/+120: forward, 5’-acgctagcAAGGTGGGGGCGGGACGGAG-3’; reverse, 5’-ctagatctCCTGGCACAGGAAGTCAGTTC-3’. Mutation in the p53 binding site was made by using the Quikchange Multi site–directed mutagenesis kit (Stratagene, La Jolla, CA) using the primer pairs 5’-CCAGCTCCCAGGTTTTTCCCGCCG -3’ and 5’-CGGCGGGAAAAACCTGGGAGCTGG-3’ (p53 mutant) (the mutation sites were shown in bold) . Restin and p73 coding regions were amplified using MCF-7 cDNA as a template and inserted into our previously recombined pcDNA3.1 (+)-flag and pcDNA3.1 (+)-his vectors, respectively.
In vivo animal experiments
NOD/SCID mice were purchased from Beijing HFK Bioscience CO., LTD (Bejing, China). All animal experiments were performed under the approval of Institutional Animal Care and Use Committee (IACUC) at Henan Cancer Hospital (Permit No: 2014ct001). 1 × 106 MDA-MB-231 cells were resuspended in 20 μl PBS and subcutaneously injected into the fourth mammary fat pad of 8-week old female NOD/SCID mice (n=5 mice/group). Primary tumor growth was evaluated every four days by caliper, and tumor volume was estimated using the following formula: (L × W
2)/2. Metastatic growth in the lung was allowed to develop for 6–8 weeks. Primary tumors and lung tissues were fixed in 10% neutral buffered formalin, embedded in paraffin, and subjected to standard hematoxylin and eosin (H & E) staining.
Transfection and luciferase reporter assay
Cells were seeded onto 24-well plates and transfected with 800 ng of luciferase vectors (ZEB promoter, mir-200 promoter, ZEB 3’UTR (WT and mutant)) per well using Lipofectamine2000 Transfection Reagent (Invitrogen). 50 ng of pBind plasmids were cotransfected to normalize for transfection efficiency. 24 h later, cells were lysed with PLB lysing buffer. The luciferase activities were measured with the dual-luciferase reagent assay kit (Promega, Madison, WI) according to the manufacturer’s instructions using the TD-20/20 Luminometer (Turner Designs). All reporter assays are shown as relative luciferase activities (averaged ratios of Firefly luciferase: Renilla FSE) and are representative of three experiments.
Quantitative real-time PCR
RNAs were collected using Trizol Reagent (Invitrogen). Reverse transcription was carried out using 2 μg RNA in a 20 μl reaction volume using the Superscript III Reverse Transcription Kit (Invitrogen). Real-time PCR was performed with the SYBR® Premix Ex Taq
TM (Takara Biotechnology, Dalian, China) in 20 μl reactions using ABI PRISM ® 7500 Real-Time PCR System (Applied Biosystems, Grand Island, NY). GAPDH was used as an internal control. Primer sequences are listed in the Additional file
1: Table S1. For mir-200 detection, RNAs were reverse transcribed by miScript Reverse Transcription Kit (Qiagen, Valencia, CA). qPCR of mir-200a and 200b was performed using miScript SYBR Green PCR Kits (Qiagen). mir-200 expression was normalized with U6.
Western blot
MDA-MB-231 cells were harvested and lysed in a RIPA buffer containing 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, and 50 mM NaF. One tablet of protease inhibitor mixture (Complete Mini, Roche Applied Science) was added just prior to use. Then 30 μg protein lysates were separated by 12% SDS–PAGE and transferred onto nitrocellulose. After blocking in a 5% non-fat dried milk solution in washing buffer containing 10 mmol/l Tris (pH 7.5), 50 mmol/l NaCl, and 0.02% Tween 20 (TBST), membranes were incubated overnight at 4°C with primary antibodies. After washed three times with TBST, membranes were incubated for 1 h with horseradish peroxidase-coupled secondary antibodies at room temperature. Signals were detected with the ECL kit (Pierce, Rockford, IL).
Antibodies
The following antibodies were used: rabbit polyclonal anti-Slug (1:1000), anti-Twist1 (1:500), anti-ZEB1 and anti-ZEB2 (1:500, Santa Cruz Biotechnology, Santa Cruz, CA). Rabbit monoclonal anti-E-cadherin (1:1000, Santa Cruz). Rabbit polyclonal anti-MDM2 (C-18) (1:500, Santa Cruz). Mouse monoclonal anti-α-tubulin (1:2000) and anti-fibronectin (1:1000) (Cell Signaling, Danvers, MA). Mouse monoclonal anti-N-cadherin (1:500), anti-ZO-1 (1:1000) and anti-vimentin (1:1000) (Abcam, Cambridge, UK). Mouse monoclonal anti-Restin (1:500), anti-His (1:1500) and anti-Flag (1:2000) (Sigma). Mouse monoclonal anti-p73 (1:1000), anti-p53 (1:1000) and anti-p63 (1:1000) (Abcam). Horseradish peroxidase–conjugated secondary antibodies were obtained from Amersham Biosciences.
Co-immunoprecipitation assay
Human 293 T cells were seeded onto the 10-cm plates and cotransfected with Flag-tagged Restin and His-tagged p73 constructs using Lipofectamine2000 Transfection Reagent (Invitrogen). 2 days after transfection, cells were lysed in precooled RIPA buffer for 30 min on ice, followed by 15 min of centrifugation. Cell lysates were precleaned with protein G-Sepharose beads (GE Healthcare) for 30 min at 4°C. After centrifugation at 14,000 rpm at 4°C for 15 min, cleaned lysates were incubated with either anti-Flag or anti-His antibody on a rocking platform for 4 h at 4°C. Protein complexes were immunoprecipitated by incubation with protein G-Sepharose beads for 30 min at 4°C and then washed three times with lysis buffer. Immunoprecipitated proteins were eluted with 50 μl of Laemmli loading buffer and separated by 10% SDS-PAGE. Protein expression was evaluated by Western blot analysis with either His or Flag monoclonal antibodies.
Wound closure assay
MDA-MB-231 cells were seeded onto 6-cm cell culture dishes at a density of 5 × 105. A wound was incised in the central area of the confluent culture by a 10 μl pipette tip. 12 h after scratch, phase-contrast pictures were taken by a Nikon microscope using a 10x phase contrast objective.
Cell migration and invasion assays
2 × 104 MDA-MB-231 or MDA-MB-451 cells resuspended in 200 μl serum-free medium were seeded in the upper chamber with serum-containing medium in the lower chamber of 24-well transwell plates (BD Biosciences, San Jose, CA). After 6 h, the experiment was terminated by wiping the cells from the wells with a cotton swab and fixed and stained with 0.05% crystal violet for 2 h. Matrigel invasion assays were done using the BD BioCoat Matrigel Invasion Chamber (BD Biosciences). The procedures and the analyses were the same as those for the transwell migration assay except for the presence of the Matrigel.
Cell adhesion assay
96-well cell culture plates were pretreated with 20 μg/ml fibronectin at 37°C for 2 h and blocked with 0.5% BSA solution for 1 h. MDA-MB-231 or MDA-MB-451 cells were plated onto 96-well cell culture plates at a density of 1×104 cells/well. Cells were allowed to adhere for 30 min, after which the media were removed and nonadhered cells were rinsed away. Adhered cells were fixed with 4% paraformaldehyde, stained with crystal violet for 10 min and dissolved in 2% SDS. The absorbance was measured at 550 nm with an ELISA reader (Bio-Tek, Winooski, VT).
[3H] thymidine incorporation assay
MCF-7 and MDA-MB-231 cells (5 × 104) (control and Restin overexpressed cells) were seeded onto the 24-well plates. [3H] thymidine (1 mCi/well) was added 4 hours before the cells were harvested and thymidine incorporation was measured by scintillation counting (PerkinElmer, Waltham, MA).
Statistical analyses
Statistical significance of the studies was analyzed by Student’s t test. Differences with P values of <0.05 are considered significant.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
ZDL, DCJ and ZZL designed the experiments; ZDL, DCJ, JHQ and SY performed the experiments; ZDL, DCJ and MY analyzed the data; ZDL, SDC and ZZL wrote the manuscript. SDC and ZZL have done overall supervision of work. All authors read and approved the final manuscript.