Introduction
As a dominant cause of infertility, orchitis is defined as inflammation of one or both testicles [
1]. The causes of orchitis include infections, trauma, and tumours, and the precise incidence of orchitis is also well known [
2]. As male-specific cells, testicular Leydig cells perform the main function of synthesis and secretion of male hormones, including progesterone and testosterone, which promote spermatogenesis and male reproductive organ development and maintain secondary sexual characteristics and sexual function [
3]. As an immune-inducing factor, bacterial lipopolysaccharides (LPS) can induce cell inflammation, inhibit cell proliferation and induce cell apoptosis [
4]. LPS induces lipid peroxidation and apoptosis, decreases secretion of testosterone, disturbs spermatogenesis production and disrupts spermatogenesis in the testes [
5,
6]. Therefore, understanding the role and the underlying mechanism of LPS in growth and testosterone production in Leydig cells might aid in development of innovative strategies for the treatment of orchitis.
Increasing evidence shows that less than 2% of the active genome is transcribed to protein-coding genes, indicating that most transcripts are non-coding RNAs (ncRNAs) [
7]. NcRNAs were roughly classified into small ncRNAs with a length of less than 200 nucleotides and long ncRNAs (lncRNAs) with a length greater than 200 nucleotides [
8,
9]. Although once considered “transcriptional noise”, lncRNAs play an important role in a variety of cellular progresses, including chromatin remodelling, cell proliferation and cycling, cell death, metastasis, development and tumourigenesis via regulation of genes at the transcriptional, post-transcriptional and translational levels [
10‐
13].
LncRNAs exert influence in a great variety of human disease, including tumours and cancer, nervous system-related diseases, urogenital-related system diseases, cardiovascular-related diseases, gastrointestinal system-related diseases, embryonic development-related diseases and immune system-related diseases [
14‐
16]. Sofia Boeg Winge and colleagues screened differential expressed lncRNAs in fixed paraffin-embedded testicular tissue samples and displayed the disturbance during differentiation of Leydig and Sertoli cells [
17]. However, no literature is available to further elucidate the role and underlying mechanism of lncRNAs in the Sertoli cells of orchitis.
Located in chromosome 14q32, lncRNA maternally expressed gene 3 (MEG3) acts as a tumour suppressor and is involved in physiological and pathological progression of various human diseases [
14,
18]. MEG3 has been found to play a crucial role in various inflammation-related diseases. Zhaolin Wang and colleagues reported that knockdown of MEG3 attenuated LPS-induced inflammatory injury in ATDC5 cells [
19]. However, there is a lack of focus in the literature on the functional roles and underlying mechanism of MEG3 in Leydig cells under orchitis.
Therefore, this study aimed to investigate the role and further dissect the underlying molecular mechanism of MEG3 in Leydig cells under orchitis. This study successfully elucidated the role and underlying mechanism of MEG3 in Leydig cells under LPS and revealed a novel regulatory signalling pathway that offers a certain degree of potential for orchitis treatment.
Materials and methods
Cell culture, treatment and transfection
Human Leydig cells were purchased from ScienCell Research Laboratories (ScienCell, San Diego, California, USA) and routinely conserved in our labs and cultured in Dulbecco’s modified Eagle medium (DMEM; GIBCO, NY, USA) supplemented with 10% foetal bovine serum (FBS; Invitrogen, CA, USA), 10 U/mL penicillin and 10 μg/mL streptomycin. Cells were maintained in a 37 °C/5% CO2 humidified incubator. LPS (Sigma-Aldrich, MO, USA) was dissolved in the medium. The cells were treated with LPS (Sigma-Aldrich, MO, USA) at different concentrations for approximately 48 h. Transfection of small interfering RNA (siRNAs), miR-93 inhibitor, miR-93 mimics and control small RNAs (GenePharma, Shanghai, China) was performed using Lipofectamine 2000 (Thermo Fisher Scientific, CN, USA) over a period of approximately 48 h.
RNA isolation and real-time quantitative PCR
Trizol reagent (Junxin, Suzhou, China) was introduced to extract the total RNA. A NanoDrop 2000 (Thermo Fisher) instrument was used to measure the concentration and purity of total RNA. A reverse transcription kit (Takara, Dalian, China) was applied to synthesize the first-strand cDNA. The 2 × SYBR Green qPCR Mix (Junxin, Suzhou, China) was selected to perform qPCR analysis. The expression levels for lncRNA and mRNA were normalized to β-actin expression, and the expression levels for miRNAs were relative to the U6 expression. The 2
−ΔΔCt method and arbitrary units were introduced to calculate the relative fold change. The primers used in this study are listed in Table
1.
Table 1
Primers used in this study
MEG3 | Forward | 5′- GGCAGGATCTGGCATAGAGG − 3’ |
Reverse | 5′- CGAGTCAGGAAGCAGTGGGTT-3’ |
PTEN | Forward | 5′- ACCCACACGACGGGAAGACA − 3’ |
Reverse | 5′- CTGTTTGTGGAAGAACTCTACTTTGATATCAC − 3’ |
β-actin | Forward | 5′- CATTCCAAATATGAGATGCGTTGT − 3’ |
Reverse | 5′- TGTGGACTTGGGAGAGGACT − 3’ |
miR-93-5p | Forward | 5′- GTCACAAAGUGCUGUUCGUGC-3’ |
Reverse Transcription | 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCTG − 3’ |
U6 | Forward | 5′- CTCGCTTCGGCAGCACA-3’ |
Reverse | 5′- AACGCTTCACGAATTTGCGT-3’ |
Western blot analysis
The radio immunoprecipitation assay (RIPA) (Takara, Dalian, China) was introduced to isolate the protein. The BCA protein detection kit (Junxin, Suzhou, China) was applied to measure the concentration of protein. The proteins (30 μg in each lane) were separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, USA). The membranes were blocked in 5% fat-free milk and exposed to different primary antibodies at 4 °C overnight. The membranes were incubated with horseradish peroxidase-conjugated IgG. The immunoreactive protein bands were detected with a chemiluminescence (ECL) reagent (Junxin, Suzhou, China) and the Bio-Rad ChemiDocTM XRS system. β-Actin was measured as a loading control. The antibodies used in this study are listed below: The anti-PTEN antibody (Ab267787, Abcam, Cambridge, British), anti-Bcl-2 antibody (Ab32124, Abcam, Cambridge, British), anti-Bax antibody (Ab182734, Abcam, Cambridge, British), anti-β-Actin (Ab207604, Abcam, Cambridge, British) and Goat Anti-Rabbit IgG H&L (HRP) (Ab 6721, Ab207604, Abcam, Cambridge, British) were used according to the protocol.
Cell counting kit-8 (CCK-8) assay
Cell viability was tested using the CCK-8 assay (Junxin, Suzhou, China). In brief, cells were plated in a 96-well cell culture plate at a concentration of 4 × 103 cells per well (3 replicates for each experimental condition). After different treatments, 10 μl CCK-8 reagent was added to the cells in each well and incubated for 2 h in a 5% CO2 humidified incubator at 37 °C. The absorbance of the cells at 450 nm was detected using a microplate reader (Bio-Rad, Hercules, USA).
5-ethynyl-2′-deoxyuridine (EdU) incorporation assay
The cell proliferation potential was assessed using an EdU kit (Junxin, Suzhou, China). In brief, cells were plated in a 48-well cell culture plate at a concentration of 5 × 104 cells per well (3 replicates for each experimental condition). After different treatments, 200 μl EdU reagent was added to the cells in each well and incubated for 2 h in a 5% CO2 humidified incubator at 37 °C. The EdU analysis was performed according to the manufacturer’s instructions. The images were captured using a fluorescence microscope (Olympus, Tokyo, Japan).
Construction of reporter vectors and luciferase reporter assay
The fragments of MEG3 and PTEN containing the putative miR-93 binding site were amplified and inserted into the psiCheck2 Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to construct the reporter vectors MEG3-wild-type (MEG3-wt) and PTEN-wild-type (PTEN-wt), respectively. The psiCheck2 vectors cloned with the fragments of MEG3 and PTEN containing the mutant miR-93 binding site were referred to as MEG3-mutant-type (MEG3-mut) and PTEN-mutant-type (PTEN-mut), respectively. These reporters were co-transfected into HEK293 cells with miR-93 mimics using Lipofectamine 2000. The luciferase activities were measured with a Dual-Luciferase® Reporter Assay System Protocol (Promega).
RNA immunoprecipitation (RIP) assay
The RIP analysis was performed with the RIP kit (Millipore, MA USA) and anti-Argonaute 2 (Ago2) antibodies (Abcam, USA) according to the protocol. In brief, the cells were lysed in RNA lysis buffer, and the cell lysate was incubated with Protein A/G beads (Biolinkedin, Shanghai, China) and anti-Argonaute 2 (Ago2) antibodies (Abcam, USA) at 4 °C overnight. IgG was added as a negative control. The immunoprecipitated RNA was isolated and reverse transcribed, and qPCR analysis was introduced to measure the enrichment of MEG3 and miR-93.
Enzyme-linked immunosorbent assay (ELISA)
After different treatments, the culture supernatants were harvested, and the concentrations of the inflammatory cytokines of interleukin-6 (IL6), tumour necrosis factor alpha (TNFα) and testosterone were tested using ELISA kits (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer’s protocol.
Statistical analysis
All experiments were repeated three times. Data are expressed as the mean ± standard deviation (SD). Graphpad Prism 5 software (GraphPad, San Diego, CA) was used to perform the statistical analysis. The p-values of two independent comparisons were compared using Student’s t-test, and multi-group comparisons were expressed using one-way ANOVA. A p-value of < 0.05 indicated a significant difference.
Discussion
Infertility is a heavy global public health threat that is estimated to affect one out of every twenty men [
20]. The male factor, which contains exposure to hazardous chemicals and radiation, excessive alcohol consumption, tobacco smoking and other unhealthy lifestyle factors, accounts for more than 50% infertility due to decreased sperm quality [
21]. In the testes, autoimmune orchitis, which is induced by systemic inflammation such as immunosuppression, inflammatory reactions and infection, leads to testicular dysfunction, germ cell apoptosis, and inhibition of Leydig cell steroidogenesis and spermatogenesis, thus resulting in male infertility [
2,
22]. Therefore, immune homeostasis is essential for normal function of the testes. This study demonstrated that LPS induced an increase of TNFα and IL6 secretion and a decrease of testosterone secretion, inhibited cell growth and induced apoptosis in Leydig cells. Therefore, an urgent need exists to investigate the role and underlying mechanism of LPS in the cellular progression and function of Leydig cells.
LncRNAs are divided into three main categories: intronic lncRNA (mainly produced in the intron region of the coding gene) intergenic lncRNA (mainly produced in the middle region of the two coding genes) and antisense lncRNA (mainly produced in the antisense strand of the coding gene) [
8,
23]. Recently, more numerous functional lncRNAs were identified in human diseases [
14,
24]. Several studies revealed the lncRNAs involved in spermatogenesis, steroidogenesis and cell differentiation in the testes. One study measured the RNA profile of human testicular cells to identify the lncRNAs associated with spermatogenesis [
25]. Another research study systematically screened the enrichment of long non-coding RNAs that affected the differentiation of Sertoli and Leydig cells via transcriptome analysis of adults with Klinefelter syndrome (KS; 47,XXY) [
17]. Yui Satoh and colleagues revealed that Tesra, which is a novel testis-specific lncRNA, regulated the Prss42/Tessp 2 gene and thus affected mouse spermatogenesis [
26]. This study demonstrated that MEG3, a lncRNA, was increased in a LPS-treated mice model and in Leydig cells. Furthermore, knockdown of MEG3 alleviated the role of LPS in inflammatory factors and androgen secretion and cell growth of Leydig cells.
Recently, several regulatory mechanisms of lncRNAs were identified: combined with chromatin, which affects chromatin remodelling and generally affectis gene transcription; combined with the 5’UTR of genes, which affects gene transcription initiation; combined with mRNA transcripts, which affects mRNA alternative splicing, transport, and translation efficiency; binding to protein, which affects the location, modification and activity of protein; as a precursor of miRNA and siRNA, which affects the amount and activity of miRNA; and as a molecular sponge binding miRNA, which affects the amount of free miRNA, thus affecting the expression level of miRNA downstream target genes and activity [
10,
27,
28].
The competing endogenous RNAs (ceRNA) hypothesis has attracted increasing attention from scientists [
29]. The ceRNA hypothesis defined as that, lncRNAs which behaves binding site of miRNA serves as a molecular sponge to absorb the miRNA and thus, lowers the free miRNAs levels in cytoplasm, resulting in the decrease of the binding between miRNAs and its target-mRNA, leading to the elevation of gene transcripts and proteins [
29,
30]. MEG3 was reported to exert its function via the ceRNA hypothesis [
31]. Ru Yang and colleagues demonstrated that silencing of MEG3 alleviated LPS-induced apoptosis by sponging miR-21 in renal tubular epithelial cells [
32]. This study demonstrated that MEG3 affected the role of LPS by sponging miR-93-5p, thus modulating PTEN expression in human Leydig cells.
PTEN (phosphatase and tensin homologue deleted on chromosome ten) was first identified as a tumour suppressor gene and has an anti-growth function in a variety of cellular processes [
33‐
35]. PTEN modulates the PI3K/AKT signalling pathway [
36,
37]. Pingping Xue and colleagues demonstrated that PTEN which was induced by LPS inhibited the trophoblast invasion via AP-1/NF-κB pathway inhibits trophoblast invasion [
38]. However, the regulation of PTEN remains largely unclear. This study demonstrated that PTEN is regulated by LPS-induced MEG3, which absorbs miR-93-5p, thus supplying a novel regulatory mechanism of PTEN.
Conclusions
This study first introduced LPS for treatment of Leydig cells to simulate Leydig cells in the orchitis environment. Additionally, this study demonstrated that MEG3 expression was increased in Leydig cells under LPS and that silencing of MEG3 attenuated the role of LPS in Leydig cells. Finally, this study revealed that MEG3 exerted its function via modulation of the miR-93-5p/PTEN pathway in Leydig cells under LPS, thus indicating the potential of this signalling pathway in treatment of orchitis.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.