Introduction
c-Jun activation domain-binding protein-1 (Jab1) is a multifunctional protein that regulates cell proliferation and oncogenesis. Since its identification as a c-Jun coactivator [
1], Jab1 has been found to be an integral component of the COP9 signalosome (CSN) complex, a multifunctional protein complex involved in modulating signal transduction, gene transcription, and protein stability [
2‐
4]. Jab1 is the fifth subunit of the CSN and is also referred to as CSN5. One of the most recognized functions of the CSN is the deneddylation of the cullin-RING-ubiquitin ligase (CRL) and this function is reliant on the Jab1 MPN domain metalloenzyme (JAMM) motif that serves as the catalytic center [
5,
6]. Jab1 exists not only as a member of the CSN holocomplex and smaller CSN complexes, but also as a monomer with a number of different unique protein interactions and functions outside of the CSN.
Jab1 functionally inactivates several key negative regulatory proteins by affecting their subcellular localization, degradation, phosphorylation, and deneddylation, thereby acting as a positive regulator of cellular proliferation. Through these interactions, Jab1 plays a crucial role in the inactivation of several key tumor suppressors, including cyclin-dependent kinase inhibitor p27
Kip1, p53, and Smad4/7 [
7‐
10]. It can also interact with several important intracellular signaling molecules including hypoxia inducible factor-1 alpha (HIF-1α), macrophage migration inhibitory factor (MIF), E2F1, and cullin 1 (CUL-1) [
11,
12].
Abnormal overexpression of Jab1 has been detected in several types of cancer in humans and in some cases correlates with poor prognosis and low-level expression of p27 [
13‐
18]. However, the molecular mechanism for up-regulation of Jab1 in cancer cells is still unclear. Our studies have shown that Jab1 and p27 protein levels are inversely correlated in invasive breast carcinoma specimens and that Jab1 is highly expressed in breast tumor samples relative to paired normal-tissue samples [
14]. Jab1, along with the oncogene Myc, reside on the frequently amplified region on chromosome 8 and were identified to induce a wound signature in human breast cancer cells [
19]. Further investigations identified the isopeptidase activity of Jab1 to be critical for its ability to promote transformation and progression in breast epithelial cells and inhibition of this activity is sufficient to block breast cancer progression driven by MYC and RAS [
20]. These findings suggest that Jab1 is an important regulator in cancer development and preclinical studies suggest that inhibition of Jab1 delays tumor growth [
14].
Given the frequency of Jab1 overexpression in human cancers and its potential role in the development of cancer, identifying the mechanism by which Jab1 overexpression occurs would be of great interest. The extent to which Jab1 amplification on chromosome 8q is responsible for its frequent overexpression in cancer has not yet been investigated. However, additional mechanisms of regulation through transcriptional control are likely to also be of importance and may link its regulation to upstream signaling pathways. We hypothesize that overexpression of Jab1 in breast cancer can be attributed to an increase in transcriptional activity over that seen in normal tissue. We therefore studied the transcriptional regulation of Jab1 in breast cancer cells. In this present study, we describe the cloning and characterization of the human
Jab1 promoter. We also identify a region whereby CCAAT/enhancer binding protein-beta (C/EBP-β), signal transducer and activator of transcription-3 (Stat3), and GATA1 induce
Jab1 transcription and identify a potential upstream oncogenic signaling molecule that may be key to the regulation of Jab1 expression in cancer. The region we describe here has also recently been identified by another group to contain a T-cell transcription factor (TCF)-4 and Sp1 binding site that was found to be important for transcription and activated by human epidermal growth factor receptor (HER)-2 activation of the AKT/β-catenin pathway [
21], which points to the importance of this region in driving the transcription of
Jab1 and possibly linking its expression to potent oncogenic signaling pathways.
Materials and methods
Cell lines, reagents and antibodies
The human breast cancer cell lines, MCF7, MDA-MB-468, MDA-MB-231, BT-474, ZR-75-1, BT-549, MDA-MB-453, T47D and non-tumorigenic human breast epithelial MCF-10A, MCF-10F, HMEC, and 184A, were purchased from the American Type Culture Collection (Manassas, VA, USA). None were derived directly from tumor tissue for the purposes of this study. MCF7 cells were grown in DMEM. Breast cancer cells were grown in RPMI medium supplemented with 10% FBS. MCF-10A and MCF-10F cells were grown in 50% DMEM, 50% F-12 medium supplemented with 5% horse serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 10 μg/ml insulin, 100 ng/ml cholera toxin, 0.5 μg/ml hydrocortisone, 20 ng/ml recombinant human epidermal growth factor, and 1 mM CaCl2. The following antibodies were used in the study: C/EBP-α (N-19), C/EBP-β (C-19), GATA-1 (H-200), and Stat3 (C-20) (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The following antibodies were obtained from Cell Signaling (Danvers, MA, USA): Src, Phospho-Stat3(Y705), β-Tubulin, and β-actin. Anti-Flag was obtained from Sigma-Aldrich (St. Louis, MO, USA). IL-6 was obtained from Invitrogen (Carlsbad, CA, USA) and used at 40 ng/mL. The Stattic inhibitor (Sigma, St. Louis, MO, USA) was used at 20 nM.
Primer extension
An antisense primer, P1 was designed 5' of the ATG translation site of the Jab1 gene and end-labeled with T4 polynucleotide kinase and 32P-γ-ATP, followed by purification using Nu-Clean D25 columns (Shelton Scientific-IBI, Peosta, IA, USA). Total RNA was isolated from MDA-MD-231 cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and 20 μg of RNA was hybridized with 1 × 106 c.p.m. of 32P-labeled P1 oligonucleotide. The protocol for the Primer Extension System-AMV Reverse Transcriptase (Promega, Madison, WI, USA) was followed. The size of the extended product was determined by electrophoresis on a 6% polyacrylamide gel containing 6 M urea. To determine the size of the primer extended fragment, the labeled Promega marker and a sequencing reaction with Jab1 cDNA as template and primer P1 using the SequiTherm Excel II DNA Sequencing Kit (Epicentre, Madison, WI, USA) were run simultaneously on the gel.
Computer analysis
Transcription factor binding sites were predicted using Genomatix software (Munich, Germany); the MatInspector program, which uses TRANSFAC matrices; and the WebGene HCtata program's Hamming clustering method for TATA signal prediction in eukaryotic genes.
Cloning and analysis of the human Jab1 promoter
To clone the 5'-flanking region of the human
Jab1 gene, a bacterial artificial chromosome clone containing the region corresponding to
Jab1 was used as a template for PCR. The amplified DNA fragments were subcloned into the luciferase reporter vector pGL3 (Promega, Madison, W, USA). Progressive deletion mutants of the pGL3-Jab1 promoter were created by PCR. The integrity of constructs was confirmed by DNA sequencing. The following primers were used: +83R, -2006F, -2958F, -946F, -658F, -472F, -344F, -127F, and -59F (Table
1).
Table 1
Sequences of oligonucleotides used in RT-PCR, primer extension, cloning site- directed mutagenesis, EMSA and ChIP
Jab1 F296-314 | ATCTCAGCATTGGCTCTGC | RT-PCR |
Jab1 R1094-1076 | TAACCTGAGACATCAATC | RT-PCR |
Jab1 R883-864 | AGAACTCAACGTATTCACCC | RT-PCR |
GAPDH F | CCACCCATGGCAAATTCCATGGCA | RT-PCR |
GAPDH R | TCTAGACGGCAGGTCAGGTCCACC | RT-PCR |
P1 | CGCTCCCGGACGCCGCC | Primer extension |
+83R | CTGAAAGCTTCGCTCCCGGACGCCGCC | Cloning |
-2006F | CTGACTCGAGGTGGTAGTGAGAGG | Cloning |
-2958F | CTGACTCGAGCGCATGGGAACCAA | Cloning |
-946F | TGAACTCGAGCCTGCTCCCTGTGTC | Cloning |
-658F | CTGACTCGAGCCCACTGCCTCCTCG | Cloning |
-472F | CTGAGCTAGCCAACAGACAGCCTT | Cloning |
-344F | CTGACTCGAGGAGGCCGAGCCTGC | Cloning |
-127F | TGAGCTAGCGTCCCGGAAAGGTCCCC | Cloning |
-59F | TGACTCGAGCTGCCCCAAGAGTC | Cloning |
-31F | CTGAGCTAGCGTTCCCGTGGTGCGG | Cloning |
CEBP-Mut | GCCTTACCTTTTAGTCTTTCctgAAACTTATCTC | Site-directed mutagenesis |
GATA1-Mut | CAACAAACTTgagTCATTTAAGGTACCTATACCC | Site-directed mutagenesis |
GATA1-Del | GTCTTTCAACAAACTT....CATTTAAGGTACC | Site-directed mutagenesis |
-462/-445 CEBP WT | CCTTACCTTTTAGTCTTTCAACAAACT | EMSA |
-462/-445 CEBP Mut | CCTTACCTTTTAGTCTTTCctgcAAACT | EMSA |
-444/-417 GATA1 WT | AATCATTTATCTCATTTAAGGTACC | EMSA |
-444/-417 GATA1 M1 | GGAGTCATTTAAGGTACCTATACCC | EMSA |
-472F | CTGACTCGAGCAACAGACAGC | ChIP |
-343R | CTGAAAGCTTCGCAGGCT | ChIP |
PCR and RT-PCR
The PCR reaction contained 100 ng of DNA template, 1.5 mM MgCl2, 0.2 mM dNTP (Roche Applied Science, Indianapolis, IN, USA), 1 uM of primers, and Taq High Fidelity DNA polymerase (Invitrogen, Carlsbad, CA, USA).
The reverse transcriptase (RT) assay was performed from 2 μg of total RNA using Superscript II RT (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's procedure. A reaction without RT was performed in parallel to ensure the absence of genomic DNA contamination. PCR amplification was carried out as described previously [
22]. Conditions for the PCR reaction consisted of an initial denaturation step at 94°C for 5 minutes, followed by 30 cycles of 30 seconds at 94°C, 30 seconds at 60°C, and 30 seconds at 68°C. After a final extension at 72°C for 10 minutes, PCR products were resolved on 1.2% agarose gels and visualized by ethidium bromide transillumination under UV light. Primers used were:
Jab1 F296-314,
Jab1 R1094-1076,
Jab1 R883-864,
GAPDH F, and
GAPDH R. For these and all following primer sequences please refer to Table
1.
Transient transfection with reporter constructs and luciferase assay
MCF7, MDA-MB-231, and MDA-MB-468 cells were plated into 24-well tissue culture dishes at 4 × 104 cells/well 24 hours before transfection. Transfections were performed in triplicate according to the manufacturer's protocol using Lipofectamine PLUS reagent (Invitrogen, Carlsbad, CA, USA). Briefly, 0.4 μg reporter plasmid Jab1-Luc (Firefly luciferase) together with 10 ng of pRL (Renilla luciferase) were cotransfected. Luciferase assays were performed 36 hours after transfection using a Dual-Luciferase Reporter Assay System (Promega, Madison, W, USA). Firefly and Renilla luciferase activities were read on a Monolight 3010 luminometer (BD Bioscience, Rockville, MD, USA). Firefly luciferase activity was normalized to Renilla luciferase readings in each well. Each experiment was conducted at least twice in triplicate.
Site-directed mutagenesis of
CEBP and
GATA1 was performed according to the QuickChange II method (Stratagene, La Jolla, CA, USA). The following mutagenic primers were used:
CEBP-Mut,
GATA1-Mut,
and GATA1-Del (see Table
1 for sequences). All mutants were verified by sequencing.
Nuclear extracts were prepared as previously described [
1]. Briefly, MCF7 and MDA-MB-468 cells were lysed in 10 mM HEPES-KOH (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA). After incubation for 10 minute on ice, nuclei were recovered by centrifugation at 3,000 ×
g at 4°C for one minute and resuspended in 20 mM HEPES-KOH (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and protease inhibitor cocktail. Protein concentrations were determined using the DC Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA). The following double-stranded DNA oligonucleotides were used in the electrophoretic mobility shift assays (EMSAs): -462/-436 CEBP-WT, -462/-436 CEBP-M1, -435/-417 GATA1-WT, and -435/-417 GATA1-M1 (see Table
1 for sequences).
Oligonucleotides were end-labeled with [γ-32P] ATP (MP Biomedicals, Solon, OH, USA) by T4 polynucleotide kinase (New England Biolabs, Ipswich, MA, USA) and purified with Quick Spin G-50 Columns (Roche Applied Science, Indianapolis, IN, USA). Pre-binding of 5 μg of nuclear extract to 0.05 mg/mL poly(dI:dC) (Roche, Applied Science, Indianapolis, IN, USA) was performed in a buffer containing 20 mM HEPES (pH 7.4), 0.1 mM EDTA (pH 8.0), 75 mM KCl, 2.5 mM MgCl2, 1 mM DTT, and 5% glycerol for 20 minutes at room temperature (22 to 24°C) before addition of 60,000 c.p.m. of labeled probe. For competition assays, 25- and 100-fold excess cold competitor oligonucleotide duplex was added to the reaction buffer 10 minutes before addition of the labeled probes. For supershift assays, antibodies were added for 20 minutes at 4°C prior to addition of the labeled probe. Reactions were resolved by electrophoresis on a 4.5% nondenaturing polyacrylamide gel run in 0.5 × TBE, vacuum-dried with heat, and exposed to film at -80°C.
Chromatin immunoprecipitation (ChIP) assay
The manufacturer's protocol for the chromatin immunoprecipitation (ChIP) Assay Kit (Upstate Biotechnology, Temecula, CA, USA) was followed. Briefly, MCF7 cells or MDA-MB-231 cells transfected with control pcDNA vector or C/EBP-β2 and were incubated with 1% formaldehyde for 20 minutes at 37°C. Cells were collected, lysed, sonicated, and incubated with 4 μg of antibodies to C/EBP-α, C/EBP-β, GATA-1, Stat3, or β-actin overnight. PCR was used to amplify DNA bound to the immunoprecipitated histones after reversing the histone-DNA cross-links. The following primers were used for PCR: -472F and -344R (see Table
1 for sequences).
Transfection of small interfering RNA oligonucleotides
Small interfering RNA (siRNA) for Stat3, Src, and Control (LUC) were obtained from Dharmacon (Lafayette, CO, USA). Oligonucleotides were transfected using Oligofectamine (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol. For luciferase assay experiments, MDA-MB-468 cells were plated at 4 × 104 cells per well in a 24-well tissue culture dish. siRNA (20 nmol and 50 nmol) were transfected in complete medium without antibiotics. The -472 Jab1-Luc construct and pRL were cotransfected 24 hours later using the manufacturer's protocol for Lipofectamine PLUS transfection reagent. Luciferase assays were performed after 48 hours.
Discussion
Jab1 is commonly overexpressed in patients with breast cancer as well as other tumor types. The mechanism by which Jab1 is regulated is currently not known and our data suggest that this may occur at the transcriptional level. In this study, the
Jab1 promoter was analyzed to identify the molecular basis of
Jab1 gene expression and to give insight into the mechanisms by which Jab1 is overexpressed in cancer.
Jab1 promoter analysis led to the identification of C/EBP-β, GATA-1, and Stat3 as positive regulators of
Jab1 transcription in breast cancer cells. Promoter deletion studies identified a region between -472 and -345 that has significant transcriptional activity, as evidenced by the dramatic reduction in luciferase reporter activity when this region has been deleted (Figure
2a). Mutation of both the C/EBP and GATA-1 sites together resulted in decreased luciferase reporter activity of approximately 75% when combined. We identified C/EBP, GATA-1, and Stat3 consensus sequences located in this region and their binding was confirmed by EMSA and ChIP assays. We established that C/EBP, GATA-1, and Stat3 are positive regulators of
Jab1 promoter activity. As these transcription factors are activated during tumorigenesis, and because Jab1 is overexpressed in a number of tumors, we demonstrate that these transcription factors indeed increase transcription of
Jab1.
In our study, we identified C/EBP as a potential transcriptional activator for
Jab1, specifically C/EBPα and C/EBPβ-2. C/EBPβ-1 is expressed in normal breast cells while expression of C/EBPβ-2 is known to be expressed specifically in invasive primary breast tumor samples or cells lines [
39]. Of the three isoforms of C/EBP-β, the transactivating form of LAP2 resulted in a two-fold increase in
Jab1 transcriptional activity while the inhibitor isoform LIP decreased activity. C/EBP-β appears to play a critical role in the development of both the mammary gland and cancers therein through its involvement in development, differentiation, and proliferation of mammary epithelial cells [
25,
27,
31]. As Jab1 is frequently upregulated in breast cancer, it is possible that LAP2 is a major factor in driving
Jab1 transcription during the tumorigenic process. Of note, our study detected higher levels of all three C/EBP-β isoforms in a panel of breast cancer cell lines compared with normal mammary epithelial cells (Figure
4d), which is contrary to previous studies that identified mainly higher expression of LAP2 in breast cancer. Yet, LAP2 was the isoform that resulted in the greatest increase in transcriptional activity of Jab1. This increased expression could certainly be driving increased Jab1 activity in breast cancer cells.
Further, we identified a co-existing Stat3 binding site within the C/EBP binding site on the
Jab1 promoter. Ectopic overexpression of Stat3 increased transcriptional activity as well as mRNA and protein levels of Jab1. This was further increased with overexpression of the activated form of Stat3. Constitutive activation of Stat3 occurs commonly in cancer, including breast cancer and has been demonstrated to contribute to tumorigenic processes [
40]. Stat3 can mediate signaling through upstream receptor tyrosine kinases such as epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor (PDGR) as well as upstream non-receptor tyrosine kinases such as Abl and Src-related kinases. These receptors are constitutively activated in cancer, typically through genetic alterations [
40]. The oncogenic Src protein kinase itself is overexpressed in a large number of tumor types and interacts with multiple tyrosine kinase receptors, including EGFR and HER2 [
41] to mediate its oncogenic effects of promoting growth and metastasis. We found that Src, an activator of Stat3, is involved in
Jab1 transcription. Overexpression of both Stat3 and Src in normal mammary epithelial cells resulted in increased Jab1 mRNA and protein levels. These data provide the first evidence that Jab1 is a direct downstream target of Stat3 and Src. Additionally, inhibition of Src by siRNA reduced
Jab1 promoter activity in a manner similar to inhibition of Stat3. We further identified one upstream activator of Stat3, IL-6, that mediated activation of Jab1 expression.
Since the present study began, Jab1 expression has been linked to the HER2 signaling pathway. HER2 has been found to stimulate
Jab1 transcriptional activity in NIH3T3 cells stably expressing the HER2 receptor [
21]. This stimulation took place through the AKT/β-catenin/TCF-4 signaling pathway in breast cancer cells overexpressing the HER2 receptor. The TCF binding site is in the same area as our region of interest, between -472 and -344. In our laboratory, we also found overexpression of Jab1 in NIH3T3 and MCF7 cells that stably express the HER2 receptor (data not shown). However, inhibition of this pathway by the anti-HER2 antibody trastuzumab (Herceptin) or AKT inhibitors in MCF7 and SKBR3 cells did not reduce
Jab1 promoter activity. However, trastuzumab did inhibit Jab1 protein levels in BT-474 breast cancer cells as well as phosphorylation of AKT and Stat3 (data not shown). The regulation of Jab1 expression by HER2 through the AKT pathway is of great interest, and further studies could strengthen our understanding on the role of Jab1 in the tumorigenic process.
As overexpression of Jab1 is frequently observed in breast cancer, further investigation of the pathways that modulate
Jab1 transcription would provide insight into the role Jab1 plays in the tumorigenic process therein. Activation of the Stat3 pathway in breast cancer can occur through many pathways, including those of EGFR, HER2, IL-6 receptors, IL-11 receptors, and progesterone receptors [
42]. Experimental activation of these pathways, followed by evaluation of
Jab1 promoter activity and mRNA levels, could provide insight into the mechanisms by which
Jab1 transcription is activated. Our data provide evidence of activation of
Jab1 transcription through IL-6 and Src mediated activation of Stat3 as shown in Figure
7e. It is possible that other activators upstream of Stat3 could be mediating this downstream effect as well and warrants further investigation.
This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
TJS carried out all of the studies and drafted the manuscript. QZ assisted in many aspects of the study including the execution of deletion analysis and siRNA analysis. LT contributed to the cloning of Jab1 promoter and its analysis. VTT and AMB participated in cell culture, siRNA, and western blotting experiments. ALK provided plasmid constructs, assisted in the primer extension analysis and participated in study design. XFL and WSL, participated in the study design, and provided important intellectual support. FXC conceived the study, participated in its design, coordination and interpretation of the results and finalized the manuscript. All authors read and approved the final manuscript.