Skip to main content
main-content

01.12.2017 | Research | Ausgabe 1/2017 Open Access

Molecular Cancer 1/2017

Role of the lncRNA ABHD11-AS1 in the tumorigenesis and progression of epithelial ovarian cancer through targeted regulation of RhoC

Zeitschrift:
Molecular Cancer > Ausgabe 1/2017
Autoren:
Dan-Dan Wu, Xi Chen, Kai-Xuan Sun, Li-Li Wang, Shuo Chen, Yang Zhao
Wichtige Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12943-017-0709-5) contains supplementary material, which is available to authorized users.

Abstract

Background

There is increasing evidence in support of the role of lncRNAs in tumor cell proliferation, differentiation and apoptosis.

Methods

We examined the expression of the lncRNA ABHD11-AS1 in epithelial ovarian cancer (EOC) tissues and normal ovarian tissues by real-time quantitative PCR (qRT-PCR). After inducing ABHD11-AS1 downregulation by small interfering RNA (siRNA) or ABHD11-AS1 overexpression by plasmid transfection, we examined the EOC cell phenotypes and expression of related molecules.

Results

Expression of the lncRNA ABHD11-AS1 in EOC tissues was higher than that in normal ovarian tissue. It was positively associated with the tumor stage (stage I/II vs. stage III/IV), and it was lower in the well-differentiated group than in the poorly/moderately differentiated group. Overexpression of ABHD11-AS1 in the ovarian cancer cell lines A2780 and OVCAR3 promoted ovarian cancer cell proliferation, invasion and migration, and inhibited apoptosis. Silencing of ABHD11-AS1 had the opposite effect. Subcutaneous injection of tumor cells in nude mice showed that ABHD11-AS1 could significantly promote tumor growth. In addition, intraperitoneal injection of tumor cells in the nude mice resulted in an increase in the metastatic ability of the tumor. Further, overexpression of ABHD11-AS1 upregulated the expression of RhoC and its downstream molecules P70s6k, MMP2 and BCL-xL. Silencing of ABHD11-AS1 had the opposite effect. The RNA pull-down assay showed that ABHD11-AS1 can combine directly with RhoC. Silencing of RhoC was found to inhibit the cancer-promoting effects of lncRNA ABHD11-AS1. Thus, it seems that RhoC is a major target of the lncRNA ABHD11-AS1.

Conclusions

This is the first study to demonstrate the role of RhoC in the tumor-promoting effects of the lncRNA ABHD11-AS1. The present findings shed light on new therapeutic targets for ovarian cancer treatment.
Zusatzmaterial
Additional file 1: Table 1. ABHD11-AS1 expression in normal ovary and ovarian carcinoma tissues. Table 2. Correlation of ABHD11-AS1 expression with different clinicopathological features of ovarian carcinoma. Table 3. The ABHD11-AS1 sequence was CTCGAGTGAAGACGGAAATGGGCGGGGCTGCGAGCTAGGGCGGGAGAAGGAGCGCGGGGAGGACGTACCTTGTGAGATGCGAGCCGGCCAACAGCTTGCAAGCATGCTCCGCTGGACCCGAGCCTGGAGGCTCCCGCGTGAGGGACTCGGCCCCCACGGCCCTAGCTTCGCGAGGGTGCCTGTCGCACCCAGCAGCAGCAGCGGCGGCCGAGGGGGCGCCGAGCCGAGGCCGCTTCCGCTTTCCTACAGGCTTCTGGACGGGGAGGCAGCCCTCCCGGCCGTCGTCTTTTTGCACGGGCTCTTCGGCAGCAAAACTAACTTCAACTCCATCGCCAAGATCTTGGCCCAGCAGACAGGCCGTGCTGACGGTGGATGCTCGTAACCACGGTGACAGCCCCCACAGCCCAGACATGAGCTACGAGATCATGAGCCAGGACCTGCAGGACCTTCTGCCCCAGCTGGGCCTGGTGCCCTGCGTCGTCGTTGGCCACAGCATGGGAGGAAAGACAGCCATGCTGCTGGCACTACAGAGGGTGAGCCGCCCATGTCTGGGGCCTCCTCCCATTCAGTATATACCCTGAGGGCCCTGCAGGCAACCTGGGACTCACATGATCGTTGGATGACCAAGTTCAGGCTCCAGGAGCCATGCCTGAGACTCCCTATGTCTGCCTAAGACTGGTCCCAGTTCGGTTCTCTCCCACAGCCAGAGCTGGTGGAACGTCTCATTGCTGTAGATATCAGCCCAGTGGAAAGCACAGGTGTCTCCCACTTTGCAACCTATGTGGCAGCCATGAGGGCCATCAACATCGCAGATGAGCTGCCCCGCTCCCGTGCCCGAAAACTGGCGGATGAACAGCTCAGTTCTGTCATCCAGGACATGGCCGTGCGGCAGCACCTGCTCACTAACCTGGTAGAGGTAGACGGGCGCTTCGTGTGGAGGGTGAACTTGGATGCCCTGACCCAGCACCTAGACAAGATCTTGGCTTTCCCACAGAGGCAGGAGTCCTACCTCGGGCCAACACTCTTTCTCCTTGGTGGAAACTCCCAGTTCGTGCATCCCAGCCACCACCCTGAGATTATGCGGCTCTTCCCTCGGGCCCAGATGCAGACGGTGCCGAACGCTGGCCACTGGATCCACGCTGACCGCCCACAGGACTTCATAGCTGCCATCCGAGGCTTCCTGGTCTAAGAGTTGCTGGCAAGAAGATGGCCGGGCGTGGTGGCTCATGCCTGTAATTCCAGCACTTTGGGAGGCTAAGGCGGGAGGATGACTTGAGGCCAGGAGTTGGAGACCAGCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATACAAAAATTAGCCTGGCGTGGTGGTGCACACCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATCACTTGAACCCTGGAGGCAGAGGTTGCAATGAGCCGAGATCACACCACTACACTCCAGCCTAGGCAACAGAGCAAGACTCTGTCTCAAAAAAAACAAAACAAAAAGGAGGCACAAAACCCCAGGCTTCAAGTCTCTGCAGCCTGCTCCACATTTGGGCACAGAAGGACTCAGACAGGCACTGTGTGGGCACGAGGTTTTACAGGGGTGGTCAGACCTCAGGCTTTAATGAATAAAGACACTACTCCCAAAGGTACC. (DOCX 21 kb)
12943_2017_709_MOESM1_ESM.docx
Literatur
Über diesen Artikel

Weitere Artikel der Ausgabe 1/2017

Molecular Cancer 1/2017 Zur Ausgabe

Neu im Fachgebiet Onkologie

Mail Icon II Newsletter

Bestellen Sie unseren kostenlosen Newsletter Update Onkologie und bleiben Sie gut informiert – ganz bequem per eMail.

Bildnachweise