Background
Dengue virus (DENV) infection poses a major public health threat that affects over 40% of the world’s population [
1]. Infection with any of four serotypes of DENV (i) can be asymptomatic; (ii) cause a self-limiting, mild febrile illness known as dengue fever; or (iii) cause life-threatening illnesses called dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) [
2,
3]. At present, the mechanism of DENV infection that leads to pathogenesis of DHF/DSS remains unclear.
DENV is a member of the flaviviruses in the family
Flaviviridae. It is a positive-sense, single-stranded, enveloped RNA virus that has previously been reported to enter different types of host cells, for example, dendritic cells, monocytes, endothelial cells and hepatocytes, through receptor-dependent mechanisms or antibody-dependent enhancement [
4-
7]. DENV polyprotein is encoded by the positive-strand viral RNA genome and processed in DENV-infected cells by viral and cellular proteases to generate three structural proteins (capsid, C; pre-membrane, prM; and envelope, E) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) [
8,
9]. Interactions of these viral proteins with several host cellular proteins play important roles in the entry, replication, assembly and egress of DENV, as well as cell signaling and immune escape from host responses during DENV infection, as reported previously [
10-
13].
hnRNP C1/C2 are abundant host cellular proteins among at least 20 members (hnRNP A-U) of the hnRNP family [
14,
15] that share common characteristics, but still possess a variety of domain compositions and functional properties. hnRNP C1/C2 differ by 13-amino acid residues after glycine 106 or serine 107 as a result of alternative mRNA splicing, and the longer isoform (C2) comprises ~25% of the total hnRNP C in the cells [
16,
17]. Both the hnRNP C isoforms contain an RNA recognition motif and a basic leucine zipper-like RNA-binding motif that bind RNA in the form of heterotetramers with three molecules of C1 and one molecule of C2 [
18,
19]. hnRNP C1/C2 are involved in mRNA biogenesis, transport and stability, as well as protein translation [
14,
15]. Normally, hnRNP C1/C2 reside mainly in the nucleus [
20]. However, certain cellular conditions (e.g., apoptosis, mitosis and virus infection) induce hnRNP C1/C2 to translocate from the nucleus to the cytoplasm [
21-
25]. hnRNP C1/C2 were previously identified as DENV NS1-interacting host partners but the role of their association remained undefined [
26]. Additionally, hnRNP C1/C2 have been found to interact with vimentin, an intermediate filament supporting cell integrity, which is recruited to the perinuclear region with dense structural rearrangement during DENV infection, and is necessary for the infection process [
27-
29].
To explore the potential involvement of hnRNP C1/C2 in DENV replication, we employed an in vitro study using the hepatocyte Huh7 cell line for DENV infection and specific siRNA-mediated gene knockdown. Effects of hnRNP C1/C2 knockdown on different events in DENV infection and replication have been investigated.
Discussion
hnRNP C1/C2 are RNA-binding host cellular proteins that play important roles in replication of certain positive-strand RNA viruses such as poliovirus and hepatitis C virus (HCV) [
30-
33]. Nevertheless, their functional contribution to DENV replication remains largely unexplored. The present study used an
in vitro model of Huh7 cells for DENV infection and specific siRNA-mediated gene knockdown to investigate the potential involvement of hnRNP C1/C2 in the process of DENV infection. We demonstrated an association between hnRNP C1/C2 and viral RNA in DENV-infected Huh7 cells. A significant knockdown of hnRNP C1/C2 proteins following specific siRNA transfection affected DENV infection by decreasing viral RNA replication, viral protein synthesis and subsequent production of infectious virus.
hnRNP C1/C2 are abundant host cellular proteins found predominantly in the nucleus, but they can translocate to the cytoplasm under certain conditions [
20-
25]. Active export of hnRNP C1/C2 to the cytoplasm was triggered by tumor necrosis factor-α or phorbol 12-myristate 13-acetate (PMA)-mediated apoptosis through activation of Rho-associated kinase [
22]. The presence of hnRNP C1/C2 in the cytoplasm was also observed during mitosis upon nuclear membrane breakdown in late G2/M phase of the cell cycle [
25]. Additionally, cytoplasmic re-localization of hnRNP C1/C2 has been found in rhinovirus, poliovirus and vesicular stomatitis virus infections, through inhibition of nuclear import and changes in the composition of nuclear pore complexes [
21,
23] or enhanced nuclear export of the proteins [
24]. A previous study of DENV infection demonstrated the presence of hnRNP C1/C2 predominantly in the nuclear fraction, and to a lesser degree in the cytoplasmic fraction of virus-infected EA.hy926 cells, using a subcellular fractionation assay [
28]. This finding was consistent with the detection of hnRNP C1/C2 in the cytoplasm by immunofluorescence staining in DENV-infected HEK 293T cells [
26] and DENV-infected Huh7 cells (data not shown). However, no difference in the pattern of subcellular localization of hnRNP C1/C2 between mock-infected and DENV-infected cells was observed [
26].
Specific siRNA transfection resulted in a significant decrease in hnRNP C1/C2 at both mRNA and protein levels (Figure
2A and B). As demonstrated by immunofluorescence staining of DENV E antigen, the hnRNP C1/C2 knockdown reduced the percentage of cells expressing this viral protein (Figure
5). This effect was unlikely due to a direct hindrance at the initial step of DENV binding and entry into the cells, because hnRNP C1/C2 were undetectable on the cell surface (data not shown). Rather, it probably resulted from multiple downstream processes within the DENV replication cycle that led to a signification decrease in DENV production (Figure
8). Using real-time RT-PCR, delayed kinetics of viral RNA synthesis were observed in DENV-infected cells following hnRNP C1/C2 knockdown, particularly with a significant reduction of viral RNA accumulation at 36 h post-infection (Figure
4). This suggested a potential contribution of hnRNP C1/C2, in association with viral RNA, to facilitate the RNA replication process of DENV. Similar findings on the role of hnRNP C1/C2 in virus replication have been reported in other positive-strand RNA viruses such as poliovirus and HCV [
30-
33]. hnRNP C1/C2 have been shown to interact with 5′- and 3′-ends of poliovirus negative-strand RNA intermediate and with poliovirus protein precursors, which are essential for virus replication; that is, 3CD (a precursor of viral RNA-dependent RNA polymerase), P2 and P3 (precursors of nonstructural proteins), hence promoting viral replication complex assembly and viral RNA synthesis of poliovirus [
31-
33]. Moreover, hnRNP C1/C2, accompanied by polypyrimidine-tract binding protein (PTB or hnRNP I), bind to the pyrimidine-rich region within the 3′-untranslated region (UTR) of HCV RNA and initiate and/or regulate HCV replication [
30]. The detailed mechanism whereby hnRNP C1/C2 associate with viral RNA in DENV-infected cells is not known. It might be that this interaction functions, in concert with other viral and host proteins, to assist the structural formation of the viral replication complex required for DENV replication.
hnRNP C1/C2 have previously been found to interact with vimentin and viral NS1 in DENV-infected cells and disruption of vimentin results in reduced cell-associated DENV NS1 expression and DENV production [
28]. In support of these findings, the present study revealed that hnRNP C1/C2 knockdown diminished the expression of DENV NS1 and E proteins in DENV-infected cells (Figure
6). Whether the hnRNP C1/C2 knockdown may alter the presence of vimentin in the intracellular milieu is of interest but has not been assessed in our study. It was possible that hnRNP C1/C2 proteins may support viral RNA stability, leading to efficient DENV protein expression. Previous studies have demonstrated that binding of hnRNP C1/C2 with 3′-UTR of amyloid precursor protein mRNA and urokinase receptor mRNA increase the stability of mRNAs [
34,
35]. Furthermore, hnRNP C1/C2 function as translational modulators to regulate protein expression, most likely through their specific binding to polyuridine-rich regions of RNA, some of which may have internal ribosome entry site (IRES) activity [
14]. Interactions of hnRNP C1/C2 with IRES of c-myc mRNA, c-cis mRNA, upstream of N-Ras (UNR) mRNA and X-linked inhibitor of apoptosis (XIAP) mRNA stimulate IRES-mediated translation, thus resulting in increased protein expression [
25,
36-
38]. Unlike poliovirus and HCV, 5′-UTR of DENV genome does not possess IRES activity, and translation of DENV occurs by non-IRES-mediated mechanisms through canonical cap-dependent and noncanonical cap-independent processes [
39]. In our study, knockdown of hnRNP C1/C2 did not show a direct effect on DENV protein translation as demonstrated by the DENV luciferase reporter assay (Figure
7A and B). As a consequence, the reduced viral protein expression following knockdown of hnRNP C1/C2 observed in this study likely resulted from a reduction of viral RNA templates generated during DENV replication rather than direct influence on viral translation.
Following viral RNA replication and protein translation, assembly of DENV particles occurs in the ER. Immature viruses are subsequently transported along the secretory pathway to the trans-Golgi network for further modification, before release into the extracellular milieu [
9,
40]. In our study, determination of DENV titers in the culture supernatant demonstrated a significant reduction of infectious virus production from DENV-infected cells upon hnRNP C1/C2 knockdown (Figure
8). This may have been the consequence of decreased levels of viral RNA and protein syntheses in DENV-infected knockdown cells. The suppressive effects of hnRNP C1/C2 knockdown on viral RNA replication and protein expression and infectious virus production were unlikely to have resulted from induction of cell death and inhibition of cell proliferation owing to hnRNP C1/C2 knockdown. No significant differences in cell viability and total numbers of cells were observed between control siRNA and hnRNP C1/C2-specific siRNA transfection (Figure
3). However, it should be noted that the total number of hnRNP C1/C2 knockdown cells seemed to be slightly lower than that of control cells at 48 h post-infection. These observations were in line with a previous report in HEK 293T cells showing that hnRNP C1/C2 knockdown did not enhance cell death but affected cell growth at 72 and 96 h post-culture, by impairment of cell cycle progression and accumulation of cells in the G2/M phase [
37]. Therefore, it is possible that the consequences of hnRNP C1/C2 knockdown on the process of DENV replication may occur through direct interaction of hnRNP C1/C2 with DENV RNA and/or through their effects on other cellular activities. The role of hnRNP C1/C2 in DENV replication deserves further investigation to explore molecular mechanisms in detail. Future study may also be extended to other types of target cells, such as monocytes and macrophages in primary infection and antibody-dependent enhancement condition, to assess whether hnRNP C1/C2 have any effect on host cellular response to DENV infection.
Materials and methods
Cell lines, virus, and antibodies
Human hepatocellular carcinoma (Huh7) cells were obtained from JCRB Cell Bank (Osaka, Japan) and cultured in RPMI 1640 (Gibco, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Sigma, St. Louis, MO, USA), 1% non-essential amino acid (NEAA; Gibco), 37 μg/ml penicillin (Sigma) and 60 μg/ml streptomycin (Sigma) at 37°C in a 5% CO
2 incubator with a humidified atmosphere. Propagation of DENV serotype 2 (strain 16681) was performed in C6/36 mosquito cells. Mouse monoclonal antibodies specific for DENV NS1 (clone NS1-3 F.1) and DENV E (clones 3H5 and 4G2) were produced from previously established hybridoma cells [
41-
43]. Mouse monoclonal antibodies specific for human hnRNP C1/C2 (clone 4 F4) and human β-actin (clone C4) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Mouse isotype-matched control IgG1 antibody (clone MOPC 21) was purchased from Sigma.
Immunoprecipitation of hnRNP C1/C2 proteins
Huh7 cells (5 × 106) were seeded into a T-75 cm2 flask (Costar, Cambridge, MA, USA) and cultured for 24 h. The adherent cells were incubated with DENV-2 at a multiplicity of infection (MOI) of 0.5 in the culture medium at 37°C in a 5% CO2 incubator for 2 h. The supernatant containing DENV was discarded and the culture was maintained in fresh medium under the conditions described above. At 48 h post-infection, uninfected cells (mock control) and DENV-infected Huh7 cells were harvested and clear lysates were prepared by resuspending cell pellets with RIPA buffer containing 20 mM Tris–HCl, pH 7.4, 5 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, and 0.5% deoxycholate with protease inhibitor cocktail (Roche, Mannheim, Germany), then incubated on ice for 30 min and centrifuged at 9100 g at 4°C for 5 min. The clear lysates were subjected to immunoprecipitation by incubating with 5 μg mouse isotype-matched control IgG1 antibody or mouse anti-hnRNP C1/C2 antibody (clone 4 F4, IgG1) at 4°C overnight. Thereafter, the samples were incubated with 50% slurry protein-G-conjugated sepharose 4B beads (GE Healthcare, Uppsala, Sweden) at 4°C for 2 h followed by centrifugation at 15,300 g at 4°C for 5 min, and three washes with RIPA buffer. The immunoprecipitated complexes were eluted with nonreducing buffer and subjected to immunoblotting analysis to determine the presence of hnRNP C1/C2 proteins. Alternatively, the immunoprecipitated complexes on the beads were directly processed for RNA extraction and subsequent reverse transcriptase polymerase chain reaction (RT-PCR) for determination of DENV RNA.
Huh7 cells were seeded onto a 24-well plate in medium without antibiotics (maintenance medium) at a concentration of 9 × 104 cells/well. Fifteen hours later when the cells reached ~50% confluence, the medium was replaced with fresh RPMI medium and the cells were transfected with duplex hnRNP C1/C2-specific siRNA (siGENOME SMARTpool Human HNRNPC M-011869-01; Dharmacon, Lafayette, CO, USA) or duplex irrelevant siRNA (Stealth RNAi negative control medium GC; Invitrogen, Carlsbad, CA, USA), which is designed to minimize sequence homology to any known vertebrate transcript, using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. After 6 h incubation with siRNA (114 nM), the cells were supplemented with maintenance medium and incubated for a further 18 h. The second round of siRNA transfection was performed using a similar approach to that described above. To test the effects of hnRNP C1/C2 knockdown on DENV infection, cells that had been subjected to the second round of siRNA transfection for 6 h were incubated with DENV-2 at MOI 0.03 or maintenance medium (mock control) for 2 h. The cells were washed twice and cultured in maintenance medium. The time interval between initial transfection and DENV infection was 32 h. At 0, 12, 24, 36 and 48 h post-infection, mock-infected and DENV-infected cells and their culture supernatants were collected. The total number of viable cells was enumerated using trypan blue (Gibco) exclusion dye assay. The percentage of dead cells was assessed by staining with propidium iodide (PI) at a final concentration of 2 ng/μl for 15 min at 4°C and subsequent flow cytometric analysis. Aliquots of the cells were processed for immunoblotting analysis, real-time RT-PCR, and immunofluorescence staining, and the culture supernatants were subjected to a focus forming unit (FFU) assay as described below.
Immunoblotting analysis
Clear lysates or immunoprecipitated samples prepared from mock-infected and DENV-infected cells that were untransfected or transfected with siRNA were mixed with 4× loading buffer [50 mM Tris–HCl (pH 6.8), 2% SDS, 0.1% bromophenol blue and 10% glycerol] with or without 5% β-mercaptoethanol and heated at 95°C for 5 min. Proteins in the samples were subjected to 10% SDS-PAGE and transferred to PVDF membranes (Millipore, Billerica, MA, USA) as previously described [
26]. The membranes were incubated with 5% skim milk in PBS or in Tris-buffered saline with 0.05% Tween 20 (TBST) for 1 h to block nonspecific binding and then with mouse monoclonal antibodies specific for DENV NS1 (clone NS1-3 F.1), DENV E (clone 4G2), human hnRNP C1/C2 (clone 4 F4) and human β-actin (clone C4) at 4°C overnight. The membranes were washed three times with PBS or TBST and incubated with HRP-conjugated rabbit anti-mouse immunoglobulin antibody (DAKO) at a dilution of 1:1000 for 1 h at room temperature, followed by a further three washes. Immunoreactive proteins were visualized using an enhanced chemiluminescence detection kit (Western Lightning Chemiluminescence Reagent Plus; Perkin Elmer Applied Biosystems, Foster City, CA, USA). Relative levels of human hnRNP C1/C2, DENV NS1 and DENV E protein expression were assessed by normalization of their protein band intensities to human β-actin intensity using GeneTools software from Syngene (Cambridge, UK).
Determination of DENV RNA in immunoprecipitated complexes
RNA was extracted from immunoprecipitated complexes captured on protein G sepharose beads by TRIzol reagent (Invitrogen) and subjected to reverse transcription using SuperScript III Reverse Transcriptase (Invitrogen) according to the manufacturer’s protocol, with the NS1-R primer (Table
1). The resultant cDNA was used as a template for amplification of DENV NS1 region with the NS1-F and NS1-R primers (Table
1) using Biometra TGradient Thermal Cycler (Biometra GmbH, Goettingen, Germany). A 25-μl reaction contained cDNA template, 1× Green GoTaq Flexi Reaction Buffer (Promega, Madison, WI, USA), 2.5 mM MgCl
2, 0.2 mM dNTPs, and 0.4 μM primers NS1-F and NS1-R, 0.5 U Taq DNA polymerase (Promega) in deionized water. The PCR reaction was preheated at 94°C for 5 min and processed through 35 cycles of denaturation (94°C, 30 s), annealing (48°C, 30 s) and extension (72°C, 1 min 30 s), as well as a final extension at 72°C for 10 min. The PCR products were electrophoresed in 1.5% SeaKem LE Agarose gel (Cambrex Bio Science; Rockland, ME, USA) and visualized by Gene Genius Bio Imaging system (Syngene).
Table 1
Oligonucleotide primers for reverse transcription-PCR
NS1-F | Sense | 5′ CCGGCCAGATCTGATAGTGGTTGCGTTGTGAGC 3′ |
NS1-R | Antisense | 5′ GATCGATCGCGGCCGCTTAGGCTGTGACCAAGG AGTTAACCAAATTCTCTTCTTTCTC 3′ |
hnRNP C1/C2-F | Sense | 5′ TCGAAACGTCAGCGTGTATC 3′ |
hnRNP C1/C2-R | Antisense | 5′ TCCAGGTTTTCCAGGAGAGA 3′ |
DEUR | Antisense | 5′ GCTGTGTCACCCAGAATGGCCAT 3′ |
D2L | Sense | 5′ ATCCAGATGTCATCAGGAAAC 3′ |
D2R | Antisense | 5′ CCGGCTCTACTCCTATGATG 3′ |
actin-F | Sense | 5′ AGAAAATCTGGCACCACAAA 3′ |
actin-R | Antisense | 5′ CTCCTTAATGCTACGCACGA 3′ |
Real-time RT-PCR for measurement of hnRNP C1/C2 mRNA and DENV RNA
RNA was extracted from DENV-infected cells that were transfected with irrelevant siRNA or hnRNP C1/C2-specific siRNA by TRIzol reagent (Invitrogen). Reverse transcription was performed using 62.5 ng total RNA and SuperScript III Reverse Transcriptase (Invitrogen) or AMV Reverse Transcriptase (Promega), according to the manufacturer’s instructions with minor modifications. Oligo(dT) 20 primer and DEUR primer (Table
1) were used to synthesize cDNA templates for determination of human hnRNP C1/C2 and β-actin mRNA as well as DENV RNA, respectively. The resultant cDNA was used as a template for real-time PCR according to the manufacturer’s instructions for Light Cycler 480 SYBR Green I master mix (Roche, Mannheim, Germany), using primer pairs specific for human hnRNP C1/C2 and β-actin as well as DENV E (D2L and D2R) (Table
1). Real-time PCR was performed by LightCycler 480 II (Roche) with: (i) pre-incubation at 95°C for 10 min; (ii) 45 amplification cycles of denaturation at 95°C for 10 s, annealing at 62°C for 10 s, and extension at 72°C for 20 s; and (iii) melting curve and cooling steps as recommended by the manufacturer. Relative levels of human hnRNP C1/C2 mRNA expression were determined by normalization to the expression levels of human actin according to the 2
–ΔΔCt method [
44]. Standard DENV RNA with known concentration (copy number/μl) that was subjected to the same reverse transcription and real-time PCR processes was used as a control for determining the amount of viral RNA in DENV-infected cells.
Immunofluorescence staining for the detection of DENV E antigen
To determine the percentage of DENV infection, mock-infected and DENV-infected cells that were transfected with irrelevant siRNA or hnRNP C1/C2-specific siRNA were fixed with 4% paraformaldehyde in PBS, smeared on a glass slide, and left to air dry for 30 min at room temperature. The cells were permeabilized with 0.2% Triton X-100 for 10 min at room temperature and incubated successively with mouse anti-DENV E monoclonal antibody (clone 3H5) for 1 h at room temperature and Alexa-Fluor-488-conjugated goat anti-mouse IgG antibody (Invitrogen) at a dilution of 1:1,000 for 30 min at room temperature. The stained cells were visualized by a confocal laser-scanning microscope (LSM 510 Meta, Carl Zeiss, Jena, Germany).
Viral translation assay
A DENV-2 reporter construct was generated by cloning T7 promoter, DENV-2 5′-UTR, the first 72 nucleotides of DENV-2 capsid-coding sequence, firefly luciferase gene and DENV-2 3′-UTR into pGL3-Basic (Promega) according to a previously described method [
45]. Resultant viral reporter construct (namely pGL3-DENV2-5′UTR-72ntC-Fluc-3′UTR) and pRL-SV40 vector (Promega), which contains
Renilla luciferase gene and serves an internal control reporter construct, were linearized with
XbaI. One μg of purified DNA was subjected to
in vitro transcription using the RiboMAX Large Scale RNA Production System-T7 (Promega) in the presence of 20 mM m
7G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs, Ipswich, MA, USA) and resultant RNA product was purified using RNeasy Mini Kit (QIAGEN, Hilden, Germany). To determine the effect of hnRNP C1/C2 knockdown on DENV translation, Huh7 cells were transfected twice with hnRNP C1/C2-specific siRNA or control siRNA (286 nM each) in a 96-well plate within a 24-h interval using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. After the second round of siRNA transfection, cells were co-transfected with 21 nM DENV reporter RNA and 2.1 nM control reporter RNA using Lipofectamine 2000 (Invitrogen) followed by replacement with fresh culture medium at 4 h later. Following 12 h after transfection with viral and control reporter RNA, cells were harvested and determined for firefly and
Renilla luciferase expression using Dual-Luciferase Reporter Assay System (Promega). Both firefly and
Renilla luciferase signals were measured by Synergy H1 Hybrid multi-mode microplate reader (BioTek, Winooski, VT, USA). Cells that had been similarly processed in the absence of reporter RNA served as background controls for luciferase assay. Additionally, reporter RNA-transfected cells that were treated with 286 nM DENV capsid-specific siRNA known to reduce the production of viral protein and infectious virus [
46] or with 50 μM cycloheximide, an inhibitor of protein translation, were included in the assay to serve as positive controls for inhibition of protein translation.
Supernatants collected from cultured DENV-infected cells that had been transfected with irrelevant siRNA or hnRNP C1/C2-specific siRNA were assessed for the production of infectious DENV. Vero cells were seeded onto a 96-well plate (Costar) at 2.5 × 104 cells/well in minimal essential medium (MEM) supplemented with 10% FBS, 2 mM L-glutamine, 36 μg/ml penicillin and 60 μg/ml streptomycin, and cultured at 37°C in a 5% CO2 incubator for 24 h to obtain ~90% confluence of the cell monolayer. The medium was removed from each well. DENV was serially diluted 10-fold in MEM containing 3% FBS, 2 mM L-glutamine, 36 μg/ml penicillin and 60 μg/ml streptomycin, added to each well (100 μl/well) and incubated at 37°C in a 5% CO2 incubator for 2 h. Overlay medium (MEM containing 3% FBS, 10% tryptose phosphate broth and 1.5% gum tragacanth) was added to each well (100 μl/well), and the culture was incubated for a further 3 days under the same conditions. On the third day post-infection, the medium was discarded from DENV-infected cells and the adherent cells were washed three times with PBS (pH 7.4). The cells were fixed with 3.7% formaldehyde (BDH Laboratory Supplies, Poole, UK) in PBS at room temperature for 10 min followed by an additional 10 min of permeabilization with 1% Triton X-100 (Fluka, Steinheim, Switzerland). The cells were incubated sequentially with mouse anti-DENV E monoclonal antibody (clone 4G2) at room temperature for 1 h and HRP-conjugated rabbit anti-mouse Igs (DAKO) at a dilution of 1:500 in PBS containing 2% FBS and 0.05% Tween-20 in the dark at room temperature for 30 min. To develop an enzymatic reaction, the cells were incubated with a substrate solution containing 0.6 mg/ml diaminobenzidine (DAB), 0.03% H2O2 and 0.08% NiCl2 in PBS at room temperature in the dark for 5 min. After three washes with PBS, dark brown foci of the DENV-infected cells were counted under a light microscope. Virus titers were reported as FFU/ml from the duplicated samples.
Statistical analysis
Relative levels of hnRNP C1/C2 mRNA and protein expression, cell viability, cell proliferation, percentage DENV infection, amount of DENV RNA, relative levels of DENV NS1 and E proteins, relative luciferase expression, and titers of infectious DENV were statistically analyzed by unpaired t test, with the use of GraphPad Prism version 5.0. Results were expressed as mean and standard error of the mean (SEM) and p < 0.05 was considered significant.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
TD, TL, PY and SN conceived of the study and participated in its experimental design. TD, PS, SS and SN performed the experiments and analyzed the data. TL, CP, WK and PY contributed reagents, materials and/or analysis tools. TD and SN wrote the manuscript. All authors read and approved the final version of the manuscript.