Introduction
Cardiac fibrosis is a worldwide problem which still lack efficacious treatment and is characterized by net accumulation of extracellular matrix (ECM, mainly containing Collagen 1 and Collagen 3) in myocardium [
1]. Myofibroblasts are effector cells for cardiac fibrosis and characterized by appearance of α-smooth muscle actin (α-SMA) stress fibers [
2,
3].
Evidence indicates that p38 mitogen-activated protein kinase (p38 MAPK) is a significant intracellular signaling pathway involved in cardiac remodeling and maladaptive processes post MI [
4,
5]. Activation of p38 could cause proliferation, differentiation, secretion of collagen fibers in myocardial fibroblasts, ultimately leading to myocardial fibrosis [
6].
Dual-specificity phosphatases (DUSPs) have recently drawn significant attention in cardiomyopathy, especially DUSP1 and DUSP4 [
7]. Previous studies have proved DUSP4 gene deletion promoted p38 phosphorylation in heart tissues, while have no effect on JNK or ERK1/2 [
7].
Histone deacetylases (HDACs), a class of epigenetic modification enzymes, could cause histones to wrap DNA more tightly and result in inhibition of gene transcription. Recent studies have shown that activation of HDACs was associated with pathologic cardiac remodeling and other cardiac abnormality [
8]. Zolinza®, also known as Suberoylanilide hydroxamic acid (SAHA, a HDAC inhibitor), has been proved to have anti-fibrotic effect in both bleomycin-induced pulmonary fibrosis and chlorhexidine gluconate-induced peritoneal fibrosis in mice [
9,
10]. However, the role SAHA and HDAC1 could play in cardiac anti-fibrotic effect has not been elucidated.
In this study, we firstly confirmed that SAHA significantly suppressed cardiac fibrosis and posed as a promising anti-fibrotic reagent for treating cardiac fibrosis. We explored whether the anti-fibrotic effect of SAHA is mediated by stimulating DUSP4 to inactivate p38 MAPK signaling pathway. And we employed a well-accepted myocardial infarction (MI) injury model and investigate on the role of HDAC1 in DUSP4/p38 pathway using HDAC1 siRNA in fibroblasts isolated from neonatal mice.
Materials and methods
Study animals and MI model constructing
Male C57BL5 mice were obtained from Charles River, China. Mice were anesthetized with isoflurane and placed on a heating pad (37 °C). The heart was exposed through a left thoracotomy. For sham group, mice underwent the same procedure without occlusion of the LAD. Mice were given SAHA solution at concentration of 15 mg/kg [
9] or equal volume of DMSO by intraperitoneal injection once a day after MI surgery from day 2 to 28.
Cardiac fibroblasts isolation, cell culture and treatment with TGF-β1
Primary cardiac fibroblasts were isolated from neonatal mouse hearts. Ventricles were isolated and washed in PBS medium and transferred to a solution of 0.8 mg/mL collagenase type II (Worthington Labs) with agitation for 40 min. The cells were collected after centrifugation and strained through a 70-μm filter, then plated on a 10-cm dish for 1 h.
Cardiac fibroblasts were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, USA), supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, 2 mM L-glutamine, and 10% fetal calf serum, respectively. The cells were treated with DMSO only or 5 μM SAHA, with or without recombinant human TGF-β1 (5 ng/mL; Peprotech, USA, 100–21) for 48 h.
Masson trichrome and Sirius red staining
On day 28 after MI surgery, mice were sacrificed and hearts were isolated. A transverse mid-section of left ventricle (LV) was fixed in 10% paraformaldehyde for subsequent sectioning. The slices then were stained with hematoxylin and eosin (H&E) or Masson or Sirius. Images were acquired using a microscope (Olympus). Infarct tissue area and fibrosis content were quantified using ImageJ software.
Echocardiographic measurements
At the end of the 28 days treatment, echocardiography was performed using a GE Vivid 7 Dimension System (GE Vingmed Ultrasound, Horten, Norway) coupled with a M12 L linear (Matrix) array ultrasound transducer probe (5–13 MHz). The parameters were measured according to guidelines provided by manufacturer.
Cell viability assay
4 × 103 mice cardiac fibroblasts were seeded per well in a 96-well plate. The cardiac fibroblasts viability was determined using Cell Counting Kit-8 (CCK8) (DOJINDO, Shanghai, China) according to the manufacturer’s instructions. CCK-8 reagent (10 µl) was added to each well and the plates were incubated at 37 ℃ for 3 h. Absorbance at 450 nm was determined with a microplate reader.
HDAC1 activity assays
HDAC1 activity was measured using a HDAC1 colorimetric activity assay kit (GENMED SCIENTIFICS INC., USA, GMS50082.2.1 VA) following the manufacturer’s protocol. In brief, nuclear extracts of mouse cardiac fibroblasts were incubated with Color de Lys substrate at 37 ℃ for 60 min. Then Color de Lys developer was added to the samples and incubated at 37 ℃ for 15 min. Absorbance was measured in microplate reader measures at 405 nm. HDAC1 activity was calculated using the formula according to the manufacturer’s protocol.
Determination of α-SMA-positive cells by flow Cytometry
Mouse cardiac fibroblasts were cultured in 6-well plates and treated with SAHA or TGF-β1. Then cells were fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.5% Triton X-100 for 20 min. After being rinsed twice with PBS, cardiac fibroblasts were incubated with anti-α-SMA primary antibody (1:50, Abcam, ab124964) overnight at 4 °C. After being washed twice with PBS, cells were then incubated with Goat polyclonal Secondary Antibody to Rabbit IgG—H&L (Alexa Fluor® 594) (1:2000, Abcam, ab150080) for 2 h at 37 °C. After washing twice with PBS, cells were resuspended in 500 μl PBS and analyzed by flow cytometer (BD Biosciences, San Jose, USA). Cardiac fibroblasts stained with Alexa Fluor® 594 were α-SMA-positive cells.
Cell transfection
Mouse cardiac fibroblasts were seeded and cultured in complete medium in 6-well plates. When cells reached 50–60% confluence, small interfering RNA (siRNA) oligonucleotides against DUSP4, HDAC1 (RIBOBIO, China) were transfected into mouse cardiac fibroblasts using Lipofectamine Max (Thermo Fisher Scientific, Inc.) in Opti-MEM® Reduced Serum Medium (Thermo Fisher Scientifc, Inc.).
Western Blotting
Proteins were extracted from cells or heart tissue samples. Protein concentrations were measured with the BCA assay (Beyotime, China). 25 μg lysate samples were separated on NuPage 4–12% Bis–Tris Gels (Novex, Life Technologies, CA, USA). The primary antibodies of TGF-beta 1 (1:1000; ab92486), HDAC1 (1:1000; ab109411), DUSP4 (1:1000, ab216576), P38 (1:1,000; ab170099), Phospho-P38 (1:1,000; ab195049) were purchased from Abcam. Histone H3 (1:1000, 9715S), Acetyl-Histone H3 (1:1000; 8173S), were purchased from Cell Signaling Technology. The secondary antibodies (1:5000) were purchased from Zhongshanjinqiao.
Quantitative real-time PCR (qRT-PCR) for gene expression
Total RNA was extracted using TRIzol reagent followed by a RNA purification kit (Cat. 12183018A, ThermoFisher Scientific, Pittsburgh, PA) and DNase kit (Qiagen Inc., Valencia, CA). RNA (1 µg) was reverse transcribed to cDNA using RT2 First Strand Kit (Qiagen Inc., CA, USA) and then quantified by qRT-PCR (BIO-RAD, Cat. 1,725,124, USA). The primers are as following:
DUSP4, F 5’- CGTGCGCTGCAATACCATC—3’, R 5’- CTCATAGCCACCTTTAAGCAGG—3’;
Col1a1, F 5’-GCTCCTCTTAGGGGCCACT-3’, R 5’-CCACGTCTCACCATTGGGG- 3’;
Col3a1, F 5’-CTGTAACATGGAAACTGGGGAAA-3’, R 5’-CATAGCTGAACTGAAAACCACC-3’;
a-SMA,F 5’-GTCCCAGACATCAGGGAGTAA- 3’, R 5’-TCGGATACTTCAGCGTCAGGA- 3’;
GAPDH, F 5’-AGGTCGGTGTGAACGGATTTG-3’ R 5’-TGTAGACCATGTAGTTGAGGTCA-3’
Statistical analysis
Continuous data are expressed as mean ± SD. To test if it is statistically significant different between two groups, we used the unpaired two tailed Student’s t test. To test if it is statistically significant different between multiple comparisons we used one-way ANOVA with Bonferroni correction. GraphPad Prism 7.0 statistical software was used to analyze the data. Significance was accepted at P < 0.05.
Discussion
Excessive fibrous tissue proliferation after injury can lead to myocardial fibrosis, resulting in impaired heart function and heart failure [
13,
14]. Effective treatment to inhibit myocardial fibrosis after myocardial infarction are of significant importance.
Previous studies have shown HDAC inhibition had anti-fibrotic effect in various diseases, including renal fibrosis [
15], pulmonary Fibrosis [
8,
16] and liver fibrosis [
17]. However, whether SAHA, as a broad-spectrum histone deacetylase inhibitor, can reduce myocardial fibrosis has not been well understood. In this study, we firstly focused on the effect and mechanism of SAHA on MI-induced cardiac fibrosis. Then we proved that SAHA could reduce infarction area in MI model mice.
SAHA, as a HDAC inhibitor, could increase the accumulation of hyperacetylated histones H3, directly influencing chromatin structure and, thereby, the relationship of the nucleosome and the gene promoter elements [
18]. Histone acetylation reduces the binding between histones and DNA, leading to a more open structure which is more accessible to the transcriptional machinery. In our study, TGF-β1 reduced Ac-H3 and DUSP4 protein levels while SAHA treatment could significantly reverse the level of Ac-H3 and DUSP4, indicating that SAHA could reverse TGF-β induced low acetylation level.
Various evidence demonstrated the important role of p38 MAPK played in cardiac fibrosis [
6]. The p38 pathway is important for upregulating the expression of specific proteins in cardiac fibroblasts, including matrix metalloproteinases (MMPs), α-smooth muscle action (α-SMA) [
19‐
21]. Thus inhibiting p38 pathway may therefore be a potential therapy to ameliorate MI-induced myocardial remodeling [
22]. Our study proved that the p-p38/p38 ratio increased in mice hearts post MI, while SAHA significantly suppressed the process. Besides, SAHA could inhibit the increase of p38/p38 levels after treating with TGF-β1. The expression of DUSP4 was significantly up-regulated after SAHA treatment in mice myocardial tissues post MI. Multiple studies have shown that activating DUSPs can inhibit cardiac remodeling and cardiac fibrosis [
23‐
25]. DUSP4 degradation promoted p38 activation, leading to renal fibrosis [
26] and endometrial fibrosis [
27]. Our studies revealed that anti-fibrotic effects of SAHA on cardiac fibroblasts were largely abolished by transfection with siRNA against DUSP4, indicating that DUSP4 could mediate anti-fibrotic process of SAHA on mice cardiac fibroblasts.
Taken together, this study may be the first report of positive regulation of DUSP4 by SAHA in cardiac fibrosis. By promoting the expression of DUSP4, SAHA could block TGF-β1/p38 signaling, thus inhibiting myofibroblast formation and cardiac fibrosis, suggesting that SAHA could be a promising anti-fibrotic reagent. However, more detailed mechanisms on how HDAC1 mediates DUSP4 expression remains to be explored in the future.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.