Sphingosine-1 phosphate receptor (S1p1), a critical receptor controlling human lymphocyte trafficking, is expressed in hen and human ovaries and ovarian tumors

White leghorn hens (2-3 years old, strain W/96) were housed at the University of Illinois at Urbana-Champaign (UIUC) at the Poultry Research Farm affiliated with the Department of Animal Science. Food and water were given ad libitum and hens were maintained on a 17:7 hour light: dark schedule. Hens this age were used in our study because the proportion of hens with ovarian tumors is about 10-15%, based on our experience. Animals were selected for study based on normal or abnormal ovarian ultrasound as described previously [15, 17, 18]. Hens were sacrificed at UIUC by cervical dislocation and organs removed. Hen ovaries (n = 30) were histologically staged and typed by a pathologist using criteria similar to human tumor type and staging as described previously [17]. All procedures were approved by the University of Illinois Institutional Animal Care and Use Committee (IACUC).

Normal ovaries and ovarian tumors were obtained from the gynecologic oncology clinics at Rush University Medical Center and John Stroger Hospital (Chicago, IL) according to Institutional Review Board (IRB) approved protocols. The criterion for inclusion in the study was women ≥ 45 years old. The criteria for exclusion were a previous history of any cancer and prior chemotherapy or radiation treatment. Normal ovaries were obtained at hysterectomy (n = 5; mean age 54 ± 8 years). Ovarian tumors were obtained from patients with malignant tumors (n = 5; mean age 64 ± 15 years). The tumor histology and tumor grade were determined by a pathologist using standard FIGO criteria [17]. Of the five ovarian tumors shown in this report, three were serous and two were endometrioid.

Hen ovary (n = 30), spleen (n = 5), and caecal tonsils (peripheral lymphoid organ, n = 4) and brain (n = 2) were cut into three equal portions. There were 11 normal ovaries and 19 ovarian tumors used for these experiments. Tissues were prepared for histological and biochemical analysis. All ovarian tissue was examined to verify normal or tumor histology (n = 30). For immunohistochemical analysis, 23 tissues were used and for Western blot and PCR, 20 and 30 tissues were used, respectively. Human (normal ovary, n = 5) and ovarian tumors (n = 5) were similarly prepared. One portion was fixed in 10% PBS-buffered formalin and embedded in paraffin for histology and immunohistochemistry [17]. Sections of formalin-fixed, paraffin-embedded tissue stained with Hematoxylin and Eosin (H/E) were examined by a pathologist to determine the histological type and stage. A second portion was frozen (-80°C) for cryostat sections for immunohistochemistry. The final portion was washed with cold 1.5 mM Tris HCl, homogenized (100 mg wet weight tissue/100mL of 40 mM Tris HCl, 5 mM MgSO₄ buffer), centrifuged (1,000 × g, 10 minutes, 4°C) and the supernatant stored at -80°C for Western blot analysis [16, 31]. In addition, to enrich for S1P1 receptors, the supernatant was centrifuged again (18,000 × g, 40 minutes, 4°C) and the pellet was suspended in sample buffer (Bio-Rad Laboratories, Hercules, CA) for one-dimensional gel electrophoresis (1D-PAGE). Rat brain was used for control and was a gift from Dr. Amanda Mickiewicz (Rush University, Chicago).

To assess S1P1 mRNA expression, RT-PCR was performed as reported previously [38]. Briefly, total RNA from 30 ovaries (11 normal and 19 tumor) and 14 organs was extracted using Trizol reagent (Invitrogen, Carlsbad, CA). The RNA content was measured at an optical density (OD) of 260 nm and the purity evaluated using an OD 260/280 nm absorbance ratio ≥ 1.7. RNA was treated with DNASe (Invitrogen, Carlsbad, CA) to remove trace amounts of genomic DNA before the first strand synthesis. First strand synthesis was performed using 500 ng of RNA according to the manufacturer's protocol (37°C, 1 hour; High Capacity cDNA RT Kit, (Applied Biosystems, Carlsbad, CA). The PCR amplifications were carried out in a 25 μl reaction volume containing 25 ng of cDNA using Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA) according to the manufacturer's recommendation. The PCR cycle consisted of a primary denaturation at 94°C (3 minutes) followed by 35 cycles of denaturation at 94°C (30 seconds) and 54°C (30 seconds) to anneal and 72°C (1 minute) for extension followed by a final extension at 72°C (10 minutes) in a programmable Peltier Thermo Cycler (PTC-200, MJ Research Inc., Ramsey, MN). Hen-specific S1P1 primers were designed using Oligoperfect Designer software (Invitrogen, Carlsbad, CA) using the S1P1 sequence from the NCBI [GeneBank: XM_422305.2]. The forward primer was CCCCAGGAGCATTAAAACTG and the reverse primer was CTGCTGACCACCCTCACTG located between exons 1 and 2. β-actin was used as the endogenous control with a forward primer of TGCGTGACATCAAGGAGAAG and a reverse primer of ATGCCAGGGTACATTGTGGT. The expected base pair size for the S1P1 amplicon was 226 bp and for β-actin was 300 bp. PCR amplicons were visualized in a 2% agarose gel (Pierce/Thermo Fisher, Rockford, IL USA) in T.A.E. buffer (4.84g T ris Base, 1.14mL a cetic acid, 2.0 mL 0.5M E DTA/L of buffer) and stained with ethidium bromide. The image was captured using a ChemiDoc XRS system (Bio-Rad, Hercules, CA). Amplicon from a positive sample (endometrioid carcinoma of the ovary) was used for sequence analysis after purification using the Quia-Quick PCR Purification System (Qiagen, Valencia, CA USA) according to manufacturer's instructions. The purified DNA was sequenced at the DNA sequencing facility at the University of Illinois at Chicago using an ABI 3100 Genetic analyzer (Applied Biosystems, Foster City, CA).

Some ovarian tissue samples (n = 20; 9 normal, 11 tumor) were homogenized according to a previous protocol [39] and stored at -80°C. Proteins (10 μg/lane) were separated by 1D gel electrophoresis using 10% gradient Tris-HCl gels (Bio-Rad, Hercules, CA) using standard procedures [31]. MagicMark XP Western blot standards (Invitrogen, Carlsbad, CA) were used to estimate molecular weight. Rat brain (n = 3) was used as a positive control (recommended by Cayman Chemical website). Proteins were transferred (18 Volts, 30 minutes) to a nitrocellulose membrane (0.45 μm; Bio-Rad, Hercules, CA). Blots were blocked in 10 × Blocking Buffer (diluted to 1×; Sigma St. Louis, MO) containing 0.05% Tween-20 (4°C; 16 hours; Sigma, St. Louis, MO), rinsed in Wash buffer (0.15 M NaCl in 10 mM Tris containing 0.05% Tween-20, pH7.5) and incubated in rabbit anti-S1P1 polyclonal antibody (1:200; Cayman Chemical, Anne Arbor MI) diluted in blocking buffer containing 0.05% Tween-20. The nitrocellulose membrane was washed three times in cold Wash buffer followed by goat anti-rabbit immunoglobulin-HRP (Horseradish - Peroxidase; Pierce/Thermo Fisher, Rockford, IL). As a control for antibody specificity the anti-S1P1 antibody was pre-absorbed with blocking peptide (Cayman, Ann Arbor, MI) (1:1, v/v; 45 minutes, 22°C). The absorbed, control anti-S1P1 was diluted to the same concentration as the untreated S1P1 antibody (1:200) in blocking buffer (Sigma, St. Louis MO) supplemented with 0.05% Tween-20 and used as primary antibody. The reaction was developed in Super Signal West Dura substrate (Pierce/Thermo Fisher, Rockford, IL) and digital images acquired using a ChemiDoc XRS system (Bio-Rad, Hercules, CA). Digital images were analyzed by Quantity One software (Bio-Rad, Hercules, CA).

Because there are currently no commercially available antibodies against avian S1P1, we used a commercially available polyclonal antibody against human S1P1 for Western blotting and immunohistochemical experiments. There are two serine (S) to threonine (T) substitutions in the chicken S1P1R, within amino acids 241-253 of the epitope, and a high degree of homology (> 85% based on sequence comparisons) between the two proteins.

For cryostat sections, tissue was washed in cold phosphate buffered saline (PBS, pH 7.0) and placed in 30% sucrose overnight at 4°C. Tissues were washed once more in PBS the following morning, embedded in OCT Compound (Tissue Tek, Sakura, Japan) and flash frozen in dry-ice cooled methanol and stored at -80°C until use.

Ovarian sections were incubated with rabbit anti-S1P1 (Cayman, Ann Arbor, MI) diluted 1:200 in PBS containing 1% BSA (bovine serum albumin; Fisher, Waltham, MA). The primary antibody was omitted as a control for non-specific antibody binding. Other primary antibodies for immune cell markers include Bu1a (chB6; Abcam, Cambridge, MA) and T cell antibodies (CD3, CD4, and CD8; Southern Biotech, Birmingham, AL). As a control for antibody specificity the anti-S1P1 was pre-absorbed with blocking peptide (Cayman, Ann Arbor, MI) (1:1, v/v; 45 minutes, 22°C). The absorbed, control anti-S1P1 was diluted to the same concentration as the untreated S1P1 antibody (1:200) in normal horse serum and used as primary antibody. Sections were washed and incubated with goat anti-rabbit immunoglobulin-HRP (Pierce/Thermo Fisher, Rockford, IL) (1:10,000 in Sigma Blocking Buffer containing 0.05% Tween-20;1 hour; 22°C; Sigma, St. Louis, MO). Color was developed with 3, 3-diaminobenzidine (DAB) substrate (Vector Labs; Burlingame, CA). Slides were washed in running water (15 minutes) and counterstained with hematoxylin followed by dehydration with graded alcohol series (70 -100%) and xylene. Sections were examined with an Olympus light microscope (BX41, Tokyo, Japan) and an Olympus U-CMAD3 camera with Micro Suite #5 software.

The mRNA for S1P1 was detected at the predicted amplicon size of 226 bp in hen tissue (Figure 1). Four normal ovaries (no evidence of cancer) and four tumor ovaries with endometrioid, serous and mucinous histology had S1P1 mRNA (Figure 1A). Other tissues, including muscle, oviduct, liver and kidney also contained S1P1 mRNA (Figure 1B). The expression of S1P1 mRNA was confirmed by sequence analysis at University of Illinois at Chicago DNA Services Facility (DNAS) and was the positive control shown in Figure 1. The negative control lane omitted the use of cDNA. Human tissue was not evaluated for S1P1 mRNA expression because it was demonstrated previously [40].

S1P1 protein was expressed in human and hen ovaries and ovarian tumors with bands at 47, 72 and 108 kDa detected by Western blot (Figure 2). There were variations in the intensity of bands at each molecular size from different preparations in both hen and human tissues. A membrane-enriched fractionation (18,000 × g) did not result in a consistently enhanced 47 kDa band in either the hen tissues or control rat brain. Hen brain showed the same bands as the positive control. Spleen was expected to express S1P1 because it is a major lymphocyte processing organ and the Western blot reactions were the same as the rat and hen brain. The band intensity was reduced using anti-S1P1 antibody pre-absorbed with blocking peptide and was absent when the primary antibody was omitted.

S1P1 was expressed in normal hen ovaries in blood vessels in the stromal (Figure 3A and 3B) and medullary regions (Figure 3E) of the ovary. S1P1 was also found in mature follicles, but not in early stage follicles (Figure 3A). Within mature follicles, S1P1 was expressed exclusively in the theca externa (Figure 3A). Surface epithelial cells of the ovary also showed intense S1P1 expression (Figure 3C). Atretic follicles (Figure 3D) had S1P1+ immune cells (insert) but S1P1 staining was absent in follicle remnants. The endothelial cells but not the smooth muscle cells of blood vessels were S1P1+ (Figure 3E, insert).

Hen ovarian tumors had varied S1P1 staining (Figure 4). A mucinous ovarian tumor had S1P1 staining associated with mucin-secreting glandular structures (Figure 4A and 4C). An example of a serous ovarian tumor shows light stromal cell cytoplasmic S1P1 staining but intense staining of the surface epithelium (Figure 4E and 4F). Endometrioid (Figure 4K and 4L) ovarian tumors had similar S1P1+ staining within the tumor; the most intense staining being associated with surface epithelial cells and the area immediately adjacent to it (Figure 4L). Most of the S1P1+ cells associated with clear cell carcinomas were outside the tumor (Figure 4G), while blood vessels in the uninvolved stroma adjacent to the tumor were S1P1+ (Figure 4I).

The staining patterns of S1P1 in human ovarian cancers were heterogeneous, similar to the hen ovarian tumors. Normal ovaries had endothelial cell S1P1 staining around blood vessels as well as light staining of the ovarian stroma (Figure 5A and 5C). Serous ovarian tumors had S1P1 staining in the stroma but not the epithelium (Figure 5B). Endometrioid tumor structures were not stained, but surrounding stroma was S1P1 immuno-stained (Figure 5D).

Serial frozen sections of ovarian tissue were stained with hen specific antibodies against Bu1a (antigen specific for avian B cells) and CD3 to determine if S1P1 expression was associated with immune cells (Figures 6 and 7). In normal ovaries (Figure 6), S1P1 was expressed on cells both with and without B or T cell markers in the ovarian stroma and was primarily expressed on blood vessels. The B and T cells were found in close proximity to S1P1 stained blood vessels. In tumors (Figure 7) staining patterns were less organized. S1P1 staining occurred in serous tumor cells. While CD4 T cells were more often found scattered around the tumor glands, CD8 T cells and Bu1a+ staining was localized throughout the tissue and in tumor glands.