Background
Campylobacter jejuni is the main
Campylobacter species isolated from humans. The
C. jejuni reservoir consists essentially of the digestive tract of birds, including poultry. Transmission to humans occurs mainly indirectly via food or contaminated water [
1]. In humans, Campylobacters induce enteritis generally with a favourable evolution after a few days but with potential complications like systemic infections or post-infectious diseases (Guillain–Barré syndrome).
C. jejuni may also be involved in immunoproliferative small intestinal disease (IPSID) [
2] which belongs to the group of digestive mucosa associated lymphoid tissue (MALT) lymphomas.
In
Helicobacter pylori, a bacterium close to
C. jejuni, the role of gamma-glutamyl transpeptidase (GGT) has been extensively studied [
3‐
5]. GGT is an enzyme belonging to the family of N-terminal nucleophile hydrolases, present in prokaryotes and eukaryotes, playing a major role in the degradation of glutathione. GGTs of distant species (mammals and bacteria) often exhibit a high protein sequence identity (>25%) [
6,
7].
H. pylori GGT has been the subject of numerous studies. It is present in 100% of the strains and is constitutively expressed. It can reach the periplasmic space thanks to its signal peptide. It is synthesized as an inactive 60 kDa precursor which undergoes autocatalytic cleavage resulting in an active heterodimer composed of two subunits of 20 and 40 kDa respectively. The small subunit plays a key role in the autocatalytic and enzymatic activity of GGT; it includes the active site of the enzyme [
6,
8]. This enzyme is not essential to the bacteria, as
ggt gene deletion does not inhibit bacterial growth, but it provides an advantage in gastric colonization [
3].
H. pylori GGT also plays a role in the inhibition of T-lymphocyte proliferation by blocking the cell cycle in the G1 phase [
5]. In addition, several studies have shown that
H. pylori GGT has a proapoptotic effect on human gastric epithelial cells (AGS line) [
9‐
11].
C. jejuni GGT has been studied less. It is present in up to 31% of strains [
12] and has 67 to 69% of amino-acid identity with
H. pylori GGT. The cleavage site, the essential residues for enzymatic activity, substrate recognition and catalytic activity for
H. pylori GGT are conserved in
C. jejuni GGT. It allows
C. jejuni to metabolize glutamine and glutathione as a source of amino acids and possibly to persist in the intestine [
13]. A Finnish study showed that
C. jejuni GGT could be a marker of severity of infection, in particular for bloody diarrhea [
14].
In this study, we used phylogenetic and functional approaches to analyze C. jejuni GGT. We showed that C. jejuni GGT is related phylogenetically to Helicobacter GGTs and, like H. pylori GGT, C. jejuni GGT inhibits lymphocyte and epithelial cell proliferation. The inhibition observed was mediated by an apoptosis-independent mechanism, suggesting a conserved function among GGTs in Epsilonproteobacteria.
Discussion
Because of the conserved protein homology of C. jejuni GGT with H. pylori GGT, the objectives of the present study were to determine whether C. jejuni GGT had the same properties as H. pylori GGT to inhibit 1) epithelial cell proliferation via a pro-apoptotic mechanism and 2) human lymphocyte proliferation. These data could be strong arguments to better understand the pathogenicity of C. jejuni and to consider C. jejuni GGT as an important pathogenicity factor of this bacterium as well.
C. jejuni GGT was highly conserved among the
C. jejuni strains. As already shown by Skarp-de Haan CP
et al., [
15]
C. jejuni GGT was also very close to
Helicobacter GGTs, in particular those from
H. bilis,
H. canis and
H. trogontum, which suggests a conserved activity between these GGTs.
C. jejuni GGT was purified directly from culture supernatants. This technical approach allowed the isolation of the protein directly from the bacterium, avoiding any potential problems of protein solubility or refolding as described in a previous publication [
7].
In line with results concerning
H. pylori,
H. bilis, and
H. suis GGTs [
7,
10,
16,
17], an inhibition of epithelial cell proliferation was observed for
C. jejuni GGT. This biological activity seemed to be independent of the cell origin (gastric or intestinal). It has been suggested that
H. pylori and
H. suis GGTs exert their inhibitory activity indirectly via the formation of metabolites during transpeptidation [
5,
16]. This point should be investigated further for
C. jejuni GGT. Contrary to what has been described for
H. pylori and
H. suis GGTs [
9‐
11,
16], this inhibitory effect does not depend on a proapoptotic activity of
C. jejuni GGT.
H. pylori and
H. suis GGTs are indeed responsible for the apoptosis of human gastric epithelial cells (AGS cell line), via the activation of caspases 3 and 9, Bax, a decreased expression of anti-apoptotic proteins Bcl-2 and Bcl-xl, and the release of cytochrome c [
10,
11] or via the increase in H
2O
2 concentration due to glutathione catabolism by GGT [
16,
18]. A necrotic phenomenon was also described for
H. suis GGT. In the study of Shibayama
et al. fetal calf serum (FCS) deprivation in the culture medium was carried out before the apoptosis study [
9]. Therefore if the proapoptotic activity is detectable only under stress conditions, it may simply be a technical artifact. Finally, our results are similar to those of Rossi
et al. with
H. bilis[
7], which interestingly is one of most closely related phylogenetically to
C. jejuni GGT [
15].
The role of
C. jejuni GGT in the inhibition of lymphocyte proliferation with cell cycle arrest in the G0/G1 phase was also demonstrated in our study. This property is shared by
H. pylori,
H. bilis and
H. suis GGTs [
4,
5,
7,
19,
20]. As for
H. pylori GGT, the inhibition of lymphocyte proliferation is not dependent on an apoptotic phenomenon. Schmees
et al. showed that
H. pylori GGT acts on the cell cycle via a decrease in cellular levels of Ras-dependent track mediators [
5]. The cell cycle arrest in the G1 phase by
H. pylori GGT is characterized by an increase in p27 and CDK inhibitor levels and a decrease in cyclins. As for its activity on epithelial cells, GGT appears to have an indirect action via the metabolites formed during transpeptidation [
20]. These mechanisms have to be validated for
C. jejuni GGT.
Methods
Bacterial strains, cell lines, culture conditions
Eleven
C. jejuni strains named 2003–198, 2002–200, 2004–304, 2003–383, 2004–438, 2002–608, 2002–646, 2007–741, 2003–795, 2003–1129, and 2003–1206 were obtained from the National Reference Center on Campylobacters and Helicobacters (CNRCH) strain collection (Univ. Bordeaux, Bordeaux, France). They were received between 2002 and 2007. All of these strains were isolated from humans, essentially from faecal samples, and they were all identified at the species level by MALDI-TOF mass spectrometry [
22]. They belong to Lior biotype III (hippurate +, H
2S + and DNase -), in which the prevalence of GGT is more important (60% according to personal data) than in the other biotypes (15-20%). They were used to assess the diversity of GGT genetics in
C. jejuni. C. jejuni strain 81116 (a kind gift from Dr D. Newell) was used to purify GGT and to study
C. jejuni GGT activity on epithelial cells and lymphocytes. It was selected for its GGT activity, as previously described by Barnes
et al.[
21].
All strains were grown on horse blood agar (bioMérieux, Marcy l’Etoile, France) in a microaerobic atmosphere at 37°C. A microscopic control was systematically performed to check the morphology and mobility and standard bacteriological tests (Gram staining, catalase, oxidase) were carried out as well.
The human intestinal epithelial cell lines AGS (stomach cell line) and Caco-2 (colon cell line) were used. The AGS cells in RPMI medium (Invitrogen) supplemented with 10% FCS (Invitrogen) and 50 μg/mL of vancomycin (Sandoz, Levallois Perret, France) and the Caco-2 cells were grown in Modified Eagle’s Medium (MEM) (Invitrogen, Fisher Scientific SAS, Illkirch Cedex, France) supplemented with 1% Minimum Essential Amino Acids (MEAA) (Invitrogen).
Lymphocytes were purified from peripheral blood from hemochromatosis patients by Ficoll gradient with therapeutic phlebotomy performed regularly at the EFS (French Blood Establishment, Aquitaine-Limousin) (No. EFS CPS 10.41 Convention). Blood was collected in bags (MSE 6500 L) (Macopharma, Tourcoing, France) in the presence of an anticoagulant (sodium citrate).
Phylogenetic analysis
The
ggt genes of
C. jejuni strains 2003–198, 2002–200, 2004–304, 2003–383, 2004–438, 2002–608, 2002–646, 2007–741, 2003–795, 2003–1129, and 2003–1206 were amplified and sequenced using external and internal gene-specific primers (Table
2). The sequences obtained were translated into protein sequences using the EMBOSS software Transeq (
http://www.ebi.ac.uk/Tools/st/emboss_transeq/). GGT sequences of 5
C. jejuni strains for which the genome is completely sequenced, were selected:
C. jejuni strains 81116 [
23], 81176 [
24], M1 [
25], ICDCCJ07001 [
26] and
C. jejuni subsp. doylei strain 269.97 (RefSeq NC_009707.1). GGTs of 8 published
H. pylori strains were also selected: strains 26695 [
27], J99 [
28], HPAG1 [
29], 908 [
30], P12 [
31], Shi470 [
32], B38 [
33] and B45 [
34], as well as GGTs of
H. canis,
H. bilis,
H. trogontum, H. felis[
35],
H. salomonis,
H. suis[
36],
H. bizzozeronii[
37],
H. cetorum, H. acinonychis[
38] and
H. mustelae[
39] strains. GGT sequences of 2
Arcobacter species (related to
Campylobacter species) were added to our selection. Phylogenetic analysis of GGT amino-acid sequences was conducted in MEGA4 software using the Minimum Evolution (ME) method after alignment in the ClustalW2 software (
http://www.ebi.ac.uk/Tools/msa/clustalw2/) and 1,000 repetitions of this analysis [
40].
Table 2
Oligonucleotides used in this study
F-GGT (23 bp)
| GGGTAAATAAGAAGTTAGAATTC |
R-GGT (21 bp)
| CTTGATAAAGGCGGAAATGCC |
F1GGT (20 bp)
| TGCTTTGGCTGTAGTGCATC |
R1GGT (20 bp)
| TGCTTACAGCATTGCCTTTG |
F2GGT (20 bp)
| TAGGCTTTTTGCGGTGGTAG |
R2GGT (20 bp)
| CAGGAGATCCTGTGCCTGTG |
F3GGT (21 bp)
| TTATCGCAAAGGAAGGTCCTG |
R3GGT (20 bp)
| AGCATCAGGACCTTCCTTTG |
Nucleotide and protein sequences for the 11 C. jejuni GGTs sequenced in the present study are available in Genebank (EMBL) under the following accession numbers: KF985027, KF991209, KF991210, KF991211, KF991212, KF991213, KF991214, KF991215, KF991216, KF991217, KF991218 for the strains 2002–200, 2002–608, 2002–646, 2003–198, 2003–383, 2003–1129, 2003–1206, 2004–304, 2004–438, 2007–741, and 2003–795 respectively.
Enzyme assay for GGT activity
GGT enzymatic activity was determined by the spectrophotometric method described by Meister
et al.[
41]. The assay solution contained 20 mM of glycylglycine (Sigma Aldrich, Saint-Quentin Fallavier, France), 300 mM of L-γ-glutamyl-p-nitroanilide (Sigma Aldrich) and 60 mM of TRIS pH 8. The reaction mixture (5 μl of GGT in 200 μL of assay solution) was incubated at 37°C and analyzed by spectrophotometry at 405 nm to evaluate the release of p-nitroanilide (yellow compound). The activity of acivicin (Santa Cruz Biotechnology, Heidelberg, Germany), a pharmacological inhibitor of GGT, was also tested (10 μM) after a 2 h preincubation at 37°C as well as GGT heat inactivation at 70°C for 20 min
C. jejuni GGT purification
A bacterial supernatant of
C. jejuni 81116 was prepared by incubating the strain in 1 L of PBS overnight at 37°C with orbital shaking (150 rpm). After centrifugation at 10,000 rpm for 10 min, the supernatant was recovered. Solid ammonium sulfate (Sigma Aldrich) was added to the cell extract to 90% saturation, and the mixture was stirred at 4°C for 2 h. The precipitate was removed by centrifugation at 12,000 rpm for 30 min at 4°C and dissolved in 6 mL of dialysis buffer (TRIS 50 mM, NaCl 25 mM, pH 8). This solution was dialyzed twice against 1 L of the same buffer for 2 h and overnight at 4°C. The GGT activity was tested on 5 μL of the dialyzed solution according to the method of Meister
et al. described above [
41].
One mL of the dialyzed solution was applied to a MonoQ®HiTrap column (GE Healthcare, Aulnay sous Bois, France) equilibrated with 50 mM TRIS pH 8 (Buffer A). Elution was performed at a flow rate of 1 mL/min with a gradient of NaCl stepwise (0.08; 0.25; 0.35 and 1 M) in buffer A. 330 μl fractions were collected and tested for GGT activity as previously described. The active fractions were combined and SDS-PAGE was performed with 12% polyacrylamide running gel and 5% polyacrylamide stacking gel. After electrophoresis, the gel was stained with Coomassie blue.
The active fraction was then purified by a second ion exchange chromatography (MonoQ®HiTrap column, 1 mL, GE Healthcare). Elution was performed at a flow rate of 1 mL/min with a linear gradient of NaCl (0.08 to 0.5 M). The active fraction was not retained by the column and was eluted directly. SDS-PAGE and Coomassie blue staining were performed. The active fraction was precipitated with ammonium sulfate (90% saturation) at 4°C for 2 h. The precipitate was removed by centrifugation at 12,000 rpm for 30 min at 4°C and dissolved in 400 μL of dialysis buffer. This solution was dialyzed twice for 2 h each time against 500 mL of the same buffer at 4°C. SDS-PAGE and Coomassie blue staining were performed. The bands of interest were cut and analyzed by mass spectrometry at the Functional Genomics Platform of the University of Bordeaux. The protein concentration was determined spectrometrically using the Bradford method with bovine serum albumin (BSA) as a standard (Biorad, Marnes La Coquette, France). The GGT activity was again evaluated as described above.
Mass spectrometry
Sample preparation: Each SDS-PAGE band was cut into 1 mm × 1 mm gel pieces. Gel pieces were destained in 25 mM ammonium bicarbonate, 50% acetonitrile (ACN) and shrunk in ACN for 10 min. After ACN removal, gel pieces were dried at room temperature. Proteins were first reduced in 10 mM dithiothreitol, 100 mM ammonium bicarbonate for 30 min at 56°C then alkylated in 100 mM iodoacetamide, 100 mM ammonium bicarbonate for 30 min at room temperature and shrunk in ACN for 10 min. After ACN removal, gel pieces were rehydrated with 100 mM ammonium bicarbonate for 10 min at room temperature. Before protein digestion, gel pieces were shrunk in ACN for 10 min and dried at room temperature. Proteins were digested by incubating each gel slice with 10 ng/μl of trypsin (T6567, Sigma-Aldrich) in 40 mM NH4HCO3, 10% ACN, rehydrated at 4°C for 10 min, and finally incubated overnight at 37°C. The resulting peptides were extracted from the gel in three steps: an initial incubation in 40 mM ammonium bicarbonate, 10% ACN for 15 min at room temperature and two incubations in 47.5% ACN, 5% formic acid for 15 min at room temperature. The three collected extractions were pooled with the initial digestion supernatant, dried in a SpeedVac, and resuspended in 25 μL of 0.1% formic acid before nanoLC-MS/MS analysis.
NanoLC-MS/MS analysis: Online nanoLC-MS/MS analyses were performed using an Ultimate 3000 system (Dionex, Amsterdam, The Netherlands) coupled to a nanospray LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific, Bremen, Germany). Ten μL of each peptide extract were loaded on a 300 μm ID × mm PepMap C18 precolumn (LC Packings, Dionex, Sunnyvale, CA, USA) at a flow rate of 30 μL/min. After 5 min of desalting, peptides were separated on a 75 μm ID × 15 cm C18PepMap™ column (LC packings) with a 5-40% linear gradient of solvent B for 108 min (solvent A was 0.1 formic acid in 5% ACN and solvent B was 0.1% formic acid in 80% ACN). The separation flow rate was set at 200 nL/min. The mass spectrometer operated in a positive ion mode at a 1.8-kV needle voltage and a 27-V capillary voltage. Data were acquired in a data-dependent mode alternating an FTMS scan survey over the range m/z 300–1700 with the resolution set to a value of 60,000 at m/z 400 and 6 ion trap MS/MS scans with Collision Induced Dissociation (CID) as the activation mode. MS/MS spectra were acquired using a 3-m/z unit ion isolation window and normalized collision energy of 35. Mono-charged ions and unassigned charge-state ions were rejected from fragmentation. Dynamic exclusion duration was set to 30 sec.
Database search and results processing: Mascot and Sequest algorithms through Proteome Discoverer 1.4 Software (Thermo Fisher Scientific) were used for protein identification in batch mode by searching against a
C. jejuni UniProt database (44,546 entries). Two missed enzyme cleavages were allowed. Mass tolerances in MS and MS/MS were set to 10 ppm and 0.8 Da. Oxidation of methionine and carbamidomethylation on cysteine were searched as variable modifications. Peptide validation was performed using Percolator algorithm [
42] and only “high confidence” peptides were retained corresponding to a 1% false positive rate at peptide level.
C. jejuni GGT activity on epithelial cells
Cell proliferation: Epithelial cells were cultured in 96-well plates for 48 h. The effect of purified GGT on these lines was evaluated at different concentrations (2.5 to 320 ng/mL) after 24 h of treatment with the MTT Formazan kit (Sigma-Aldrich). GGTs, either preincubated for 2 h in the presence of acivicin or previously heat-inactivated (70°C, 20 min), were also tested.
Cell apoptosis: AGS cells were cultured in 24-well plates for 48 h. The pro-apoptotic effect of GGT (10 ng/mL) with and without acivicin after 24 h of treatment was evaluated using the Nicoletti method [
43]. Staurosporine (10 μM) (Sigma-Aldrich), a pro-apoptotic compound, was used as a positive control. Briefly, adherent cells were trypsinized, washed and centrifuged for 5 min at 3,000 rpm. The cell pellet was resuspended in 100 μL of Nicoletti buffer (0.1% sodium citrate, 0.1% Triton X-100, 50 mg/L of propidium iodide in distilled water). The FACS CantoII cytometer (BD Biosciences, Le Pont de Claix, France) was used for data acquisition.
C. jejuni GGT activity on lymphocytes
Lymphocytes were cultured in 24-well plates (1.10
6 cells/well) for 4 days at 37°C in a 5% CO
2 atmosphere in RPMI supplemented with 10% FCS and 50 μg/mL of vancomycin in the presence of purified GGT (10 ng/mL) with or without acivicin (10 μM), and heat-inactivated (70°C, 20 min) or not. The proliferative capacity of lymphocytes was monitored using phytohemagglutinin (PHA, 1 μg/mL) (Sigma Aldrich) and interleukin 2 (IL 2, 1000 U/mL) (Chiron, Surennes, France) [
19]. Lymphocyte proliferation was measured by BrdU incorporation (5 bromo 2′ deoxyuridine) (BD Biosciences) with flow cytometry (FACS CantoII) using a method previously validated in the laboratory [
19]. This incorporation was revealed using an anti-BrdU antibody coupled to the fluorochrome fluorescein isothiocyanate (FITC) (BD Biosciences). Stimulation of this fluorochrome by the laser cytometer allowed an analysis of the cells based on their size and density and a record of the proportion of those that have been specifically recognized by the anti-BrdU antibody. The results were analyzed using CellQuest (BD Biosciences) software and were used to determine the percentage of proliferated cells.
During the same experiment, the percentage of cells undergoing apoptosis and the cell cycle were both evaluated by the Nicolleti method. Lymphocytes were centrifuged for 10 min at 1,500 rpm and resuspended in 100 μl of Nicoletti buffer.
Statistical analysis
Statistical analyses were performed using the Mann–Whitney test (SPSS Version 16 software). This is a nonparametric test which is used to test the equality of distribution of two independent sets of values to be compared (p <0.05).
Acknowledgements
The authors thank Armelle Menard for advice in GGT purification and the Veterinary Laboratories Agency – Weybridge (New Haw, Addlestone, Surrey KT15 3NB, UK) and especially Dr Diane Newell for the kind gift of the C. jejuni strain 81116, and Lindsay Mégraud for English revision of the manuscript. A. Hocès de la Guardia received funding from the French Ministry of Research.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
PF, VPey, AHDLG and JWD performed the experiments. PF, PL, FM, JWD wrote the manuscript. PL, PF and MC designed the experiments. VPitard, MB supervised some of the data analysis. All authors read and approved the final manuscript.