Murine EAE model
Female C57BL/6J mice were obtained from The Jackson Laboratory (Bar Harbor, ME).
Abcc8−/− mice, obtained as described [
13], exhibited neurological function and spinal cord histology indistinguishable from wild-type (WT) mice. Mice were housed under pathogen-free conditions in the animal facility of the University of Maryland, School of Medicine.
EAE was induced in female WT and
Abcc8−/− mice at 8 weeks of age, as described [
13]. EAE was induced with myelin oligodendrocyte glycoprotein 35–55 (MOG
35–55) peptide (Biomer Technology, Pleasanton, CA) in complete Freund’s adjuvant containing
Mycobacterium tuberculosis (H37RA; Sigma-Aldrich, St. Louis, MO). Mice were immunized by subcutaneous injection in the flank regions (left and right sides) with 200 μL total of an emulsion of MOG
35–55 peptide (200 μg in 100 μL phosphate-buffered saline (PBS) plus 100 μL of complete Freund’s adjuvant containing 0.4 mg of heat-inactivated
M. tuberculosis). Each mouse then received 400 ng of pertussis toxin (List Biological Laboratories, Campbell, CA) intraperitoneally (IP) on post-induction day (pid) 0 and pid-2.
Abcc8−/− mice with induced EAE were described previously [
13], and so were used in the present study for only a single experiment that examined astrocyte expression of TNF, BAFF, CCL2, and NOS2 in EAE. WT mice with induced EAE were randomly assigned to receive no treatment or glibenclamide treatment beginning either on pid-12 or on pid-24 (these groups are referred to below as “EAE/glib-pid-12” and “EAE/glib-pid-24”). Treatment consisted of administering 10 μg glibenclamide IP daily to mice in the treatment groups until the end of the experiment (pid-40). A stock solution of glibenclamide was prepared by placing 25 mg glibenclamide (#G2539; meets USP testing; Sigma-Aldrich) into 10 mL dimethyl sulfoxide (DMSO). We diluted 200 μL of this solution into 9.8 mL PBS; mice received 200 μL of the final solution.
Scoring of disease severity was carried out as previously described [
13]. From pid-1 onwards, mice were assessed daily for signs of paralysis by two independent observers blinded to treatment group. Mice were assigned a clinical score of increasing severity: 1, limp tail; 2, hind limb paresis; 3, complete hind limb paralysis; 4, hind limb paralysis and body/front limb paresis/paralysis; 5, moribund. End point evaluations included mean severity of disease over time and mean day of disease onset (first day of score > 0). Paralyzed mice (scores 3 and 4) were moved to individual cages where food and water were placed at cage floor level. The weight of EAE mice was measured every 2 days, and mice were euthanized if there was a loss of more than 20% in weight or if they become dehydrated.
On pid-40, mice were euthanized by IP injection of pentobarbital (> 100 mg/kg), followed by intracardial perfusion of 10% neutral-buffered formalin (15 mL; Sigma-Aldrich). The spinal cords were removed, immersion fixed for 24 h in formalin, and either cryoprotected 48 h in 30% sucrose prior to cryosectioning (7 μm) or they were paraffin embedded for sectioning.
Histology, immunohistochemistry, and immunoFRET
Mouse tissues. For the analysis of tissues from pid-40 mice, paraffin or cryosections of the lumbar spinal cord were either stained with hematoxylin and eosin (H&E) or Luxol fast blue (LFB) or immunolabeled for either chromogen or fluorescence immunohistochemistry, as follows.
Chromogen immunohistochemistry was performed on paraffin sections, as described in [
13], using VECTASTAIN Elite ABC Kits (#PK-6100; Vector Laboratories) and Mouse on Mouse (M.O.M.) Elite Peroxidase Kit (#PK-2200; Vector Laboratories). Primary antibodies were directed against: CNPase (1:1000; MAB326; EMD Milipore, Billerica, MA), PDGFRα (1:500; sc-338; Santa Cruz Biotechnology, Santa Cruz, CA), SMI-312 (1:1000; SMI-312R; Covance Inc., Gaithersburg, MD), cluster of differentiation (CD) 45 (1:1500; ab10558; Abcam, Cambridge, MA); CD20 (1:100; sc-7735; Santa Cruz Biotechnology); CD3 (1:200; ab5690; Abcam); p65 (1:200; GTX102090; Genetex, Irvine CA); CD86 (1:500; bs-1035R; Bioss,Woburn, MA); CD163 (1:500; bs-2527R; Bioss); TNF (1:500; sc-1350; Santa Cruz Biotechnology); BAFF (1:400; ab16081; Abcam); CCL2 (1:400; ab8101; Abcam); NOS2 (1:500; 482,728; EMD Millipore). Sections were counterstained with hematoxylin and were examined using bright-field microscopy. Quantification was performed by blinded observers using ImageJ software (National Institutes of Health, USA). Cell infiltrates (H&E) in white matter were quantified by counting the number of positive quadrants with inflammatory infiltrates and are reported as the percentage of the total number of quadrants examined. Immunolabeling experiments for specific markers were quantified based on the number of positive cells/field, with each field being a 435 × 325 μm rectangle, and with 7–9 fields covering the entire white matter of one coronal section of the lumbar spinal cord of each mouse.
Fluorescence immunohistochemistry was performed on cryosections. Myelin was assessed by immunolabeling for myelin basic protein (MBP) (1:500; Ab40390; Abcam) and by staining with LFB. Reactive astrocytosis was assessed by immunolabeling for GFAP (1:500; C9205; Sigma-Aldrich). Unbiased measurements of signal intensity within regions of interest (ROIs) were obtained using NIS-Elements AR software (Nikon Instruments, Melville, NY, USA). The area that was evaluated was the dorsal half of the white matter of one lumbar spinal cord section from each mouse. Specific labeling for MBP or LFB or GFAP within the ROI was defined as pixels with signal intensity > 1.5–2.0× background. Percent demyelination in EAE groups without and with treatment was computed based on measurements in normal (non-EAE) mice.
Double immunolabeling was performed for GFAP (1:500; C9205; Sigma-Aldrich) plus TNF (1:500; sc-1350; Santa Cruz Biotechnology) or BAFF (1:400; ab16081; Abcam) or CCL2 (1:400; ab7202; Abcam) or NOS2 (1:500; 482,728; EMD Millipore). Double immunolabeling also was performed for SUR1 (1:800; custom rabbit antibody) plus CD31 (1:200; 550,274; BD Biosciences; San Jose, CA). For visualization, we used fluorescent-labeled species-appropriate secondary antibodies [1:500, Alexa Fluor 488 (green) and Alexa Fluor 555 (red); Invitrogen/Molecular Probes, Eugene, OR] at room temperature. The specificity of the immunolabeling for all proteins was tested in control sections by incubation with pre-immune serum, or after pre-adsorption of the antibody with the peptides used as immunogens.
Human tissues. For the analysis of human tissues, cryosections (10 μm) were stained with H&E or LFB to identify appropriate areas for further evaluation by immunohistochemistry. We used immunolabeling for CD68 (1:200; ab955; Abcam), CD45 (1:200; ab10558; Abcam) and CD3 (1:200; ab5690; Abcam) to categorize demyelinating white matter lesions as either active, chronic active or chronic inactive, per De Groot et al. [
16], as well as to analyze subpial/cortical demyelinating lesions. Tissues from the 9 MS patients yielded 13 white matter lesions, including 5 active lesions, 4 chronic active lesions, and 4 chronic inactive lesions. From these 9 cases, we also identified 6 demyelinating subpial/cortical lesions, each from a different patient. Preactive white matter lesions with “normal appearing white matter” were not included in this study.
Immunohistochemistry and immunoFRET were performed on cryosections using custom goat or custom rabbit anti-SUR1, custom chicken anti-TRPM4, or goat anti-TRPM4 (G-20, sc-27,540, Santa Cruz Biotechnology) antibodies, as described [
12,
15,
17]. Slides were incubated with a mixture of 2% donkey serum (D9663; Sigma-Aldrich) and 0.2% Triton X-100 for 1 h at room temperature prior to immunolabeling.
Single-label immunohistochemistry was performed using biotin-conjugated secondary antibody. Sections were incubated for 30 min in PBS with 0.3% H
2O
2 to block endogenous peroxidase activity, after which sections were placed in the above blocking solution for 1 h. Following overnight incubation with anti-SUR1 antibody (1:800; custom rabbit antibody [
12]) at 4 °C, sections were incubated with biotinylated secondary antibody (1:500; BA-1000; Vector Laboratories, Burlingame, CA) for 1 h. After washing in PBS, sections were incubated in avidin biotin solution (Vector Laboratories) and the color was developed in diaminobenzidine chromogen solution (0.02% diaminobenzidine in 0.175 M sodium acetate) activated with 0.01% hydrogen peroxide. The sections were rinsed, mounted, dehydrated, and cover-slipped with DPX mounting medium (Electron Microscopy Services, Hatfield, PA). Omission of primary antibody was used as a negative control.
Double-label immunohistochemistry was performed using fluorescent secondary antibodies. To identify cell-specific expression, double immunolabeling was performed for SUR1 (1:800; custom rabbit antibody) plus S100B (1:400; ab868; Abcam) or GFAP (1:500; C9205; Sigma-Aldrich) or CD68 (1:200; ab955; Abcam) or CD3 (1:200; ab5690; Abcam). To show co-localization, double immunolabeling was performed for SUR1 (1:800; custom rabbit antibody) plus TRPM4 (1:800; custom chicken antibody [
12], as well as for SUR1 (1:800; custom rabbit antibody) plus BAFF (1:400; ab16081; Abcam), or CCL2 (1:400; ab7202; Abcam), or NOS2 (1:500; 482,728; Calbiochem, San Diego, CA). For visualization, we used fluorescent-labeled species-appropriate secondary antibodies [1:500, Alexa Fluor 488 (green) and Alexa Fluor 555 (red); Invitrogen/Molecular Probes, Eugene, OR] or, in the case of chicken anti-TRPM4 antibody, a FITC-conjugated secondary antibody (The Jackson Laboratory), all at room temperature. Sections were cover-slipped with polar mounting medium containing anti-fade reagent and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen). Immunolabeled sections were visualized using epifluorescence microscopy (Nikon Eclipse 90i; Nikon Instruments Inc., Melville, NY). Omission of primary antibody was used as a negative control. Specific labeling was defined as fluorescence intensity twice that of background.
Semi-quantitative analysis of SUR1 labeling intensity in various types of demyelinating lesions was performed as described previously for SUR1 [
17]. Briefly, all sections had been immunolabeled as a single batch, and all images were collected using uniform parameters of magnification and exposure. Two areas encompassing demyelinating lesions were randomly selected for construction of a montage, with each montage composed of 4 images, each 300 × 400 μm, that were acquired at × 20 magnification. Images were evaluated independently by 2 observers for specific SUR1 immunoreactivity associated with each lesion type. Areas of maximum labeling were scored for each case using a semi-quantitative scale ranging from 0 to 4. The overall concordance between observers was more than 90%. In cases of disagreement, independent reevaluation was performed by a third observer to arrive at the final score. Co-localization of fluorescence signals in double immunolabeled sections (SUR1 plus BAFF or CCL2 or NOS2) was computed as Pearson’s correlation coefficient [
18].
Antibody-based Förster resonance energy transfer (immunoFRET) for SUR1-TRPM4 was performed as described above [
12,
17], except for the secondary antibodies (CY5-conjugated donkey anti-chicken and CY3-conjugated donkey anti-rabbit antibodies; The Jackson Laboratory), image acquisition using a Zeiss LSM710 confocal microscope, and controls that included omission of one or the other of the two primary antibodies.
Fluorescence-activated cell sorting (FACS)
Normal (no EAE) mice were administered fingolimod (FTY720, SML0700, Sigma-Aldrich) (3 mg/kg once daily × 3 days by gavage) or glibenclamide (#G2539; Sigma-Aldrich; 10 μg/mouse once daily × 3 days IP). Untreated normal mice served as controls.
To evaluate circulating leukocytes, whole blood was collected aseptically by cardiac puncture using sterile K3 EDTA VACUTAINER blood collection tubes. The fluorochrome-conjugated monoclonal antibodies, FITC rat anti-mouse CD45 (553080), PerCP rat anti-mouse CD4 (553052), and PE rat anti-mouse CD8a (553032), 2 μg each, all from BD Biosciences, were added to 100 μL of whole blood in a 12 × 75-mm-capped polystyrene test tubes (2058; BD Biosciences). The blood was vortexed gently and was incubated for 30 min in the dark at room temperature, after which 2 mL of × 1 FACS Lysing Solution (349,202; BD Biosciences; × 10 diluted to × 1 in distilled water before use) was added. The mixture was vortexed gently and was incubated for 10 min in the dark at room temperature. The suspension was centrifuged at 500 ×
g for 5 min, the supernatant was removed, 2–3 mL of wash buffer (PBS with 0.1% sodium azide) was added, and the suspension was centrifuged at 500 ×
g for 5 min. The supernatant was removed and 0.5 mL of 1% paraformaldehyde solution (prepared in PBS with 0.1% sodium azide) was added to fix the cells. Counts of total CD45+ leukocytes, and CD45 + CD4+ and CD45 + CD8+ T-lymphocytes in the three treatment groups were determined by FACS (BD LSR II Flow Cytometer; University of Maryland, Center for Innovative Biomedical Resources) [
19].
To evaluate the splenocytes, spleens were removed immediately after euthanasia and were placed in PBS on ice. They were then sliced into small pieces (∼1 mm3) in a Petri dish using surgical blades, and a single cell suspension was prepared by gently forcing the pieces through a 100-μm cell strainer. The resulting cell suspension was centrifuged and resuspended in red blood corpuscle lysis buffer (× 1 FACS Lysing Solution, BD Biosciences), was shaken at room temperature for 10 min, and was washed 2× with PBS with 0.1% sodium azide by centrifugation at 500 × g and resuspension at 4 °C. Isolated splenocytes were counted to estimate total cell numbers. Prior to incubation with antibodies, cells were fixed for 20 min in 1% formaldehyde solution (prepared in PBS with 0.1% sodium azide). Surface labeling was performed using the fluorochrome-conjugated monoclonal antibodies: PE hamster anti-mouse CD3e (#561824), APC rat anti-mouse CD4 (#553051), and PE-CY5 rat anti-mouse CD8a (#553034), all from BD Biosciences and was carried out in FACS buffer (BD Biosciences) with 1-h incubation at room temperature. Counts of total CD3+, CD3 + CD4+, and CD3 + CD8+ T-lymphocytes in the three treatment groups were determined by FACS (BD FACSCanto II system; University of Maryland, Center for Innovative Biomedical Resources).
Astrocyte primary cultures
Astrocyte primary cultures were prepared from post-natal day 3–5 C57B6 mice or Wistar rats using a modified version of the method described [
20]. Animals were euthanized with a barbiturate overdose, whereupon brains were dissected from the skull and were placed in ice-cold Dulbecco’s modified Eagle’s medium containing 4.5 g/L glucose (Invitrogen), supplemented with 10% fetal bovine serum, 100 units/mL penicillin, and 100 μg/mL streptomycin. The meninges were completely removed, and the cortices were isolated. Cortices were passed through 70- and 40-μm nylon meshes, and cell suspensions were plated in the above media. Astrocyte cultures were maintained to confluency for ~12 days, with media changes every 3 days. Confluent cultures were rotary shaken at 250 rpm for 18 h to detach contaminating cells, and were washed × 3 with the above media. GFAP immunolabeling demonstrated that cultures were > 95% GFAP+. Astrocyte cultures were maintained for experiments < 2 months.
To model the astrocyte response in MS/EAE, astrocyte cultures were exposed to TNF (20 ng/mL; 8902SC, Cell Signaling, Danvers, MA) plus IFNγ (20 ng/mL; 8901SC, Cell Signaling) overnight [
1]. After activation, cells were studied by patch clamp electrophysiology to detect functional SUR1-TRPM4 channels, or they were processed to measure mRNA, as described below.
Patch clamp electrophysiology
Primary astrocytes, with or without TNF + IFNγ activation, were studied using patch clamp electrophysiology, as described [
12,
21,
22]. Whole cell recordings were performed using a nystatin perforated patch technique to minimize disturbance of the intracellular milieu that causes rapid rundown of TRPM4 currents. Nystatin, 50 mg (Calbiochem) was dissolved in DMSO, 1 mL. Working solutions were made before the experiment by adding 16.5 μL nystatin stock solution to 5 mL of the base pipette solution to yield a final concentration of nystatin of 165 μg/mL and DMSO 3.3 μL/mL. To record whole cell macroscopic currents exclusive of K
+ channels, such as K
ATP, the extracellular solution contained (mM): CsCl 145, CaCl
2 1, MgCl
2 1, HEPES 32.5, glucose 12.5, pH 7.4; and the pipette solution contained (mM): CsCl 145, MgCl
2 8, and HEPES 10, and nystatin, 165 μg/mL, pH 7.2. The following parameters were used to elicit membrane currents: holding potential, − 50 mV; ramp pulses were from − 100 to + 10 mV, 4 mV/ms, applied every 15 s.
RNA isolation and quantitative real-time polymerase chain reaction
Mouse primary astrocytes, with or without TNF + IFNγ activation, were homogenized in Trizol Reagent (Thermo Fisher Scientific) and total RNA was isolated with Direct-zol™ RNA MiniPrep Kit (Zymo Research; Irvine, CA). To avoid contamination by genomic DNA, RNA was further purified with Amplification Grade DNase I (Invitrogen). The concentration of total RNA was determined by measuring the optical density at 260 and 280 nm. cDNA was synthesized from 1 μg of total RNA of each sample using SuperScript III Reverse Transcriptase (RT) Supermix (Thermo Fisher Scientific). The abundance of the various mRNAs in the samples was determined by quantitative polymerase chain reaction (qPCR) (ABI PRISM 7300; Applied Biosystems, Carlsbad, CA). qPCR reactions (25 μL) consisted of 1-μL cDNA template, Platinum SYBR Green SuperMix-UDG with ROX (Thermo Fisher Scientific), and gene specific primers. Reactions were incubated at 50 °C for 2 min and 95 °C for 2 min, were followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s, and were followed by melting curve analysis. No-template and no-RT reactions were used as negative controls in every experiment. Melting curve analysis was used to confirm the validity of experimental results. The primers used in this study are listed in Table
1. Data are reported as fold-change.
Table 1
Primer sequences used for qPCR
Abcc8
| NM_011510.3 | GCCAGCTCTTTGAGCATTGG | AGGCCCTGAGACGGTTCTG |
Trpm4
| NM_175130.4 | TGTTGCTCAACCTGCTCATC | GCTGTGCCTTCCAGTAGAGG |
Tnf
| NM_013693 | GATCGGTCCCCAAAGGGATG | AGATGATCTGAGTGTGAGGGT |
Baff
| NM_033622 | CTACCGAGGTTCAGCAACACCA | GAAAGCGCGTCTGTTCCTGTGG |
Ccl2
| NM_011333 | GCTACAAGAGGATCACCAGCAG | GTCTGGACCCATTCCTTCTTGG |
Nos2
| NM_010927 | TGGAGCGAGTTGTGGATTGTC | GGGCAGCCTCTTGTCTTTGA |
Rps18
| NM_011296 | CGGAAAATAGCCTTCGCCATCAC | ATCACTCGCTCCACCTCATCCT |