Background
Colorectal carcinoma (CRC) is a leading cause of cancer-based mortality in western countries, causing some 500000 annual deaths worldwide. A novel avenue of research on CRC therapy emerged some years ago as the result of a series of population-based studies which demonstrated that the long-term intake of non steroidal anti-inflammatory drugs (NSAIDs) leads to a significantly reduced risk of developing colon cancer [
1]. NSAIDs such as aspirin or indomethacin are potent and selective inhibitors of cyclooxygenase (COX), of which two isoforms, COX-1 and 2, exist. Cyclooxygenase catalyzes a key step in the biosynthesis of prostaglandins (PGs), a family of bioactive lipids that regulate as diverse biological processes as inflammation, pain, immunity, nerve and bone homeostasis among many others. Over the last few years, experimental evidence stemming mostly from animal studies has accumulated to support an important contribution of COX-2 in the development of CRC [
2‐
5]. Since COX catalyzes the opening reaction required for the biosynthesis of all PG subtypes, one major question regards the identity of the lipid mediators that transduce the pro-carcinogenic effects of COX. While studies on the function of specific PG species in the promotion of CRC have been very limited, available evidence points to a role for the PG subtype PGE2. [
6‐
9]. For example, PGE2 elevates tumour incidence in various murine models for CRC [
10‐
13], and cell culture experiments have implicated PGE2 and PGE2 receptor-dependent signalling in the stimulation of colon epithelial cell growth (see below).
PGE2 exerts its biological functions via binding to four types of G-protein-coupled receptors termed EP1-4 [
13,
14], which couple to distinct downstream second messenger systems. EP1 is a Gq-coupled receptor that elicits Ca2+ and diacylglycerol signals while EP2 and EP4 receptors are coupled to Gs-proteins and raise cAMP levels. The EP3 receptor, finally, which manifests in up to 8 splice variants, leads predominantly to the down regulation of cAMP signalling via Gi-protein-mediated inhibition of adenylate cyclase [
14‐
16]. Which of the multiple pathways or which combination thereof emanating from the various EP receptor subtypes is responsible for the pro-carcinogenic effects of PGE2 is far from being understood. Rodent studies have implicated EP1, EP2 and EP4 receptor in intestinal tumorigenesis [
13], pointing to a complex coordination of PG effects by various receptor subtypes.
In an attempt to delineate the signal transduction processes that mediate PGE2's growth-promoting effects on colon epithelial cells, a number of laboratories have carried out cell culture experiments on a few well-characterized CRC cell lines. The outcome of those studies, however, has yielded substantial discrepancies as to the growth-promoting effects of PGE2. For instance, PGE2 has been reported to induce cell proliferation of HT-29 cells in three studies [
17‐
19], whereas two other laboratories failed to observe a proliferative effect in the same cell line [
20,
21]. In fact, antiproliferative effects of PGE2 on CRC cell lines have also been reported [
21,
22]. It is likely that these incongruencies relate to differences in the experimental protocols employed since a number of parameters including PGE2 concentration, proliferation time frame and the inclusion/exclusion of serum, among others, differ widely in the referred studies. Similarly, there is only a limited body of partially conflictive experimental data on the regulation of apoptosis in colorectal cancer cells by PGE2 [
13,
22‐
24]. In sum there is an imbalance between the appreciation of the role of COX-derived PGs in the development of CRC and our understanding of the mechanisms underlying the growth promoting effects of PGs in colon epithelial cells
in vitro.
We have undertaken an in-depth analysis of the cell-biological effects of PGE2 on 4 commonly employed CRC cell lines. We document that PGE2 exerts a significant proliferative effect on 3 cell lines, in a dose-dependent fashion. Unexpectedly, low PGE2 dosage in the lower nano molar range fosters CRC proliferation whilst higher PGE2 concentrations do not exhibit mitogenic potency. Of note, we monitor cell proliferation in the complete absence of serum, excluding the masking of PGE2's effect by more dominant proliferative serum constituents. We furthermore present correlative and pharmacological evidence arguing that down regulation of cAMP/PKA signalling via EP3 receptor engagement is an important step of PGE2's proliferative action, suggesting that this pathway acts in a switch-like fashion to either trigger or prohibit CRC cell proliferation driven by PGE2. We further document that expression of Gi-coupled but not Gs/Gq-coupled EP3 splice variants is selectively up regulated following serum deprivation, indicating that cAMP-reducing EP3 receptor variants are regulated by the proliferative vs. quiescent status of the CRC cell. Not least, these data illustrate that EP3 receptor down regulation represents a further means by which the presence of serum may have obscured the ability of PGE2 to induce cell proliferation in previous studies. Over all, our data illustrate that mitogenic PGE2 signalling in colon epithelial cells is multi-faceted, and that the ability to induce CRC proliferation may be determined by the ability to lower cAMP signalling via Gi-coupled EP3 receptor variants, as opposed to other EP receptor types. These findings help to rationalize conflictive literature data on the in vitro growth-promoting effects of PGE2.
Methods
Materials and Reagents
Prostaglandin E2 (PGE2) was obtained from Alexis Biochemicals and dissolved in DMSO. Lysophosphatidic acid (LPA), Isoproterenol, Pertussis toxin (PTX) and propidium iodide were purchased from Sigma-Aldrich (Taufkirchen, Germany). Butaprost, Sulprostone and 11-deoxy-PGE1 were from Cayman Chemicals (Ann Arbor, USA). EP1, 3 and 4 receptor selective antagonists were kindly provided by Merck Frost, Canada [
25]. [
3H]-Thymidine (7 Ci/mmol) was obtained from Hartmann Analytic (Braunschweig, Germany). The Annexin V-binding assay kit was from BD Bioscience (Heidelberg, Germany). Antibodies against phosphorylated PKA substrates and PARP were obtained from Cell Signalling Technology (Beverly, MA). Antibody to Vinculin was purchased from BIOZOL (Eiching, Germany).
Cell culture
The human colon cancer cell lines Caco-2, Lovo and SW480 cells were purchased from the DSMZ (Braunschweig, Germany). These cells were maintained in RPMI medium containing 10% foetal bovine serum. Early passage HT-29 cells were provided by the Institute for Nutrition (FSU Jena, Germany) and cultured in DMEM medium containing 10% foetal bovine serum. Prior to experiments, all cells were deprived of serum for 16–18 h unless otherwise stated.
Proliferation assays
For the assessment of [3H]-thymidine incorporation into cellular DNA 1 × 104 HT-29, Caco-2, Lovo and SW480 cells were seeded in 24-well culture plates. 24 h later cells were deprived of serum overnight. Cells were stimulated with agonists or treated otherwise as appropriate. In cells stimulated with PGE2 and other agonists dissolved in DMSO, the final concentration of DMSO never exceeded 0.1% v/v. Once administered, PGE2-containing medium was not exchanged for fresh medium, even for longer time points of stimulation. Control experiments, in which medium was replaced by fresh PGE2-containing medium evidenced no obvious difference in the experimental outcome, arguing against PGE2 stability as a limiting factor. 12 hr prior to quenching the samples, 0,5 μCi of [3H]-thymidine was added to each well. Cells were washed once with ice-cold 5% TCA and incubated for 20 minutes in 5% TCA on ice. Wells were washed 3 times with ice-cold 96% ethanol, residual cell material was solubilized with (1% SDS, 2% Na2CO3, 0,1 M NaOH) and radioactivity was measured by scintillation counting.
For automated cell counting 1 × 105 HT-29, Caco-2, Lovo and SW480 cells were seeded in 12-well culture plates and cultured for 24 hours. Cells were serum-starved over night and exposed to agonists for the indicated lengths of time. Cells were detached from the culture dishes by trypsinization and counted in a CASY 1 Cell Counter (Schärfe System GmbH, Reutlingen, Germany) using the Analyzer System Model DT routine according to the manufacturer's instructions.
Apoptosis assays
5 × 104 HT-29 cells were seeded in 6-well plates, cultured for 24 hours and serum-deprived overnight. After agonist stimulation, both attached and detached cells were collected, pooled in a vial, and lysed in 1 ml ice-cold lysis buffer A [50 mM Hepes (pH 7,5), 150 mM NaCl, 5 mM EDTA, 1% NP-40, 1 μg/ml pepstatin A, 2 μg/ml leupeptin, 1 μg/ml aprotinin, 100 μM PMSF, 100 μg/ml pefabloc]. Lysates were cleared by centrifugation at 20,000 g for 15 min and protein concentration was determined with the Micro BCA protein assay kit (Pierce, Bonn, Germany). Same amounts of cell extract were resolved by polyacrylamide gel electrophoresis and PARP cleavage was assessed by Western blotting. Membranes were subsequently reprobed with Vinculin to evaluate protein loading.
For flow cytometric cell cycle distribution analysis HT-29 cells were seeded at a density of 5 × 105 cells/well in 6-well culture plates for 24 hours and deprived of serum overnight. After stimulation with the indicated concentrations of PGE2 for further 120 hours cells were trypsinized, washed once with phosphate-buffered saline (PBS) and resuspended in 100 μl PBS. Annexin V-binding was determined with the assay kit following the manufacturer's instructions. Fluorescence was measured on a FACScalibur flow cytometer (Becton Dickinson, Heidelberg, Germany). The total number of cells analyzed for each sample was 10000 and raw data were processed using the CellQuestPro and WinMDI software.
cAMP measurements
2,5 × 105 HT-29, Caco-2, Lovo and SW480 cells were seeded in 12-well culture plates and grown for 24 hours. Cells were starved of serum overnight and treated with 500 μM 3-isobutyl-1-methylxanthine (IBMX) for 4 hr followed by stimulation with the indicated concentrations of PGE2 for 15 minutes. Reactions were stopped by addition of ice cold 65% ethanol. Cells were scraped off, cell debris was pelleted by centrifugation (20,000 g, 10 min) and the supernatant was evaporated in a SpeedVac. Intracellular cAMP, present in the residue, was subsequently determined using the Cyclic AMP [3H] assay (Amersham Biosciences, Freiburg, Germany) exactly as described by the manufacturer.
Phosphorylation of PKA substrates
5 × 106 cells were seeded in 6-well culture plates and cultured for 24 hours. After serum deprivation overnight cells were challenged with PGE2 for 15 minutes and lysed in 1 ml cold lysis buffer A supplemented with phosphatase inhibitors: 3,4 μM microcystin, 10 mM β-glycerophosphate, 100 μM Na-orthovanadate. Lysates were cleared by centrifugation and resolved by polyacrylamide gel electrophoresis. Phosphorylation of PKA substrates was determined by Western blotting with an anti phospho-PKA substrate antibody. The blots were subsequently reprobed with Vinculin to ascertain equal protein loading.
RT-PCR analysis of EP receptors and EP3 receptor splice variants
For EP1-4 receptor analysis total RNA was isolated using the Rneasy Kit (Qiagen, Germany) and 1 μg was reverse-transcribed using TaqMan Reverse Transcription Reagents (Roche Diagnostics, Germany) following the manufacturers' instructions. EP receptor cDNA was amplified by standard PCR techniques using previously reported primer sets for EP1, 2, 3 (subtype 1–8) and 4 [
26,
27]. Amplification of EP3 receptor splice variants, along with GAPDH as an internal control in each reaction, was carried out with the OneStep reverse transcription-PCR kit from Qiagen (Hilden, Germany) according to the standard protocol with newly created primer sets for each subtype. All used primer sets are listed in table
1. A HA-tagged version of human EP3 subtype 3 (cDNA was obtained from the Missouri S&T cDNA Resource Centre) was transfected by standard procedures into HT-29 cells and used as a positive control for the PCR amplification.
Table 1
List of primer pairs used in the current study for amplification of EP receptor isoforms.
EP1
| NM_000955 | CTTGTCGGTATCATGGTGGTGTC | GGTTGTGCTTAGAAGTGGCTGAGG | 322 | |
EP2
| NM_000956 | CCACCTCATTCTCCTGGCTA | CGACAACAGAGGACTGAACG | 216 | |
EP3 subtype 1–8
| NM_000957 | CTTCGCATAACTGGGGCAAC | TCTCCGTGTGTGTCTTGCAG | 300 | |
EP3 subtype 1–3
| NM_000957 | CTTAATAGCTGTTCGCCTGG | GCTTAGCTGGACACTGCAG | 293 (1) 224 (2) 197 (3) | This study |
EP3 subtype 4
| NM_198716 | CTTAATAGCTGTTCGCCTGG | ATTTCCCCAAAATTCCTCTTG | 232 | This study |
EP3 subtype 5
| NM_198715 | CTTAATAGCTGTTCGCCTGG | TGCTTCTGTCTGTATTATTTCAT | 182 | This study |
EP3 subtype 6
| NM_198716 | CTTAATAGCTGTTCGCCTGG | ATTTCCCCAAAATTCCTCTTG | 140 | This study |
EP3 subtype 7
| NM_198717 | CTTAATAGCTGTTCGCCTGG | ATTTCCCCAAAATTCCTCCTG | 113 | This study |
EP3 subtype 8
| NM_198718 | CTTAATAGCTGTTCGCCTGG | GTCTTTACTGTTGAGATTCTG | 268 | This study |
EP4
| NM_000958 | TGGTATGTGGGCTGGCTG | GAGGACGGTGGCGAGAAT | 329 | |
Discussion
While the beneficial action of NSAIDs in preventing colorectal cancer progression in humans is generally accepted, the molecular mechanisms underlying the pro-carcinogenic effects of its likely targets, COX and PGs, remain obscure. The present study was conducted to provide a comprehensive view of the proliferative action of PGE2 on 4 CRC cell lines in vitro. The four cell lines differ in their grade of malignancy as well as in their mutational status [
40‐
43] and are commonly used model cell lines for mechanistic studies. Our data evidence that PGE2 elicits DNA synthesis and net proliferation in three (HT-29, Caco-2, Lovo) out of the four cell lines. PGE2 driven cell proliferation, as measured in the absence of serum by 2 independent approaches, is low compared to the mitogenic effect of serum and proceeds only after a substantial lag of 48 h in all 3 cell types. Strikingly, the dose-response curve is bi-phasic with lower concentrations of PGE2 exerting proliferation while micro molar doses are ineffective or, in the case of SW480 cells, even anti-proliferative. A similar bell-shaped response to PGE2 has been reported by Qiao and co-workers in the adenocarcinoma cell line SW1116 [
17]. Similarly the related PG subtype PGE1 induces proliferation of HT-29 cells at nano molar concentrations whereas it stalls proliferation at higher dosage [
44]. Along these lines, high levels of exogenously administered prostaglandins reportedly inhibit tumour cell growth or tumorigenic parameters in cell culture studies [
45,
46]. Yet other researchers have documented a stimulation of colon cancer cell proliferation by low concentrations of PGE2 in the nM range [
17,
47,
48], in agreement with our own results. All these data point to a bi-faceted action of PGE2 as a stimulus (at low concentrations) and inhibitor (at high dosage) of CRC cell growth.
Since the proliferative effects of PGE2 were obtained in the absence of serum, it was important to determine whether or not the increased cell count reflected a
bona fide mitogenic effect of PGE2 or, alternatively, a pro-survival effect that becomes evident under situations of cellular stress, such as conceivably induced by serum withdrawal. In line with this possibility, a number of reports have illustrated anti-apoptotic effects of PGE2 in CRC lines [
22,
23]. Two independent apoptosis assays, however, did not provide any indication for a pro-survival effect of low PGE2 doses or a pro-apoptotic effect of higher PGE2 concentrations, indicating that the effects documented herein reflect true proliferative signalling by PGE2.
Beyond raising intriguing speculations on the mechanism of action of PGE2 on colorectal cancer cell growth, the reported concentration and time dependence of PGE2's proliferative action may help to rationalize previously reported, partially conflictive findings. Cassano et al. failed to detect any effect of PGE2 on the proliferation of HT-29 cells [
20]. In their study they monitored the effect of various concentrations of PGE2 on HT-29 proliferation 24 h or 48 h after PGE2 administration. However, as documented herein, an effect of PGE2 on HT-29 proliferation becomes evident not earlier than 72 h post-stimulation. Along the same lines, Parker et al. reported an anti-proliferative effect of micro molar PGE2 doses on HT-29 [
21] but the same authors observed no induction of HT-29 cell proliferation by lower PGE2 dosage, in apparent discrepancy with our observations. One possible explanation could be that Parker and co-workers monitored the effect of PGE2 on HT-29 cell proliferation in the presence of 10% serum, which according to our findings is expected to obscure the proliferative effect of PGE2. On the other hand, nano molar doses of PGE2 are mitogenic for HT-29 cells kept in 2% serum [
19], indicating that the amount of serum present in the assay is a critical factor when it comes to detect proliferative effects of PGE2. One parameter worth considering at this point is the regulation of the EP3 receptor by serum, as documented in the current study. In particular, the possibility that different concentrations and/or batches of serum may affect EP3 receptor subtype levels to different extents is a factor that could have a large impact on the responsiveness of CRC cell lines to PGE2. In conclusion, our data indicate that future cell-culture studies on the growth-promoting effects of prostaglandins should evaluate longer time points of PGE2 administration and a broader range of PGE2 concentrations under serum-free or low-serum conditions.
In an attempt to decipher the signalling pathways involved in PGE2's proliferative effects we have focused on the cAMP pathway. Cyclic AMP is one major second messenger system addressed by prostaglandins in numerous tissues [
49]. However the role of cAMP as a potential mediator of PGE2's promotion of cell growth has been controversially discussed. Several studies document that PGE2 engages proliferative or anti-apoptotic pathways via an increase in cAMP levels [
33,
50]. On the other hand, down regulation of cAMP levels has been linked to PGE2-driven cell proliferation in other reports [
51,
52], while some laboratories have been unable to detect any PGE2-dependent changes in cAMP levels in HT-29 and other CRC cell lines, at all [
20]. A recent study documents that forced signalling via the EP4 prostanoid receptor, which results in increased levels of cAMP, does not result in increased cell proliferation of HT-29 cells [
53]. We find that PGE2 affects cAMP levels in all four colorectal cancer cell lines investigated here in a strictly dose-dependent fashion. Intriguingly, changes in cAMP levels in response to particular PGE2 doses inversely correlate with their proliferative potency (compare Figs.
1A and
3A): Thus, mitogenic PGE2 doses either down regulate or do not ostensibly affect cAMP levels whereas anti or non-proliferative PGE2 concentrations do in all cases elevate cAMP. Importantly, a second experimental readout for cAMP levels, the phosphorylation of substrates of the cAMP target PKA, yielded qualitatively the same results, but in several cases it evidenced a more dramatic reduction of cAMP/PKA signalling in response to mitogenic PGE2 doses than those disclosed by the RIA assay. For example, in HT-29 cells 1 nM, 10 nM and 100 nM PGE2 all lead to a reduced phosphorylation of PKA substrates, indicative of a reduction in cAMP levels, while only 10 nM PGE2 induces a detectable drop in cAMP levels as measured by the radioimmunoassay. As discussed above, several effects could account for this discrepancy. For example, PGE1 elicits cAMP accumulation at discrete sites within cells [
34], suggesting that locally confined, modest changes in cAMP levels, which may be arduous to detect via RIA, may suffice to mediate changes in the activity of downstream effectors such as PKA. Moreover, since cAMP measurements are preceded by the administration of phosphodiesterase inhibitors in order to block cAMP degradation, the RIA assay may more accurately reflect raises in cAMP than a reduction in those levels. We suspect that a drop in cAMP levels, as reflected by a marked reduction in PKA substrate phosphorylation e.g. by 1 or 100 nM PGE2 in HT-29 cells (Fig.
3C) did largely pass undetected in the cAMP measurements. In conclusion, we hypothesize that a reduction in cAMP levels may be a general outcome to the administration of low PGE2 concentrations that relates to the proliferative action of nano molar PGE2 doses.
Gi-Proteins rank among heterotrimeric G-protein subclasses with the highest mitogenicity, although cell-type dependent variations do surely exist. This status is reflected by the oncogenic nature of various components of Gi-protein signalling pathways such as autotaxin, an extra cellular phospholipase A2 that generates lysophosphatidic acid (LPA), an agonist of Gi-protein coupled receptors [
54], or transforming mutants of the Giα-subunits themselves [
55]. In line with this notion, we document herein that the Gi-protein coupled receptor agonist lysophosphatidic acid is a strong mitogen in HT-29 cells. This shows that Gi-protein dependent signals elicit CRC cell proliferation, as corroborated by the ability of PTX to block PGE2 or LPA induced proliferation (Fig.
4B and data not shown). The major intracellular effect of Gi-protein signalling is a down regulation of cAMP levels via the inhibition of adenylate cyclase, suggesting that inhibition of cAMP signalling is an important component of the proliferative signal elicited by low PGE2 doses. Indeed, several findings reported here argue for a role of reduced cAMP dependent signalling in this context: Firstly, the Gi-protein activator LPA induces, whilst the Gi-protein inhibitor PTX inhibits CRC cell proliferation. Secondly, mitogenic doses of PGE2 down regulate cAMP/PKA signalling. Thirdly, the cAMP-raising agent isoproterenol abolishes proliferation induced by LPA and 10 nM PGE2, and finally, the pharmacological profile of PGE2 dependent mitogenesis, based on the use of receptor specific agonists and antagonists, strongly points to a major role for the down regulation of cAMP levels via Gi-proteins in PGE2 driven proliferation.
While these data all point to a role of cAMP, it is important to note that Gi-proteins can activate mitogenic pathways independently of their effect on cAMP levels. For example, LPA and other agonists of Gi-protein coupled receptors activate the Ras/Erk pathway in fibroblasts and epithelial cells independently of their effect on cAMP [
56]. Several groups have documented an activation of Ras and/or its downstream target Erk by PGE2 in CRC cells [
18,
57,
58], although the extent of those effects was weak if compared to the consequences of Gi-protein-driven Ras/Erk activation in fibroblasts or epithelial cell lines of other origin. It has been proposed that transactivation of the EGFR mediates both Ras/Erk pathway activation and stimulation of cell growth by PGE2 in CRC cell lines [
18,
59,
60]. We have been unable to detect a significant stimulation of Ras or Erk activity by PGE2 in the cell lines studied here, even at longer time points of stimulation up to 3 h (data not shown). As a matter of fact, the cell lines studied here and in the studies referenced above do all harbour oncogenic K-Ras or B-Raf and a high constitutive activation of Erk (data not shown). In conclusion, we propose that PGE2 induces cell proliferation in CRC cells at least partly via the modulation of cAMP levels.
The prostanoid receptor subtype EP3 reportedly couples to heterotrimeric Gi-proteins and thus represents a candidate mediator of the effect of PGE2 on CRC cell proliferation. We document that HT-29 cells do express the EP3 receptor but EP3 expression appears to be tightly regulated. Removal of serum leads to the induction of EP3 expression whereas EP3 was virtually undetectable in cells kept in serum. Strikingly, among the four EP3 receptor splice variants detected in HT-29 cells, only those linked to Gi-proteins were up regulated in response to serum withdrawal, raising the question as to why CRC cells should choose to up regulate expression of G1-coupled receptors in the absence of proliferative signals. In this regard it will be intriguing to investigate how PGE2 itself regulates the expression of the distinct EP receptor isoforms and splice variants. A distinct profile of EP receptor subtypes could also explain the behaviour of SW480 cells, the only among 4 CRC cell lines studied here that did not respond to nano molar doses of PGE2 with enhanced proliferation. Interestingly, EP3 receptor levels are down regulated in colon cancer mucosa in comparison to healthy tissue [
26], indicating that EP3 expression may not be compatible with a high proliferative rate in those cells. We are intrigued by the possibility that EP3 expression may be generally linked to the proliferative state of the cell and could serve as a lever to finely adjust the proliferative rate of CRC cells. According to such a scenario, and within the context of colon cancerogenesis, PGE2 signalling via EP3 could be a priming step for CRC cell mitogenesis that becomes shut off at later time points as aberrant proliferation takes over.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
IL carried out all experiments. MG helped with FACS analysis. FDB participated in the design and coordination of the study. IR conceived the study, participated in its design and coordination and drafted the manuscript. All authors read and approved the final manuscript.