SERCA2a gene transfer improves electrocardiographic performance in aged mdx mice

The cis plasmid for AAV-9 SERCA2a vector production has been extensively characterized and used in various animal studies and human trials [16‐19]. In this construct, the human SERCA2a cDNA expression was regulated by the ubiquitous cytomegalor virus (CMV) promoter, a hybrid intron and a bovine growth hormone poly-adenylation signal (Figure 1A). Experimental AAV vector was produced using a previously reported triple plasmid transfection protocol [20, 21]. Recombinant viral stocks were purified through two rounds of isopycnic CsCl ultracentrifugation as we previously described [22]. Viral titration and quality control were performed according to our published protocol [22, 23].

All animal experiments were approved by the Animal Care and Use Committee of the University of Missouri and were in accordance with NIH guidelines. Dystrophin-deficient mdx mice and normal control C57Bl/10 (BL10) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). AAV-9 SERCA2a vector was injected to conscious 12-m-old mdx mice in a single bolus through the tail vein according to a previously described protocol [11]. Each mouse received 1 × 10¹² vg particles of AAV-9.

DNA was extracted from frozen heart tissue sections as we described before [24]. The AAV SERCA2a vector genome was amplified with a forward primer corresponding to the CMV promoter (DL1263, 5'-CCAAGTACGCCCCCTATTGA) and a reverse primer corresponding to the human SERCA2a cDNA (DL1262, 5'- AGCCCCGTACTCTCGTTGAC) (Figure 1A). The size of the expected PCR product is 519 bp. The mouse CFTR gene was used as an internal control. The forward primer corresponds to the mouse cystic fibrosis transmembrane conductance regulator (CFTR) gene exon 2 (DL1286, 5'-CATATACCAAGCCCCTTCTGCT). The reverse primer corresponds to the mouse CFTR gene intron 2 (DL1287, 5'- TGCATCACTTTTAAATGGAACCTC). The expected mouse CFTR gene amplicon size is 160 bp.

The frozen heart was ground to fine powder in liquid nitrogen. Whole heart muscle lysate was prepared according to our published protocol [15, 25]. Primary antibody of for SERCA2a (1:3,000) has been previously described [26]. A monoclonal antibody to β-actin (1:5,000, Sigma; St Louis, MO) was used to confirm protein loading.

SERCA2a expression was confirmed by immunofluorescence staining. Briefly, 10 μm frozen heart sections was blocked with 20% goat serum at room temperature for 30 min. The rabbit polyclonal anti-SERCA2a antibody was then applied at the dilution of 1:3,000 overnight at 4°C [26]. SERCA2a staining was revealed with an Alex 488 conjugated goat anti-rabbit antibody (1:100 dilution).

General heart histology was evaluated by hematoxylin and eosin (HE) staining. Cardiac fibrosis was examined by Masson trichrome staining as we described before [27]. Fibrotic tissue stained blue and myocardium stained dark red.

Mice were anesthetized with isoflurane (3% induction, 1-1.5% maintenance). A non-invasive 12-lead ECG was performed according to our published protocol [28]. ECG signals were processed through a single channel bioamplifier (Model ML132; AD Instruments) and then recorded on a Model MLA0112S PowerLab system using the Chart software (version 5.5.5, AD Instruments, Colorado Springs, CO). ECG from a continuous 1 min recording was analyzed by the Chart ECG analysis software (version 2.0, AD Instruments). The amplitude of the Q wave was analyzed using the lead I tracing. The remaining ECG parameters were analyzed using lead II tracing results. Cardiomyopathy index is determined by dividing the QT interval with the PQ segment (QT/PQ).

Data are presented as mean ± standard error of mean. Statistical analysis was performed with the SPSS software (SPSS, Chicago, IL) using one-way ANOVA followed by Bonferroni post hoc analysis. Difference was considered significant when P < 0.05.

To evaluate SERCA2a gene therapy in a dystrophin-deficient heart, we packaged the CMV.SERCA2a construct into AAV-9 (Figure 1A). Since the heart of young mdx mice is mildly affected, we opted to test SERCA2a therapy in 12-month-old mdx mice [29]. At this age, mdx mice exhibit cardiac histopathology but do not suffer heart failure [29]. The CMV.SERCA2a vector has been extensively characterized in different animal models and is currently in use in a human trial [17‐19, 30, 31]. We injected AAV-9 SERCA2a to 12-m-old mdx mice via the tail vein. Eight months later, we examined the AAV genome in the heart. The vector genome was detected in all mdx mice that received AAV-9 SERCA2a injection but not in untreated mdx mice (Figure 1B). To confirm SERCA2a expression, we performed western blot and immunofluorescence staining. Compared with untreated mdx, increased SERCA2a expression was found in AAV infected mdx mice by western blot (Figure 1C). Consistent with previous reports [10, 32], we observed endogenous cytosolic SERCA2a staining in the BL10 heart by immunostaining (Figure 1D). Further, the endogenous SERCA2a level was reduced in the mdx heart (Figure 1D). Consistent with the published AAV-9 transduction profile in the mdx heart [11, 12], we observed mosaic but widespread AAV-mediated SERCA2a expression in the hearts of AAV-9 SERCA2a infected mdx mice (Figure 1D).

On histopathologic examination, the hearts of SERCA2a treated mice were not different from those of untreated mdx mice (Figure 2). Myocardial fibrosis was clearly observed in the hearts of both treated and untreated mdx mice (Figure 2). Surprisingly, ECG examination revealed significant improvement (Figure 3). Specifically, tachycardia was corrected. The PR interval, QT interval and cardiomyopathy index were normalized (Figure 3B). Interestingly, the widened QRS duration and the deep Q wave were not improved (Figure 3B).