Background
Hip fracture remains a leading cause of excessive morbidity and mortality among old people [
1,
2]. Particularly, mortality associated with hip fracture is over 20% within 6 months [
2]. Hip fracture becomes one of the most serious health care burdens affecting old people [
3].
Trauma triggers an inflammatory response that can result in additional organ damage and even multi-organ failure [
4]. The tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10) play an important regulatory role in the course of inflammatory responses [
5‐
7]. The balance between TNF-α and IL-10 is important for the immune homeostasis maintenance, and the dysregulation of the TNF-α/IL-10 ratio might be predictive of complications in patients with inflammatory diseases [
8]. Hip fracture is a common trauma in the elderly, which induces a state of inflammation. Hip fracture is reportedly associated with elevated systemic pro-inflammatory function [
2,
6,
7,
9‐
11] and is thus accompanied with postoperative liver and lung dysfunction [
2,
6,
7,
10,
12].
MiRNAs, small non-coding 22-nucleotide RNA molecules, involve in many biological and pathological processes such as tissue formation, cancer development, diabetes, neurodegenerative diseases, and cardiovascular diseases [
13]. Particularly, it has been shown that some microRNAs (miRNAs) (e.g., miR-155, miR-146, miR-150) control the development and responses of the immune system [
14]. However, there is little understanding on which miRNAs participate in the immune disturbance (IMD) related to hip fracture. In this study, we characterized and validated the dysregulated expression patterns of miRNAs related to hip fracture-induced IMD in rats by using microarray profiling, as well as analyzed genes and signaling pathways related to these dysregulated miRNAs using bioinformatics tools. This study might provide a new potential biomarker for the diagnosis and prognosis of IMD related to hip fracture in aged patients and a potential therapeutic target as well.
Methods
Experimental animals
Male Sprague Dawley (SD) rats were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and maintained on a 12:12 h light/dark cycle with free access to food and water. Animals were monitored every 3 days to check the status of movement and feeding. A total of 60 male SD rats, aged 22–23 months, defined as aged [
15], and weighted 460–570 g, were used in this study. Rats were randomly divided into normal group (subject to anesthesia only,
n = 15) and hip fracture group (subject to operation,
n = 45), respectively. The experiment was designed to last for 72 h. The plasma of rats was collected at 24, 48, or 72 h after the hip injury. At 72 h, rats were sacrificed by intraperitoneal injection of phenobarbital, and the lung tissues were collected and stored at − 80 °C until use. This study was approved by the Institutional Committee of Animal Care and Usage of the Chinese PLA Army General Hospital (Beijing, China).
Hip fracture model
The method was described previously by Zhang et al. [
6]. In brief, rats were anesthetized by an intraperitoneal injection of xylazine (25 mg/kg) and ketamine (75 mg/kg) and were then placed on the base of a blunt guillotine ramming apparatus in a prone position with one rear leg immobilized by a rubber band to a screw. The proximal femur was identified and marked under the guidance of a C arm fluoroscopy (PLX112D, Siemens, Germany). A blunt guillotine with a weight of 500 g was dropped on it, with an average drop height of 14 cm. The force of the descending weight resulted in a unilateral closed proximal femoral fracture. After the modeling procedure, rats were put back in the feeding room to bind the injury site to relieve the pain and freely get access to food and water.
Rats in the normal group were anesthetized but were not subject to the following treatment.
Analysis of serum TNF-α and IL-10
Blood samples were harvested from rats at 24, 48, and 72 h after the hip fracture injury. Serum concentrations of TNF-α and IL-10 were determined using an enzyme-linked immunosorbent assay kit (R&D, Minneapolis, MN, USA) according to the manufacturer’s instruction.
MiRNA microarray
Three rats were randomly selected from each group, and the total RNA was isolated using an SLNco Total RNA Isolation kit (SLNco, Shanghai, China) in accordance with the manufacturer’s instructions. The quantity of RNA was determined using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Wilmington, NC, USA). The concentration of RNA was assessed with an Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA). Triplicate samples were for miRNA microarray using Affymetrix GeneChip MiRNA 4.0 Array (Affymetrix, Santa Clara, CA, USA). Microarray data were analyzed by Origene software (Origene, Beijing, China). Differentially expressed miRNAs were identified according to a fold-change of > 2 or < 0.5.
Algorithm analyses
To identify possible mRNA targets and functions of the differentially expressed miRNAs, three different in silico analyses were performed, including Gene Ontology (GO), pathway analysis with Kyoto Encyclopedia of Genes or Genomes (KEGG), and the interaction analysis of miRNAs with genes using the Sanger miRNA database.
RNA isolation and quantitative real-time reverse transcription polymerase chain reaction analysis
The differentially expressed miRNAs identified by microarray were validated through quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) analysis using an iQ5 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) and the SYBR Premix Ex Taq™ kit (TaKaRa, Otsu, Shiga, Japan). Related primers were purchased from Dingguochangsheng Biotech. (Beijing, China), which were shown in Table
1.
Table 1
The primer sequences for miRNAs
miR-150-5p | F: CGCCAGGGTTTTCCCAGTCACGACTCTCCCAACCCTTGTACCAGT |
R: CGCGAGGAGAGAATTAATACGACTCAGTATACGCGCACTGGT |
miR-130a-3p | F: CGCCAGGGTTTTCCCAGTCACGACCAGTGCAATGTTAAAAGGGCAT |
R: CGCGAGGAGAGAATTAATACGACTCAGTATACGCGATGCCCT |
miR-143-3p | F:CGCCAGGGTTTTCCCAGTCACGACTGAGATGAAGCACTGTAGCTCA |
R:CGCGAGGAGAGAATTAATACGACTCAGTATACGCGTGAGCTA |
miR-223-3p | F:CGCCAGGGTTTTCCCAGTCACGACTGTCAGTTTGTCAAATACCCC |
R:CGCGAGGAGAGAATTAATACGACTCAGTATACGCGGGGGTAT |
miR-125b-1-3p | F:CGCCAGGGTTTTCCCAGTCACGACACGGGTTAGGCTCTTGGGAGCT |
R:CGCGAGGAGAGAATTAATACGACTCAGTATACGCGAGCTCCC |
miR-6324 | F:CGCCAGGGTTTTCCCAGTCACGACTCAGTAGGCCAGACAGCAAGCAC |
R:CGCGAGGAGAGAATTAATACGACTCAGTATACGCGGTGTTGC |
U6 | F:CTCGCTTCGGCAGCACA |
R:ACGCTTCACGAATTTGCGT |
Prediction of the potential target genes of miRNA
Western blotting
Lung tissues were collected from the sacrificed rats, grinded and sonicated at 4 °C in lysis buffer containing 50 mM Tris (pH 7.5), 1 mM EDTA, 1% NP-40, 150 mM KCl, 2 mM NaF, 4 mM sodium orthovanadate, 0.2 mM Na4P2O7, 0.2 mM β-glycerol phosphate, and EDTA-free protease inhibitor mix (Roche, Basel, Switzerland). Protein concentration of the lysate was measured, and proteins were separated by standard SDS-PAGE using a 10% separating gel. A mouse anti-interferon regulatory factor-1 (IRF1) monoclonal antibody (1: 1000, Abcam, Cambridge, MA, USA) and rabbit anti-sphingosine-1-phosphate receptor 1 (SIPR1) monoclonal antibody (1:1000, Abcam) were used as primary antibodies. Goat or rabbit anti-mouse monoclonal antibody conjugated with horseradish peroxidase (Beijing Dingguochangsheng Biotech.) was used as the secondary antibody. The membrane was developed using the enhanced chemiluminescence method. Protein of each blot on the membrane was quantified based on the analysis of grayscale intensity using Quantity one software (Bio-Rad), which was normalized to β-tubulin.
Statistical analysis
Data were analyzed using SPSS software Version 18.0 (SPSS, Chicago, IL, USA). Data were presented as mean ± standard error of the mean, and data at each time point were compared between all the groups using one-way analysis of variance with the following post hoc Tukey test. P < 0.05 was considered statistically significant.
Discussion
Hip fracture frequently occurs in the elderly, with a high incidence of morbidity and mortality [
2]. Reportedly, hip fracture causes systemic pro-inflammatory response [
2,
6,
7,
9‐
11]. Particularly, patients with hip fracture have significantly increased serum levels of inflammatory cytokines (e.g., TNF-α, IL-6, IL-10) compared with healthy controls [
2,
6,
7]. In this study, we determined the serum levels of TNF-α and IL-10 in normal versus hip fracture rats. Elderly rats were randomly divided into normal or hip fracture groups. To avoid any potential resultant inflammatory response from blood collecting, the hip fracture rat group was classified into three subgroups for collecting blood at 24, 48, or 72 h, respectively, after the hip injury. Our result showed that in elderly hip fracture rats, the serum levels of TNF-α and IL-10 were almost significantly increased compared with healthy controls, which was consistent with those previously reported [
2,
6,
7].
TNF-α as a pro-inflammatory cytokine is mainly produced by monocytes, macrophages, initial hemorrhages, and necrosed tumor tissues [
16]. IL-10 is a cytokine that downregulates the immune response and inflammation by suppressing the expression of pro-inflammatory cytokines and downregulating important cell surface molecules such as MHC class II molecules [
17]. There is a consensus as to a protective effect of IL-10 on the inflammatory action of TNF-α during systemic inflammatory response syndrome [
18]. Low TNF-α/IL-10 ratio, characterized by IL-10 superiority, indicates a status of immunosuppression in IMD [
8]. In this study, 13.3% (6 of 45) of hip fracture rats were dead or became moribund at 72 h after injury, which was simultaneously accompanied by a significant decrease of TNF-α/IL-10 ratio compared with non-IMD hip fracture and normal rats. This implies an immunosuppression status in these dead or moribund rats (IMD) with hip fracture.
As small non-coding 22-nucleotide RNA molecules, miRNAs involve in post-transcriptional regulation either by mRNA cleavage and degradation or by repressing the translation of mRNA into proteins [
19]. MiRNA control has emerged as a critical regulatory principle in the mammalian immune system [
14], and it has been shown that miRNAs may be used as potential biomarkers for the diagnosis of various human diseases [
20]. A recent study showed that the serum levels of miR-122-5p, miR-125b-5p and miR-21-5p were significantly upregulated in patients with bone fracture in comparison with healthy controls [
21], implying the potential values of these miRNAs as biomarkers for bone fracture. However, until now, there have no miRNA profiling studies on hip fracture. In this study, we screened the differentially expressed miRNAs between the normal, IMD, and non-IMD elderly hip fracture rats by using miRNA microarray and further confirmed that the miR-130a-3p levels of the serum and lung tissue in IMD rats were both significantly reduced compared with those in normal and non-IMD rats using qRT-PCR. This implies that miR-130a-3p may be used as a potential biomarker for the IMD related to hip fracture in the elderly.
To further understand the role of miR-130a-3p in the regulation of immune response in aged IMD rats, a miRNA-mRNA network was suggested, including 14 mRNAs (e.g., S1PR1 and IRF-1 genes) related to immune system as the potential target genes of miR-130a-3p. Target prediction showed that S1PR1 and IRF-1 genes are potential targets of miR-130a-3p. Since reportedly elderly hip fracture often accompanies with postoperative liver and lung dysfunction [
2,
6,
7], we selectively observed the expression of miR-130a-3p and protein of S1PR1 and IRF in lung tissue. Sphingosine 1-phosphate (S1P) is a major mediator of T cell lymphoid traffic, tissue migration and proliferation, and cytokine secretion [
22]. S1PR1 as a receptor of S1P restrains thymic development, and peripheral number and suppressive functions of T regulatory cells.
23 Increase of S1PR1 in CD4
+ T cells promotes STAT3 activation [
23], and STAT3 is the main downstream molecular target for IL-6R and IL-10R signaling and promotes IL-10 while inhibits IL-12 production [
24]. Conversely, IL-10-induced STAT3 activity in macrophages leads to impaired antigen-specific T cell responses [
25]. Therefore, S1PR1, as an immunosuppresive factor, may induce the production of IL-10 via STAT3 signaling. IRF-1 is a nuclear transcription factor crucial to inflammation, immunity, cell proliferation, and apoptosis [
26]. IRF1 and the transcription factor complex ISGF3 (including STAT1, STAT2, and p48) mediate the upregulation of IL-10 expression by type I interferon (IFN) and IFN-α. Activation of IRF1 and STAT3 in IFN-α-stimulated human monocytes initially contributes to the production of IL-10, pro-inflammatory cytokines, etc. by low level autocrine IFN-α-mediated signaling [
27,
28]. Therefore, IRF1 may also participate in the regulation of the IL-10 production. In this study, we found the lung expression of SIPR1 and IRF1, both related to the production of IL-10, were significantly increased in IMD rats, suggesting that the reduction of miR-130a-3p may lead to increased expression of SIPR1 and IRF1, which mediates the production of IL-10. In addition, a previous study reported that miR-130a directly targeted the 3′-UTR of TNF-α and repressed its translation [
29]. Consistently, this study revealed that decrease of miR-130a-3p promotes the production of the pro-inflammatory factor TNF-α in hip fracture rats.
In this study, through the target prediction of miR-130a-3p using bioinformatics tool and the measurement of the lung levels of miR-130a-3p, S1PR1, and IRF1, we supposed that S1PR1 and IRF are the targets of miR-130a-3p. The next study will be carried out to determine the direct control of miR-130a-3p toward S1PR1 and IRF genes.