Background
CC is a leading cause of mortality in females, especially in developing countries [
1]. The two viral oncoproteins E6 and E7 mediate the oncogenic activities of high-risk human papillomavirus (hrHPV), especially HPV16 or/and HPV18 (HPV16/18), which have been demonstrated to play critical roles in CC through different pathways [
2,
3]. HrHPV alone is necessary but insufficient for cervical carcinogenesis; only a small proportion of HPV-infected patients develop invasive CC, and the majority remain subclinical or exhibit only precursor lesions [
4,
5]. Though there has been some of molecular and cytological tests, some of which are commercially available (e.g. LCT, HC2 and CINTec Plus), that provide helpful data to determine the potential risk of HPV-infected patients to develop cancer, it is still important to detect novel biomarkers that are able to identify the women who are at risk of developing CC from among those who are persistently hr-HPV infected.
Research has indicated that epigenetic abnormalities, particularly aberrant methylation changes, play causative roles in tumorigenesis [
6,
7]. Though studies have been focused on aberrant methylation of many tumor supressor genes, some tumor genes also have been demonstrated to be associated with tumorigenesis [
7‐
9]. STK31 is one of the novel cancer/testis (CT) genes [
10,
11], and the expression of STK31 has been proven to be regulated by the methylation status of its promoter [
12]. The results have demonstrated that the STK31 gene play crucial roles in human cancers. These roles may involve cell cycle regulation; the overexpression of STK31 increases cell migration and invasiveness, whereas the depletion of STK31 induces apoptosis [
13]. STK31 has also been revealed to maintain the undifferentiated state of colon cancer cells [
12]. However, the biological function of STK31 and the potentially associated epigenetic mechanism have not yet been investigated in CC.
In this study, we investigated the influences of HPV16 E6 and E7 on the expression and methylation status of the STK31 gene in CC cell lines. Additionally, we tested the methylation levels and expression changes in STK31 in HPV16/18-positive and HPV-negative cervical lesions in different stages. We also explored the correlations between chemotherapy and STK31 gene methylation changes in CC cases.
Discussion
The HPV oncoproteins E6 and E7 mediate the oncogenic activities of hrHPVs and are crucial for hrHPV-induced malignant cell transformation; furthermore these oncoproteins have been proven to affect human CC through different pathways [
2,
3,
14,
15]. In the present study, we found that the HPV16 E7 oncoprotein induced the expression of STK31 in HPV-negative CC cells through an epigenetic mechanism, which indicates that STK31 may be a novel cellular target gene for the HPV16 oncogene E7. The restoration of STK31 expression by the demethylating agent 5-aza-dC in the C33A and HT-3 HPV-negative CC cell also supports the epigenetic role of STK31 in the etiology of cervical tumors. Due to the fact that the STK31 gene exerts its important effects in various human cancers via its biological functions of increasing cell migration and invasiveness, suppressing cell apoptosis, promoting tumorigenicity and maintaining the undifferentiated state of cancer cells [
12,
13], it has been speculated that the inhibition of HPV oncogene E7 in HPV-positive CCs contributes to CC therapy by inhibiting the tumor gene STK31 activities. STK31 might therefore act as a potential therapeutic target in human CCs.
A small proportion of women with HPV infections that are left untreated develop invasive cervical carcinomas; therefore, the positive predictive value (PPV) of HPV testing for CC screening is very low. Additionally, there is no well-established national CC screening program in China [
16,
17]. Therefore, the exploration of a panel of CC-specific biomarkers, e.g., DNA methylation biomarkers, with proven high sensitivities and specificities for cervical neoplasia [
18‐
20] may be valuable for detecting cancer precursors early, reassuring candidates by reducing the frequency of screening, predicting the outcomes for women infected with hr-HPV, and guiding the treatment of HPV-related cervical tumors [
19,
21]. Our previous studies (Fig.
2a) revealed that the regulation of the expression of STK31 by its methylation status is heterogeneous across the different stages of cervical lesions, which suggests that STK31 may be a precursor for human cervical carcinogenesis and is thus a potential DNA aberrant methylation biomarker for the early diagnosis of CC. The results of histological follow-ups showed that invasive CC was found in 5 of 21 (23.8 %) cases with STK31 hypomethylation and in none of the 49 patients with STK31 hypermethylation (
p < 0.05), revealing the aberrant methylation of STK31in the patients with CIN3 may indicate a higher risk for the development of CC. Because the aberrant methylation of STK31 in the CIN3 biopsy cases indicated an increased possibility of developing into CCs, individual therapy may be needed and of great importance for such CIN3. Interestingly, CIN2 and CIN3 are classified together as high-grade intraepithelial lesions (HSIL), but our study found that the STK31 methylation in CIN2 is different from that in CIN3. Although CIN2 and CIN3 are HSILs, studies have shown some different indexes between CIN2 and CIN3 [
22,
23], it’s necessary to detect the methylation status in CIN1, CIN2 and CIN3 respectively. Our results found that CIN3 represents a more advanced stage of intraepithelial neoplasia than CIN2, and the difference in STK31 methylation between CIN2 and CIN3 may be due to the different stages of the cervical tumors.
The development of chemotherapy resistance requires changes in the expressions of a number of genes. It has been hypothesized that epigenetic therapy holds the potential to reverse chemotherapy resistance [
24]. A variety of genes have been proved to be associated with chemoresistance through different pathways [
25‐
27]. The results of Table
1 showed that aberrant methylation of the STK31 gene was statistically correlated with resistance to chemotherapy. Results of Fig.
3 indicated that the expression patterns of STK31 before and after neoadjuvant chemotherapy were in accordance with the previously observed patterns of methylation changes, suggesting that chemotherapy may function in CC patients through an epigenetic mechanism. Nevertheless, the treatment of chemotherapy may result in extensively effects including signaling pathways, cell cycle regulation, apoptosis and metabolite, so further studies need to be focused on whether the altered methylation status was caused by the direct effect of chemotherapy treatment.
Based on the reversible nature of epigenetic aberrations, a number of DNA methylation and histone deacetylase (HDAC) inhibitors are being preclinically tested in combination for cancer therapy. These epigenetic therapeutic drugs have potential therapeutic effects due to abilities to exert synergistic effects on gene expression [
28,
29] and tumor growth [
30]. Recent studies have demonstrated that epigenetic drugs are able to increase the efficacy of chemoradiation and to reduce chemoresistance by inducing the demethylation activities of tumor suppressor genes and increasing their expressions [
31‐
33]. Nevertheless, epigenetic therapies based on DNA methylation and histone deacetylase (HDAC) inhibitors are not suitable for all patients because the up-regulation of the expressions of oncogenes could render patients more resistant. The present study found that aberrant changes in the hypomethylation of STK31 were correlated with chemoresistance and the development of CC.
Conclusions
In conclusion, though the processes that govern the degree of gene promoter methylation in HPV-induced carcinogenesis is quite complex, the present study primarily revealed that STK31 may be a novel cellular target gene for the HPV16 oncogene E7. The aberrant methylation of the STK31 promoter/exon 1 region may be a precursor for human cervical carcinogenesis and thus a potential DNA aberrant methylation biomarker of the progression of precancerous disease to invasive cancer. Overall, the STK31 gene represents a potential tool for the diagnoses, treatments and prognoses of CCs.
Methods
Cell lines and constructs
The HPV16/18-positive CC cell lines HeLa, CaSki, SiHa and the HPV-negative CC cells C33A and HT-3, all of which were obtained from Shanghai institute for biological sciences, Chinese academy of Sciences Institute of Cell Resource Center (Shanghai, China). In the present study, we established the ectopically expressed HPV16 E6, -E7, and -E6/E7 cell models of C33AE6, C33AE7, C33AE6/E7, HT-3E6, HT-3E7, and HT-3E6/E7 by transfecting HPV16 E6, -E7, and -E6/E7 oncogenes with lentivirus vectors into the HPV-negative CC cell line C33A and HT-3 cells in our lab. The C33A-vector (C33A-V) and HT-3 vector (HT-3 V) cells were established by transfecting C33A and HT-3 cells with lentivirus vectors that did not code for the HPV16 E6, -E7, or -E6/E7 proteins as controls. Stable transfectants were selected with 10 ug/ml puromycin for 3 weeks. The transfection efficiency was tested by western blotting, which revealed that the transfected cells successfully expressed the E6, -E7, or -E6/E7 proteins (Fig.
1a).
Cell treatment with 5′-aza-2-deoxycytidine (5-aza-dC)
For the demethylation experiments, demethylation was induced with 5-aza-dC treatment at a concentration that was able to induce the demethylation of the DNA without killing the cells. HeLa, SiHa, CaSki, HT-3 and C33A cells were plated at a density of 8 × 104 cells/25 cm2 flask and treated with various concentrations (5 μM and 10 μM) of 5-aza-dC for 96 h. We also cultured the five cells in a 10 μM 5-aza-dC medium for 0 h, 12 h, 24 h, 48 h, 72 h, 96 h and 120 h.
Tissue specimens
This study was approved by the Institutional Review Board (IRB) of the Affiliated Hospital of Qingdao University. All human cervical samples, including 148 HPV16/18-positive and 18 HPV-negative CC samples that were without preoperative adjuvant chemotherapy (PACT), 55cases of HPV16/18-positive CC samples with PACT, 42 HPV16/18-positive normal cervical samples, 20 cases of HPV16/18-positive CIN1, 20 cases of HPV16/18-positive CIN2, 48 cases of HPV16/18-positive CIN3 were used in the study and were obtained with written informed consent from the donor who underwent primary surgical treatment for cervical tumors or other benigh uterine tumors from the Affiliated Hospital of Qingdao University between 2003 and 2015. All cases were reviewed by at least two pathologists to confirm the diagnoses. Paraffin blocks of the HPV16/18-positive CC biopsy samples before preoperative adjuvant chemotherapy (PACT), CIN1, CIN2, and CIN3 were taken from the Pathology Department of our hospital and processed under strict conditions to avoid contamination.
HPV-DNA detection and genotyping
The detection of HPV DNA was performed by using HPV MY-PCR primers (MY09/MY11), GP5+/6+ and SPF1/2 methods. Both MY09/11 and GP5+/6+ were performed in a final reaction volume of 20 uL, containing 3 uL of the isolated DNA, 2 uL of the 10 × Buffer, 0.8 uL of each deoxynucleoside triphosphate, 0.4 uL of forward and reverse primers, and 1.0 U of Taq DNA polymerase (genebase bioscience, Guangzhou, China). PCR conditions of MY09/11 were as follows: preheating for 5 min at 94 °C was followed by 40 cycles of 1 30 s at 94 °C, 1 min at 45 °C, and 1 min at 72 °C and a final extension of 7 min at 72 °C; PCR conditions of GP5+/6+ were as follows: preheating for 10 min at 94 °C was followed by 40 cycles of 1 min at 94 °C, 2 min at 40 °C, and 1.5 min at 72 °C and a final extension of 7 min at 72 °C. Each PCR experiment was performed with positive and several negative PCR controls. The final PCR products were separated by electrophoresis in 1.8 % agarose gel. SPF was performed in a final reaction volume of 40 uL, containing 4 uL of the isolated DNA, 4 uL of the 10 × Buffer, 3.2 uL of each deoxynucleoside triphosphate, 0.5 uL of forward and reverse primers, and 2.5 U of Taq DNA polymerase (genebase bioscience, Guangzhou, China). PCR conditions were as follows: preheating for 1 min at 94 °C was followed by 40 cycles of 1 min at 94 °C, 1 min at 45 °C, and 1 min at 72 °C and a final extension of 5 min at 72 °C. Each PCR experiment was performed with positive and several negative PCR controls. The products of PCR were then fractionated on 12 % polyacrylamide gel electrophoresis, PAGE gels. As for all methods of HPV-DNA detection and genotyping, see Table
2 for the detailed primer sequences and size of the product. HPV-detection results of the three methods were all consistent with each other, the negtive ones were demonstrated as HPV-negative samples and the positive samples were further etected by HPV type specific PCR for HPV 16 and HPV 18 [
34]. Details of PCR are available from the corresponding author.
Table 2
The primer sequences and product size of MY09/11, GP5+/6+ and SPF1/2
MY09/11 | F: 5ʹ- CGTCCMARRGGAWACTGATC- 3ʹ | 450 |
| R: 5ʹ- GCMCAGGGWCATAAYAATGG- 3ʹ | |
GP5+/6+ | F: 5ʹ- TTTGTTACTGTGGTAGATACTAC- 3ʹ | 150 |
| R: 5ʹ- GAAAATAAACTGTAAATCATATTC - 3ʹ | |
SPF1A | F: 5ʹ- GCiCAGGGiCACAATAATGG - 3ʹ | 65 |
SPF1B | R: 5ʹ- GCiCAGGGiCATAACAATGG - 3ʹ | |
SPF1C | F: 5′- GCiCAGGGiCATAATAATGG - 3′ | |
SPF1D | R: 5′- GCiCAAGGiCATAATAATGG - 3′ | |
SPF2B-bio | F: 5′-GTiGTATCiACAACAGTAACAAA - 3′ | |
SPF2D-bio | F: 5′-GTiGTATCiACTACAGTAACAAA- 3′ | |
RNA extraction and cDNA synthesis
Total RNA was isolated from the CC cells and cervical tissues using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). A RNeasy FFPE Kit (QIAGEN GmbH, Hilden, Germany) was used to extract the RNA from paraffin-embedded cervical tissues. One microgram of RNA was used to obtain cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany) according to the manufacturer’s protocol. The cDNAs were then used for reverse-transcription PCR (RT-PCR) and quantitative real-time PCR (qPCR).
RT-PCR and qPCR
Conventional RT-PCR and qPCR were performed to examine the expression of the STK31 gene. A PCR assay with the specific primers for GAPDH cDNA was performed for each sample to ensure the integrity of the RNA. The final PCR products were separated by electrophoresis in 2 % agarose gel. See Table
3 for the primer sequences and PCR conditions.
Table 3
Primer sequences and reaction conditions for the BGS, MSP and RT-PCR experiments
STK31-BGS | F: 5ʹ-TTTTTAAAGTTATAGTTTGAAGTTTTG- 3ʹ | 499 | 50 |
R: 5ʹ- ACATCTAACACCCCTCTAAAATAAC - 3ʹ |
STK31-M | F: 5ʹ- TTGTTACGTGATTTTCGTTAATATC - 3ʹ | 149 | 51 |
R: 5ʹ-TAAACCCACATACTAAACTTTCGAC - 3ʹ |
STK31-U | F: 5ʹ-GTTATGTGATTTTTGTTAATATT - 3ʹ | 147 | 51 |
R: 5ʹ-TAAACCCACATACTAAACTTTCAAC - 3ʹ |
STK31-RT | F: 5′-AGAGGAATATGAGATGCTAACTA - 3′ | 111 | 60 |
R: 5′- GTAAGGAGACCACCAGAG - 3′ |
GAPDH | F: 5′- GATGACCTTGCCCACAGCCT - 3′ | 303 | 60 |
R: 5′- ATCTCTGCCCCCTCTGCTGA - 3′ |
DNA extraction and bisulfite genomic sequencing (BGS)
The DNA was extracted by using SDS-proteinase K and purified with phenol:chloroform:isoamyl alcohol. A QIAampDNAFFPE tissue kit (QIAGENGmbH, Hilden, Germany) was used of the DNA extraction from the paraffin-embedded tumor tissues. The bisulfite conversion of the DNA was performed using an EpiTect Fast DNA Bisulfite kit (Qiagen, Valencia, CA, USA) according to the instruction of the manufacturer. The methylation statuses of the promoter/exon 1 region of STK31 in the human CC cells and cervical specimens were analyzed by BGS. The primer sequences and conditions for the BGS are presented in Table
3. The purified PCR products were cloned into the pUC18-T vector, and six clones from each sample were randomly selected and sequenced.
Methylation-specific PCR (MSP)
MSP was performed to test the methylation status of the STK31 gene promoter/exon 1 region. The specific primer pairs and PCR conditions are listed in Table
3.
Western blotting
The harvested cells were lysed in RIPA lysis buffer supplemented with protease inhibitor cocktail. Each protein lysate (30 ug) was mixed with 5× SDS-PAGE sample loading buffer, and the mixtures were boiled for 5 min. The boiled mixtures (50 μg) were then fractionated on 12 % SDS-PAGE gels and subsequently transferred onto PVDF membranes (Merck Millipore, Billerica, MA, USA). The primary antibodies used for the western blot analyses were anti-STK31 and anti-β-actin. β-actin was used as a housekeeping protein to normalize the protein loads.
Statistical analysis
The comparison of the STK31 expressions between the groups were performed with a Student’s t-test. The correlations between the clinicopathological characteristics and the numbers of methylated specimens were tested using the χ2-test. Differences were considered significant at p < 0.05, and all statistical tests were performed with SPSS version 17.0 (SPSS, Chicago, USA).
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
FFY, BL and YKW designed the study. FFY collected the samples. NW, XNB and XXX performed the tests and analyzed the data. FFY drafted the manuscript. XY, YLW and CQZ revised the manuscript. All authors read and approved the final manuscript.