Background
The incidence and mortality of colorectal cancer (CRC) rank the top 5 among all malignant neoplasms both in China and western countries. Except for exairesis, chemotherapy is one of the most common treatments for CRC patients, especially those who have distant metastasis. However, long-term use of chemotherapeutic drugs e.g. oxaliplatin (Oxa) can cause several side effects such as hepatotoxicity and neurotoxicity and induce drug resistance [
1‐
3]; thus, it is hard to achieve the expectations. Nowadays, several natural compounds have been introduced in anti-tumor researches and clinical oncotherapies, either alone or combined with traditional chemotherapeutic drugs. Resveratrol (Res) is a natural polyphenolic compound rich in peanuts, red wine and grapes. Apart from the well-documented anti-inflammation and anti-oxidation effects [
4,
5], Res has an anti-tumor potential in CRC and other cancers in vitro and in vivo [
6‐
9], excitingly, without apparent side effects.
Efforts have been made to figure out how Res plays the anti-tumor role, which is of importance for the better application of Res in clinic. It has been reported that Res could induce cell apoptosis and cell cycle arrest via p53 pathway and/or caspase/cyclin-CDK pathway to achieve its anti-tumor activities [
10,
11]. Identification of the role that microRNAs play in human cancer pathogenesis triggered researches in the regulation of Res on microRNA expressions. Depending on their targets, microRNAs could serve as either oncogenes or tumor suppressing genes. Accumulating evidence showed that Res decreased
miR-520 h and subsequently suppressed tumor cell invasion and migration in lung cancer cells [
12]. Res also inhibited cancer growth and metastasis of SW480 human CRC cells by inducing
miR-663 expression [
13]. These observations clearly indicated that microRNAs were involved in the Res-mediated anti-tumor activities.
MiR-34c is suggested to be a candidate of tumor suppressing gene and epigenetically silenced in CRC [
14,
15]. We recently found that over-expression of
miR-34c induced apoptosis and inhibited proliferation and invasion in CRC cells by silencing its target, stem cell factor (SCF, also known as KITLG) [
16], suggesting
miR-34c as a promising target for the treatment of CRC patients. Besides, it has been recently raised that Res inhibited human CRC cell growth and induced apoptosis through up-regulating
miR-34a, a homologue of
miR-34c, implying a possible similar modulation of Res on
miR-34c expression [
17]. However, whether
miR-34c is implicated in the Res-mediated anti-CRC effect has not yet been fully elucidated. Furthermore, how Res synergizes with Oxa in the treatment of CRC needs clarified besides its protection from the Oxa-induced hepatotoxicity and neurotoxicity [
18].
In the present study, we provided evidence that Res itself could not only exert significant anti-CRC effect, but also showed a synergistic effect with Oxa in a miR-34c dependent manner.
Methods
Cell culture and reagents
Human CRC cell lines HT-29 (p53
+
) and HCT-116 (p53
−
) were purchased from the Cell Bank of Chinese Academy of Sciences. All cell lines were cultured in DMEM medium (Life Technologies, USA) supplemented with 10 % fetal bovine serum (Life Technologies) and 1 % penicillin/streptomycin (Life Technologies). Cells were grown at 37 °C in the presence of 5 % CO2 and treated with Res (Sigma, USA) and/or Oxa (Sigma). DMSO (Sigma) was used as control.
Cell viability assay
Cell viability was detected by cell counting kit-8 (CCK-8, Dojindo Laboratories, Japan) according to the manufacturer’s protocol. Cells were seeded in 96-well plates at 3 × 103 cells per well. 10 μL of the tetrazolium substrate was added to each well. The plates were incubated at 37 °C for 1 h and the absorbance was measured at 450 nm using Multiskan FC (Thermo Scientific, USA). All experiments were done in triplicate and repeated three independent times.
Combination Index (CI) calculation
To assess the drug interactions of Res and Oxa, the CI value defined by median-effect analysis was calculated as follows:
$$ \mathrm{C}\mathrm{I} = {\left({\mathrm{D}}_{\mathrm{X}}\right)}_{\mathrm{Res}}/{\left(\mathrm{D}\right)}_{\mathrm{Res}} + {\left({\mathrm{D}}_{\mathrm{X}}\right)}_{\mathrm{Oxa}}/{\left(\mathrm{D}\right)}_{\mathrm{Oxa}} $$
where (D)
Res and (D)
Oxa are the doses for each drug alone that inhibits 50 % cell viability, and (D
X)
Res and (D
X)
Oxa are the doses for Res and Oxa in a combination that inhibits 50 % cell viability. CI < 1 indicates a synergistic effect; CI = 1, additive effect; and CI > 1, antagonistic effect [
19].
The bottom of 6-well plate was coated with 0.6 % low melting agarose (Promega, USA) and covered with 0.35 % agarose containing 1000 cells. The plates were incubated at standard incubator condition for 2 weeks. Colonies were counted under inverted phase contrast microscope (Leica DMI3000 B, Germany) in 9 randomly sampled visual fields each well by stereological technique. All experiments were done in triplicate.
Western blot
The harvested cells were suspended in RIPA (Radio-Immunoprecipitation Assay) lysis buffer (Applygen, Beijing, China). After 10 % SDS-PAGE, the proteins were transferred onto PVDF membrane (Merk-Millipore, USA) and blocked with 5 % non-fat dry milk or 5 % bovine serum albumin (Sigma) for 1 h. The membrane was incubated with rabbit anti-KITLG (1:500, Abcam, UK), mouse anti-p53 (1:1000, Cell Signaling Technology, USA), rabbit anti-Akt (1:1000, Cell Signaling Technology) or rabbit anti-p-Akt (1:2000, Cell Signaling Technology) primary antibody at 4 °C overnight. Then, the membrane was incubated with HRP-conjugated secondary goat anti-mouse IgG (1:2000, Santa Cruz, USA) or goat anti-rabbit IgG (1:2000, Santa Cruz) for 1 h at 25 °C. The proteins were detected using ECL chemiluminescence (Thermo Scientific) and viewed in Fusion FX Vilber Lourmat (France). A mouse anti-actin (1:4000, Santa Cruz) antibody was used as an internal control.
Real-time monitoring of cellular proliferation, migration and invasion
We employed real-time cellular analyzer (RTCA, ACEA Biosciences, USA) to monitor cellular proliferation, migration and invasion as we previously described [
16]. Briefly, for the proliferation assay, the cells were seeded in E-plates at a density of 8000 cells/well and the cell index (CI) was automatically recorded every 15 min. For the migration assay, the cells were seeded in the upper chambers of CIM-plates in serum-free medium at a density of 20,000 cells/well. The bottom chambers of CIM-plates were filled with serum-containing medium to promote migration across the membranes towards the serum gradient. The CI was registered only from the cells that were capable of migrating through the membranes. The protocol for the invasion assay was identical to that for the migration assay, except that the upper chambers were loaded with 30 μl of 5 % Matrigel (BD Biosciences, USA) solution to create a 3D biomatrix film in each well prior to cell seeding. Four independent experiments were performed respectively. The slope of CI curve was analyzed.
RNA extraction and qPCR
The total microRNA was extracted using miRNApure Mini Kit (CWBiotech, Beijing), according to the manufacturer’s instruction. Reverse transcription was performed using Taqman microRNA RT Kit (Life Technologies) and Taqman microRNA Assay with specific stem-loop primers. Real-time PCR was performed using Taqman Universal Master Mix II (Life Technologies). The reactions were incubated at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min in ABI 7500 real-time PCR system. Results were normalized to the internal control, RNU6B.
The total RNA was extracted using TRIzol reagent (Life Technologies) according to the manufacturer’s instruction. Reverse transcription reactions were performed using High Capacity RNA-to-cDNA Kit (Life Technologies). Real-time PCR was performed in ABI 7500 real-time PCR system using SYBR Green PCR Master Mix (Life Technologies). The primers are listed in Table
1. The reactions were incubated at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min.
| Reverse | TTGGCCTTCCTATTACTGCTACTG |
E-cadherin
| Forward | TGCCCAGAAAATGAAAAAGG |
| Reverse | GTGTATGTGGCAATGCGTTC |
PTEN
| Forward | GCTGTGGTTGCCACAAAGTGCC |
| Reverse | GCAGGTAGAAGGCAACTCTGCCA |
HOXB3
| Forward | AAAGGCACAAAACACGTTCC |
| Reverse | GGATCTCTCACCATCCCTGA |
FGFR1
| Forward | CCCGTAGCTCCATATTGGACA |
| Reverse | TTTGCCATTTTTCAACCAGCG |
Pim
| Forward | GAGAAGGACCGGATTTCCGAC |
| Reverse | CAGTCCAGGAGCCTAATGACG |
GAPDH
| Forward | AGAAGGCTGGGGCTCATTTG |
| Reverse | AGGGGCCATCCACAGTCTTC |
Unmethylation | Forward | TTTTTATTTGTTTTGTTTTGTGTTTGTTTTG |
| Reverse | CCTAAAACTAACTCTCTCAACCCCA |
Methylation | Forward | ATTCGTTTCGTTTCGCGTTCGTTTC |
| Reverse | CTAAAACTAACTCTCTCGACCCCG |
All reverse transcription reactions included no-template controls, and all PCR reactions were run in triplicates. Relative microRNA or mRNA expression was determined using the comparative CT (2-ΔΔCt) method.
Flow cytometry
For cell apoptosis analysis, AlexaFluor® 488 Annexin V/Dead Cell Apoptosis Kit (Life Technologies) was used according to the manufacturer’s instruction. In Brief, cells were seeded in 6-well plates and 1 × 105 cells were resuspended in annexin binding buffer, after which annexin V and propidium iodide (PI, 100 μg/mL) were added and incubated at 25 °C for 15 min in the dark. Cell apoptosis was analyzed in Coulter EPLCS XL (Beckman Coulter, USA). All experiments were done in triplicate.
For cell cycle analysis, 1 × 106 cells were fixed with 70 % ethanol for 2 h at 4 °C, followed by the treatment with phosphate buffered saline containing RNase (50 μg/mL) for 30 min at 37 °C. Cells were stained with PI (500 μg/mL, Sigma) for 30 s in the dark. Cell cycle kinetics were analyzed by measuring the DNA contents in Coulter EPLCS XL. All experiments were done in triplicate.
Over-expression of miR-34c by lentiviral mediation
The full length of pre-miR-34c was chemically synthesized and introduced into GV217 lentiviral vector (GeneChem, Shanghai, China) in the unique EcoRI site to construct a lentivirus encoding miR-34c (Lv-miR-34c). The Lv-miR-34c or its control, Lv-NC, was transfected into CRC cells seeded in 6-well plates when reaching 30 % confluence. After 3 days, the infectious efficiency was evaluated by observing the EGFP-expression with an inverted phase contrast microscope (Leica DMI3000 B, Germany).
MiR-34c knockdown
For knockdown of miR-34c, the specific miR-34c inhibitor was purchased from Ribobio (Guangzhou, China). The inhibitor or its control, inhibitor-NC, was transfected into CRC cells using riboFECT™ CP Transfection Kit (Ribobio) according to the manufacturer’s instruction.
Methylation Specific PCR (MSP)
The genomic DNA of CRC cells was extracted using QIAamp® DNA Mini Kit (Qiagen, USA). 200 ~ 500 ng DNA was subject to bisulfite conversion using EZ DNA Methylation-Gold™ Kit (Zymo Research, USA). The methylation-sensitive PCR was performed using Platinum Taq DNA Polymerase (Life Technologies). The PCR reaction conditions consisted of an initial incubation at 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s and 68 °C for 1 min using verity 96-well thermo cycler (Applied Biosystems). The primers are listed in Table
1. The PCR products were electrophoresed in 0.75 % agarose gel, and visualized by uitraviolet illumination.
Xenograft in BALB/c nude mouse
In order to determine the in vivo anti-CRC effect of Res, the CRC cell xenograft in BALB/c athymic nude mice (3–4 weeks old) were performed. Twenty-eight nude mice were purchased from the Experimental Animal Center in the Capital Medical University and housed under Specific Pathogen Free condition. 5 × 10
6 HCT-116 cells suspended in 50 μL phosphate buffered saline were subcutaneously injected into the right armpit of the nude mice. Ten days after cell xenograft, the nude mice were randomly grouped (7 mice/group) and received Res (100 mg/kg), Oxa (10 mg/kg), Res (100 mg/kg) + Oxa (10 mg/kg) or DMSO via tail-vein injection every day for 2 weeks based on modification of previous report [
18]. The body weight and tumor size were measured every other day. The tumor volume was calculated as: W
2 × (L/2), where W represents the tumor width and L the tumor length. The experimental procedures were approved by the Institutional Review Board of the Capital Medical University.
ELISA
The xenografts were lyzed; and the supernatants from xenografts as well as the serum of mice were collected. The concentrations of IL-6 and TNF-α was determined by ELISA according to the manufacturer’s instructions (R&D Systems, USA). The absorbance of each well at 490 nm was read using the microplate reader (Multiskan FC, Thermo Scientific). All experiments were done in triplicates.
Statistics analysis
All statistical analysis were performed using SPSS 13.0 (Chicago, USA). Values are expressed as means ± SEM. Results were analyzed by Student’s t test or one-way ANOVA. The P value < 0.05 was considered to be statistically significant.
Discussion
Res has been of interest in oncotherapies because of its potent anti-tumor activities and minimal side effects. To better understand the underlying mechanism of Res in treating CRC, we conducted in vitro and in vivo experiments. Consistent with previous reports, Res repressed CRC cell viability, proliferation, capacity of forming colonies, migration and invasion, as well as induced cell cycle arrest and apoptosis. Note that, Res arrested HCT-116 cells in G0/G1 phase while HT-29 cells in G2/M phase, indicating that the effect of Res on the cell cycle arrest was cell type dependent. The most interesting result was that the anti-CRC effect of Res was partially through up-regulating the tumor suppressing microRNA,
miR-34c, which silenced its target KITLG. Besides
miR-34c, previous studies showed that Res could increase some tumor suppressing microRNAs in CRC. Namely, Res increased
miR-663 that targeted TGF-β and potentiated the anti-CRC effect of Res [
13].
MiR-129 was suggested to participate in the anti-CRC action of piceatannol, a naturally occurring analog of Res, by targeting Bcl-2 [
33]. Nevertheless, though we did detect significant increases of tumor suppressing microRNAs,
miR-28 and
miR-34a, their respective targets,
HoxB3 and
KIT, were not decreased, implying that
miR-28-HoxB3 and
miR-34a-KIT axes may not involve in the anti-CRC activities of Res. But we could not exclude the involvement of
miR-28 and
miR-34a since they may potentiate the anti-CRC effect of Res by silencing other undetermined targets which we did not detect in this study. Fortunately, miRNA microarrays showed that Res treatment in SW480 CRC cells significantly decreased
miR-17,
miR-21,
miR-25,
miR-92a-2,
miR-103-1 and
miR-103-2 which have been shown to behave as onco-miRNAs [
13]. Here, we also showed that Res did not up-regulate oncogenic
miR-9 and
miR-19a in HCT-116 cells. It was thus inferred that the modulation of Res on the microRNA expressions was distinct: positive on tumor suppressing microRNAs and negative on oncogenic microRNAs. However, the reasons for the distinct effects of Res have been veiled yet. Taken together, we proposed that Res had a robust positive effect on
miR-34c-KITLG axis in CRC cells and the effect was, to some extent, specific.
It’s acknowledged that the promoter of
miR-34c is hypermethylated in CRC tissues and cell lines which lead to silencing of
miR-34c [
27]. Therefore, we considered Res-induced demethylation might be responsible for the increased
miR-34c. However, we did not observe any demethylated bands by MSP method upon the treatment of Res, indicating demethylation did not account for the Res-induced
miR-34c. P53 is a tumor suppressor and drives
miR-34c transcript [
27]. Could p53 conduced to the Res-stimulated
miR-34c expression in CRC cells? Res increased
miR-34c expression both in
p53
+
and
p53
−
CRC cells, suggesting the effect of Res on
miR-34c expression was p53 independent. However, it was worth noting that p53 was elevated after treated with Res in HT-29 cells and, simultaneously, the inducement of
miR-34c by Res was more prominent in HT-29 cells, indicating p53 facilitated the effect of Res on
miR-34c expression. We also found inactivation of PI3K/Akt signaling upon the treatment of Res only in HT-29 cells, which possibly account for the up-regulation of p53 by inhibiting MDM2, a ubiquitin protein ligase controlling the degradation of p53. A recent work provided a new evidence that Res can bind directly and distinctively to
miR-33a and
miR-122 and divergently modulate their levels in hepatic cells [
34]. Whether the increase of
miR-34c in CRC was due to the stabilization of Res deserves deep investigation. If so, we hope to find out the underlying mechanism of the distinct effects of Res on the oncogenetic microRNAs and tumor suppressing microRNAs.
Oxa is one of the first choices treating CRC patients currently; but the side effects and drug resistance caused by the long-term use interfere with the therapeutic efficiency. In this study, Res was introduced to facilitate the chemosensitivity to Oxa in CRC cells, which was probably relied on the elevated
miR-34c. Moreover, no publications showed that Res was harmful to patients, suggesting Res could be a safe medication in preventing CRC. Lines of evidence suggested Res reversed multidrug resistance by down-regulating
MDR-1 gene in breast cancer cells [
35,
36]. Wen et al. [
37] addressed that PI3K/Akt signaling positively regulated
MDR-1 in CRC. According to the previous and present results, we presumed that Res-induced
miR-34c in CRC cells might be associated with the reduced
MDR-1 or other multidrug resistance-related genes via silencing PI3K/Akt pathway, which, however, needs further investigation.
The in vivo xenograft experiment further consolidated the in vitro results. Res raised the
miR-34c expression in tumors but not in serum, giving a clue that the
miR-34c-inducing effect of Res was tissue specific instead of systemic. Moreover, the proinflammatory cytokine IL-6 was reduced exposure to the 2-week Res treatment. IL-6 could act as growth factor in multiple tumors by activating the oncogenic STAT3 transcription factor. Rokavec et al. [
38] identified that
miR-34a/c could target IL-6R by binding to its 3′ untranslated region (3′UTR); thereby disrupted the IL-6/IL-6R-STAT3-
miR-34a loop. Here, we hypothesized that the IL-6-triggered CRC progression could be interfered by the Res-increased
miR-34c.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SY and DZ designed experiments. SY and WL performed experiments and wrote the manuscript. HS, BW, FJ, TS, HC, PS and YW performed experiments. DZ gave suggestion on discussion and interpretation on the data. All authors read and approved the final manuscript.