Introduction
Thyroid carcinoma (TC) is the most common malignancy of the endocrine system. As of 2020, the incidence of TC has continually increased, and approximately 4.1% of patients with TC are expected to die from malignancy [
1]. Papillary thyroid carcinoma (PTC) is the major histological type of differentiated thyroid carcinoma, accounting for 75–85% of all TC cases [
2]. Although the estimated five year survival rate of PTC is approximately 98%, more than 25% of patients with PTC are at risk of recurrence post-surgery during long-term follow-up [
3]. The point mutation of a valine-to-glutamate at residue 600 (V600E) of BRAF is the most frequent genetic variation in PTCs, accounting for 37–50% [
4]. The BRAF
V600E mutant functions as the major driver of the MAPK pathway and is involved in the secondary genetic alteration of members of the PI3K-AKT pathway, thus leading to the aggressive development of PTC [
5,
6]. Many studies have indicated that the BRAF
V600E mutation is associated with an increased risk of lymph node metastasis and recurrence [
7,
8]. Notably, the positive rate of BRAF mutations in recurrent or metastatic PTCs is nearly 80% [
9]. Targeting the BRAF
V600E mutant has thus become an important strategy in the treatment of advanced recurrent, or metastatic PTCs.
Vemurafenib (VEM) is the first orally available selective inhibitor of BRAF
V600E approved by the FDA (Food and Drug Administration) has no antiangiogenic properties for the treatment of
BRAFV600E-TC and melanoma [
10‐
12]. Many clinical VEM treatments for patients with the BRAF
V600E mutation have been conducted, and it was found that VEM helped some patients achieve better outcomes, especially in metastatic or unresectable PTCs refractory to radioactive iodine [
13]. However, VEM resistance was found in many BRAF
V600E mutant patients within 3–12 months of treatment [
14]. Data obtained clinical research and in vitro studies support the conclusion that primary or secondary resistance to VEM may result from the inhibition of apoptosis via inhibition of the B-cell CLL/lymphoma 2 (BCL2) pathway [
15]. Other studies have revealed that the loss of key effectors of different pathways, including the BCL2 and PI3K/AKT/mTOR pathways, is linked to VEM resistance, and combining the BCL2 inhibitor obatoclax with VEM improved sensitivity [
16]. Furthermore, simultaneous mutations in BRAF
V600E and PI3KCA are significantly associated with VEM resistance [
17].
Forkhead box P2 (FOXP2) is a member of the FOXP transcription factor (TF) family and contains a C-terminal Winged-helix/Forkhead DNA binding domain, thus playing important roles in embryonic development and cancer progression [
18]. FOXP2 is expressed in various cancers and acts as an oncogene or suppressor in carcinogenesis. For instance, FOXP2 can inhibit epithelial-mesenchymal transition by activating the transcription of E-cadherin and PHF2 in breast cancer cells [
19]. Conversely, it is an oncogene in triple-negative breast cancer [
20]. A previous study indicated that FOXP2 is decreased in TC tissues, and overexpression of FOXP2 hampers the proliferation and stemness of TC cells [
21]. However, whether FOXP2 is involved in the acquired resistance to VEM remains unknown.
In this study, we aimed to identify a potential target for reversing VEM resistance based on the establishment of VEM-resistant cell lines. Because only one PTC cell line (B-CPAP) with the BRAFV600E mutant could be established, a melanoma cell line (A375) carrying the BRAFV600E mutant was also considered or the development of potential targets. The two VEM-resistant cell lines (B-CPAP/VR and A375/VR) were established by gradually increasing the drug concentration, followed by phenotypic detection. Next, RNA sequencing and bioinformatic analysis were performed to identify the specific effectors that reversed VEM resistance. Finally, FOXP2 was screened, and the role of FOXP2 in reversing VEM resistance was investigated.
Materials and methods
Cell culture and main reagents
The PTC cell line carrying the BRAFV600E mutant, B-CPAP (Cell Bank of the Chinese Academy of Sciences, Shanghai, China), was cultured in RPMI-1640 (Gibco, Grand Island, NY, USA) supplemented with 1% penicillin-streptomycin (Gibco) and 1% NAEE (Gibco). A375 cells (Fuheng Biotech. Ltd. Co., Shanghai, China) is a melanoma cell line with the BRAFV600E mutation and was cultured in DMEM supplemented with 2 mM glutamine (Gibco). The media for the two cell lines were supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin/streptomycin (Gibco), and the cells were maintained in an incubator with 5% CO2 at 37 °C.
The establishment of VEM-resistant cell lines
The VEM-resistant B-CPAP cell line (B-CPAP/VR) and the VEM-resistant A375 cell line (A375/VR) were established by gradually increasing the concentration of VEM. The induction concentration was determined from the half-maximal inhibitory concentration (IC50) values of the cell lines: 7 μM and 1 μM for B-CPAP and A375, respectively. After the cells resumed normal growth speed and reached 80% confluence with the addition of VEM, the next round of treatment began. The concentration of VEM was gradually increased during each round of induction. After four months of treatment, B-CPAP and A375 could survive and proliferate in a cell culture system containing 30 μM and 15 μM of VEM, respectively, and were named B-CPAP/VR and A375/VR, respectively. In contrast to the parental cells, the culture system of the two resistant cell lines required 5 μM VEM.
Cell viability assay and half-maximal inhibitory concentration calculation
B-CPAP, A375, B-CPAP/VR, and A375/VR cell lines were collected and seeded at 5 × 10
3 cells/well in 96-well plates and then treated with different concentrations of VEM (0, 0.01, 0.1, 1, 10, 50, and 100 μM). Four replicate wells were used for each concentration. After drug treatment for 72 h, cells were incubated with 3-[4,5-dimethylthiaoly]-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) for another 3 h. Next, the supernatant was removed and dimethyl sulfoxide (DMSO; Sigma-Aldrich) was added to each well and incubated for 15 min. The optical density (OD) of each well was measured at 490 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). The survival rate (%) was calculated according to the following formula [
22]:
Survival rate (%) = mean OD of experimental group/mean OD of control group × 100
The IC
50 was calculated according to the survival rate using SPSS version 17.0. The drug resistance index was calculated according to the formula [
22]:
Resistance index (RI) = IC50 of drug-resistant cell line/ IC50 of corresponding parental cell line
VEM resistant cell lines proliferation potential assay
The B-CPAP, A375, B-CPAP/VR, and A375/VR cell lines were collected and seeded at 3 × 10
3 cells/well in 96-well plates. The OD of each well was measured at 490 nm using the MTT assay every day for 5 days. Four replicate wells were used for each time point. The proliferation rate was calculated using the following formula [
23]:
Proliferation rate = mean OD of day measured (n)/mean OD of first day (n = 1–5)
Transwell assay
A Boyden chamber (8 μm; CytoSelect) inserted into a 24-well plate was used to measure cell motility. The B-CPAP, A375, B-CPAP/VR, and A375/VR cell lines were collected and resuspended in FBS-free culture medium, seeded in a chamber at 2 × 104 cells/well and cultured for 24 h at 37 °C. The cells on the lower surface were fixed with 4% paraformaldehyde at room temperature for 30 min and stained with crystal violet for 20 min, followed by washing with PBS buffer and air drying. Cells passing through the lower chamber were observed under a microscope and the number of cells was recorded in six random fields. Experiments were performed in triplicate.
B-CPAP, A375, B-CPAP/VR, and A375/VR single cells resuspended in the required medium were counted, and 800 cells/well were seeded in 6 well plates. Three days later, VEM (2 μM) was added to the medium and cells were cultured for an additional 11 days. After cloning, the cells were fixed with 4% paraformaldehyde for 30 min and stained with crystal violet for 10 min. Finally, cells were washed twice with PBS for two times and photographed using a digital camera.
RNA sequencing
Total RNA of B-CPAP, A375, B-CPAP/VR, and A375/VR was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA quality and concentration were determined from OD260/280 readings using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Montchanin, DE, USA) and assessed on a 1% gel electrophoresis. RNA samples were subjected to BHBIO (Shanghai Biotechnology Corporation, Shanghai, China) for RNA sequencing. Differentially expressed genes (DEGs) were screened under a threshold of log2 fold change (absolute) |Log2 FC | > 1 (as n = 2, p-value was not included), and the resulting genes were used for further bioinformatics analyses.
Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was conducted to analyze the enriched signaling pathways of the DEGs. A gene number > 2 was used as a threshold when screening for relevant KEGG pathways. TF-binding networks were constructed using the top 2000 dysfunctional genes utilizing weighted correlation network analysis (WGCNA).
Cell transfection
B-CPAP/VR and A375/VR cells (1 × 105 cells/well) were seeded into six-well plates. After the cells grew to 80% confluence, si-FOXP2 and control siRNA (si-NC) were transfected into VEM-resistant cell lines using Lipofectamine® 3000 (Invitrogen), according to the standard protocol. Forty-eight hours after transfection, transfection efficiency was determined by quantitative real-time PCR (qRT-PCR). The siRNA sequences for si-FOXP2 were as follows: sense (5′-3′): GGCUAGACCUCACUACUAATT, anti-sense (5′-3′): UUAGUAGUGAGGUCUAGCCTT.
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from the cells using a Universal RNA Extraction kit (TaKaRa, Dalian, China) and then reverse-transcribed using a PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa) according to the manufacturer’s instructions. The complementary DNA template was amplified by qRT-PCR using SYBR Premix Ex Taq (TaKaRa Bio). qRT-PCR was conducted using the StepOne Plus Real-Time PCR System (Thermo Fisher Scientific). Briefly, the reaction system for quantification included 0.5 µL cDNA, 1 µL primers, 5 µL SYBR Green, and 3.5 µL deionized water. Amplification was performed as follows:
94 °C for 5 min and 40 cycles of 94 °C for 5 s and 60 °C for 1 min. Gene expression data were analyzed using the 2
−∆∆Ct method and were normalized to GAPDH expression. The primer sequences synthesized by Sangon Biotech (Shanghai, China) are listed in Table
1.
Table 1
Primer sequences used for qPCR
NR4A1 | Forward | ATGCCCTGTATCCAAGCCC |
Reverse | GTGTAGCCGTCCATGAAGGT |
SOX10 | Forward | CCTCACAGATCGCCTACACC |
Reverse | CATATAGGAGAAGGCCGAGTAGA |
NR4A2 | Forward | GTTCAGGCGCAGTATGGGTC |
Reverse | CTCCCGAAGAGTGGTAACTGT |
FOXO6 | Forward | ACCTCATCACCAAAGCCATC |
Reverse | GTGCAGCGACAGGTTGTG |
NFATC2 | Forward | GAGCCGAATGCACATAAGGTC |
Reverse | CCAGAGAGACTAGCAAGGGG |
FOXD2 | Forward | CTACTCGTACATCGCGCTCA |
Reverse | TCTTGACGAAGCAGTCGTTG |
FOXP2 | Forward | AGGCTTCCAGTCTGTGCTGT |
Reverse | TTTGCAGCTGTAGCCTTTGA |
GATA3 | Forward | GCCCCTCATTAAGCCCAAG |
Reverse | TTGTGGTGGTCTGACAGTTCG |
GAPDH | Forward | GGAGCGAGATCCCTCCAAAAT |
Reverse | GGCTGTTGTCATACTTCTCATGG |
Statistical analysis
SPSS statistical software was used for statistical analysis. The data were tested using the Students’ t-test to analyze the differences between the different groups. Statistical significance was set at p < 0.05.
Discussion
Acquired drug resistance often occurs when it comes to clinical treatment for patients with cancer, especially for those carrying a mutation in a specific gene. BRAFV600E is the most common mutation in some types of cancer. It is highly related to high mortality in patients with PTC or melanoma, which also stimulates research on BRAF inhibitors. To date, the development of new targets is still an important strategy to reverse resistance to VEM and prolong the effective treatment of drug-resistant patients.
In clinical and pre-clinical studies on BRAF inhibitor resistance, the time for VEM resistance development ranged from 3 weeks to 1 year, and very few patients survived without developing resistance [
24]. It was found that RI was significantly higher in patients resistant to VEM within 3 weeks than in those resistant to VEM within 1 year. This suggests that the established resistant cell lines with higher RI in vitro may retain more typical phenotypes of the cells in the tumor, compared to the resistant cell lines with lower RI. In this study, the RI of the established VEM-resistant cell lines B-CPAP/VR and A375/VR was more than 40, which is much higher than the RI (around 3) reported in other studies [
25,
26]. Primary melanoma cells isolated from patient biopsies with the BRAF mutant were first treated with a high concentration of VEM (10 μM) for 1 h, followed by four months of 1 μM VEM treatment [
16]. The present study established the B-CPAP/VR and A375/VR cell lines by gradually increasing the concentrations of VEM, which was similar to the clinical VEM treatment strategy. Moreover, phenotype assays indicated that the resistant cell lines showed a slower proliferation rate and higher migration and clonal formation abilities, which were completely different from those of the sensitive cells.
According to RNA sequencing data, many of the DEGs involved in the pathways were related to human diseases, but most of them were classified in signal transduction pathways. Many reports have also revealed that signaling pathways are indeed related to drug resistance in TC and melanoma based on in vitro and clinical studies [
27]. Clinical and pre-clinical research shows that activation of either or both pERK or pAKT pathways occurred in most of the patients resistant to VEM despite the variable resistance drivers [
24]. The PI3K/Akt pathway is a critical molecular signaling pathway involved in carcinogenesis and acquired resistance. Interestingly, in the present study, the PI3K/Akt pathway was also linked to the acquisition of VEM-resistant cell lines B-CPAP/VR and A375/VR through the target gene of FOXP2. In addition to the PI3K/Akt pathway, the MAPK pathway and its effectors (RTK, RAS, BRAF, MEK, and ERK) also play key roles in this process. The two tumorigenesis pathways are both stimulated by the activation of RTK, which is also the target of effective inhibitors such as cabozantinib, vandetanib, sorafenib, and lenvatinib in the treatment of TC and melanoma [
28]. As the existing data indicate, RTK and BRAF inhibitors are both effective for targeting BRAF
V600E; however, to prevent drug resistance, more targets belonging to related pathways need to be identified.
TFs are proteins that control DNA transcripts to mRNA, which can not only upregulate downstream gene expression but also silence specific genes. Therefore, dysregulated TFs induce specific diseases, including cancer, which makes TFs interesting targets for future medications [
29]. Many dysregulated pathways in VEM-resistant cells were identified as signaling transduction-related, which directed our attention to explore functional TFs. FOXP2 is one of the TFs upregulated in both the established VEM-resistant cell lines. Further phenotypic assays indicated that B-CPAP/VR and A375/VR became sensitive to VEM after silencing FOXP2. In addition, proliferation, migration, and clonal formation abilities were much weaker than those in the control group. This suggests that FOXP2 is a potential target to reverse VEM resistance. Previous studies have indicated that FOXP2 is a suppressor in TC cells [
21,
30], which is different from the oncogenic role found in VEM-resistant cells. The role of FOXP2 in tumorigenesis remains controversial. For instance, FOXP2 functions as an oncogene in colorectal cancer [
31] and diffuse large B-cell lymphoma [
32] but also acts as a suppressor in prostate cancer [
33] and gastric cancer [
34]. Additionally, FOXP2 has been found to play opposite roles in breast cancer [
19] and in triple negative breast cancer [
20]. Therefore, it is inappropriate to define it as a complete oncogene or suppressor. The opposite roles of FOXP2 in TC and VEM-resistant cancer cells might be due to the expression changes of upstream or downstream mediators, since a large number of DEGs were identified in the VEM-resistant cells.
KEGG analysis showed that FOXP2 does not directly participate in some signaling pathways, as FOXP2 functions as a TF. Nevertheless, it is possible for FOXP2 to manipulate some downstream genes to turn on/off signal transduction, and the TF network suggests that there is a connection between LPAR3 and FOXP2. LPAR3 encodes a member of the G protein-coupled receptor family and the EDG family of proteins [
35]. It is not only involved in the PI3K/Akt pathway but also in the Rap1 signaling pathway and other pathways in cancer. Therefore, LPAR3 could be a key downstream gene for FOXP2 to overcome VEM resistance, which requires further investigation.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.