Background
Colorectal cancer is one of the most common cancers worldwide, with rising incidence and mortality [
1,
2]. Despite some significant improvements achieved in CRC diagnosis and treatment, the poor long-term follow-up still exists, which is caused by the CRC local recurrence and distant metastasis [
3,
4]. The underlying mechanism of poor prognosis of CRC remains unclear.
Cancers have been considered as metabolic disorders, including high glycolysis, increased glutamine consumption and abnormal lipid metabolism [
5‐
7]. One of the hallmarks of cancer cells is deregulation of lipid metabolism [
8,
9]. Stearoyl-CoA desaturase-1, the fatty acyl Δ9-desaturing enzyme that converts saturated fatty acids (SFA) to monounsaturated fatty acids (MUFA) and is regulated by sterol regulatory element binding transcription factor 1 c (SREBP1c) or carbohydrate response-element binding protein, has been positively associated with many human malignancies [
10‐
12]. Fatty acid biosynthetic pathway and SCD1 have been implicated to be essential for tumor cell survival [
13,
14]. High expression of SCD1 and disorders of MUFA are involved in progression of cancers including hepatocellular, lung, renal, colorectal and prostate cancer [
15‐
19]. SCD1 expression increased in erythrocytes of patients with CRC [
20], but the relationship between SCD1 expression and CRC progression remains to be elucidated.
SCD1 has also been positively associated with insulin resistance and diabetes [
21‐
23]. SCD1 activity has been suggested to be a risk factor for diabetes in humans [
24,
25]. Increasing epidemiological studies showed positive correlation between type 2 diabetes mellitus (T2DM) and increased incidence and mortality of many cancers [
26‐
29]. CRC remains as one of the most common diabetes-related cancers [
27,
30,
31]. Although diabetic conditions have been associated with invasion and metastasis of CRC [
29], the molecular mechanism underlying this connection remains elusive.
PTEN, a classical tumor suppressor gene, is the most important negative regulator of the PI3K/Akt signaling pathway [
32‐
34]. PTEN function is commonly lost in a large proportion of human cancers, such as brain, breast, prostate and colorectal cancer, through somatic mutations, gene silencing, or epigenetic mechanisms [
32,
35]. Studies have showed that loss of PTEN function contributes to progression of CRC [
35].
In order to elucidate the role of SCD1 in CRC metastasis, we first analyzed the level of SCD1 in CRC tissues and found a negative correlation between SCD1 and the prognosis of CRC. Next, we showed that SCD1 promoted CRC progression through increasing MUFA levels and suppressing PTEN. Moreover, SCD1-induced cell migration and invasion contributed to glucose-induced CRC metastasis. These results provide us with novel insights into metastasis of CRC, especially in CRC patients with diabetes.
Methods
Clinical tissue specimens and database analysis
Pairs of cancer and adjacent noncancerous tissues enrolled in this study were collected from patients diagnosed with colorectal cancer, which obtained from Shanghai General Hospital of Shanghai Jiao Tong University. The study protocol was approved by and in accordance with the guidance of the Research Ethics Committee of Shanghai Jiao Tong University of Medicine, Shanghai, China. The Cancer Browser was linked from the UCSC Cancer Genomics Browser (
https://genome-cancer.ucsc.edu/), colorectal cancer was chosen and then downloaded related datasets. SCD1 items were searched and summed up and then we combined SCD1 expression with clinical information, to build overall survival curve and outcomes comparison.
Cell lines and culture conditions
Human colonic carcinoma cell lines HCT116, Caco2, HT29, SW116 and SW620 were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Giboco, USA), which contained 10% FBS, 2 mM L-glutamine and 1% penicillin/streptomycin (Gibco, USA). Cells were incubated in 37 °C, 5% CO2 humidified atmosphere.
Quantitative real-time PCR
Total RNA was isolated by using TRIzol (Invitrogen Life Technologies, USA). cDNA was made using the PrimeScript™ RT reagent kit (Takara Bio Inc., Japan). Real Time-PCR was performed in triplicate utilizing StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA). The primers were as follows: SCD1 forward, 5′- GTCCTTATGACAAGAACATTAGCC -3′ and reverse, 5′- AATCAATGAAGAATGTGGTGAAG -3′; ChREBP forward, 5′- GTGTCTCCCAAGTGGAAGAATTT -3′ and reverse, 5′- GCTCTTCCTCCGCTTCACAT -3′; 18 s rRNA forward, 5′- GTAACCCGTTGAACCCCATT-3′′ and reverse, 5′- CCATCCAATCGGTAGTAGCG-3′; The relative gene expression levels were calculated by the 2-ΔΔCt method. 18 s rRNA were used as an internal control.
Western blotting
The protein lysates of cells or tissue specimens were prepared with RIPA buffer containing protease inhibitors (Thermo Fisher Scientific, USA) and supernatant was collected. Lysates were separated by 8.5% SDS-PAGE, and transferred to PVDF membranes (Millipore). Membranes were probed with the antibodies: anti-SCD1 (Proteintech Group, USA), anti-ChREBP (Santa Cruze, USA), anti-PTEN (Proteintech Group, USA), anti-Ecadherin (Cell Signaling Technology, USA), anti-Vimentin (Cell Signaling Technology, USA), anti-Akt (Cell Signaling Technology, USA); anti-phospho-Akt (Cell Signaling Technology, USA),anti-β-Actin (Cell Signaling Technology, USA), and anti-α-Tubulin(Santa Cruz Bio-technology, USA), followed by incubation of secondary peroxidase-labeled antibody (Cell Signaling Technology, USA). Protein signals were revealed with ECL detection system.
Immunohistochemical staining
Harvested tumors were fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. After deparaffinization and rehydration, the slides were retrieved for 30 min at 95 °C. 10% normal goat serum were used as blocking solution for 1 h. Then sections were subjected to antibody incubation overnight at 4 °C, followed by incubation with secondary antibody incubation. Then chromogenic reaction was performed with 3, 3-diaminobenzidine (Sigma-Aldrich, USA). After counterstaining with hematoxylin, slides were evaluated under a light microscope.
Stable gene transfection
Short hairpin RNA (shRNA) against SCD1 (shSCD1) and nonspecific control shRNA were synthesized (Genepharma, China). The sequences of the two designed SCD1 shRNAs were as follows: shSCD1–1, CAGGACGATATCTCTAGCTCC; shSCD1–2, CCTACCTGCAAGTTCTACACC. The cDNA encoding human SCD1 was obtained from Dr. Jiahuai Han (Xiamen, China) and subcloned into vector pLVX-IRES-ZsGreen1 (Clontech). Cells were transfected with SCD1 shRNA and cDNA using polybrene as previous study [
36].
Transient gene transfection
Control and PTEN siRNA were synthesized by GenePharma Co., Ltd. (Shanghai, China). The siRNA sequences were as follows, si1 forward, 5′- GGCUAAGUGAAGAUGACAATT -3′ and reverse, 5′- UUGUCAUCUUCACUUAGCCTT -3′ and si2 forward, 5′- GAAGGCGUAUACAGGAACATT -3′ and reverse, 5′- UGUUCCUGUAUACGCCUUCTT -3′. The siRNA transfection was carried out using Lipofectamine RNAiMAX (ThermoFisher, USA), according to manufacturer’s protocol. The overexpression human PTEN was constructed by pEX-3(pGCMV/MCS/Neo) vector.
Migration and invasion assay
24-Well transwell chambers (8 μm pore size; Becton Dickison, Falcon, USA) were used to measure the cell migration and invasion capacity. Approximately 5 × 105 CRC cells in serum-free DMEM were added into the upper chambers with (invasion assays) or without (migration assays) matrigel coating, while complete DMEM was placed in the bottom. After 24 h, cells migrating or invading the bottom layers were fixed with 4% paraformaldehyde, following by staining with 0.1% crystal violet. The nonmigratory cells on the upper side of the membrane were scraped off with a cotton tip. Migrated and invasive cells were photographed under an inverted microscope and counted using the ImageJ software.
Animals
BALB/c nude mice and C57BL/6 mice were originally provided by Shanghai Slack in Laboratory Animal Ltd. The animals were maintained under a specific pathogen free (SPF) condition with 12/12 h light/dark cycles. All animal experiments were approved by the Shanghai Jiao Tong University School of Medicine Institutional Animal Care and Use Committee (IACUC).
Male BALB/c nude mice (6 weeks old) were used for tumor metastasis study. Briefly, 2 × 106 HCT116 cells stably transfected with shNC or shSCD1 were suspended in 100 μl PBS and injected through tail vein. Mice were sacrificed 6 weeks later, and lungs were harvested for histological examination of metastasis.
Male mice at 8 weeks of age were used for insulin resistance/T2DM model. Mice were maintained in 12/12 h light/dark cycles and fed either chow diet or high-fat diet (D12492, Research Diets). After 3 months, IPGTT and ITT were performed and mice were sacrificed.
Lipidomics
The shNC and shSCD1 HCT116 cells were harvested when cell confluence was over 90%. After a series of addition of cold methanol/water (4:3, v/v), chloroform and centrifugation, the chloroform layers were collected and dried under gentle nitrogen stream. For the lipid analysis, lipid extract was reconstituted in 150 μL isopropyl/alcohol/acetonitrile/water (2:1:1). After centrifuging at 14000 rpm for 10 min, the supernatants were injected. The lipid supernatants were analyzed via ultra-performance liquid chromatography (UPLC) coupled to a SYNAPT G2 HDMS time of flight-mass spectrometry (UPLC-TOF/MS) (Waters Corporation, Milford, MA) through an electrospray ionization positive and negative full scan mode. The scan range was m/z 150–1200 (for positive mode) and m/z 90–1000(for negative mode). Lipids were separated on a Waters Acquity UPLC HSS T3 column (1.8 μm, 100 mm*2.1 mm) equipped with a Waters Acquity UPLC HSS T3 VanGuard Pre-column (1.8 μm, 5 mm*2.1 mm) maintained at 55 °C. Gradient elution was adopted with a flow rate at 0.3 mL/min. The lipid data was analyzed using Progenesis QI software (Waters Corporation, Milford, MA).Abundance of lipids were normalized by cell counts.
After summarizing the linked fatty acid compositions in lipidomic data, we calculated the p value and log2 (fold change) and made the volcano plot by R-Studio, taking log2 (fold change) as X axis and –log10 (P value) as Y axis.
Statistical analysis
All experiments were performed in triplicate. All data were present as mean ± standard deviation. All graphing and statistical analyses were performed using GraphPad Prism 6 software (GraphPad Software, La Jolla, CA, USA) and SPSS 19 (IBM SPSS, IBM, Armonk, NY, USA). Correlations between the level of SCD1 in CRC tissues and clinic-pathological parameters were analyzed by Fisher’s exact tests. Comparison of survival between groups was performed using the log-rank test and Kaplan-Meier curves were plotted. The other data statistics were performed with student’s t-test in two groups. P value < 0.05(*), P value < 0.01(**) and P value < 0.001(***) were set as statistical significance.
Discussion
CRC is one of the most common malignancies which have a higher morbidity in diabetic patients [
2]. Upregulation of SCD1 activity and/or expression has been reported as a risk factor for CRC [
18,
48]. Besides, after being treated with SCD1 antagonist, the growth of xenograft tumors generated from HCT116 cells was reduced in mice [
49]. However, the mechanistic role of SCD1 in CRC metastasis remains to be elucidated. Poor prognosis of CRC is usually due to tumor metastasis and recurrence. So, identification of the role of SCD1 in CRC progression will provide effective strategies to improve advanced CRC patients’ prognosis.
Accumulating data indicate elevated SCD1 activity and increased levels of MUFAs in parallel to reduced SFA levels present in neoplastic cells and tumor tissues [
14,
50]. In our study, analysis of human CRC tissues and CRC database revealed high SCD1 levels in human CRC tissues and SCD1 had a negative correlation with CRC prognosis. Moreover, our in vitro study showed SCD1 could promote migration and invasion of CRC cells by regulating EMT. The lipidomics result in this study showed that MUFA levels and the ratio of MUFA and SFA in lipids of CRC cells were reduced after SCD1 knockdown, leading to a difference in the relative abundance of many lipid fractions. Furthermore, we found that MUFA stimulated migration and invasion of CRC cells and could reverse the reduced migration and invasion rates of SCD1 knockdown cells, which is consistent with the notion that high SCD1 levels and subsequently altered fatty acid composition are biochemical features of cancers [
14].
T2DM, a common metabolic disorder, often results in hyperglycemia, insulin resistance and dyslipidemia. As one of the target genes of ChREBP, a glucose sensing transcription factor, SCD1 plays an important role in T2DM [
51]. Our previous study showed
advanced glycation end products (AGEs) in T2DM promoted CRC cell proliferation by increasing ChREBP expression [
52]. Here, our data demonstrated that glucose increased expression of both ChREBP and SCD1 in CRC cells. Taken together, these results suggested the high glucose could induce upregulation of colorectal SCD1 and this may be mediated by activation of ChREBP.
Previous meta-analysis and pathologic analysis showed CRC patients with diabetes have more tumor invasion, higher TNM staging and increased mortality, compared to those without diabetes [
53,
54]. Our previous study showed diabetes aggravates CRC by increasing
specificity protein 1 (Sp1) expression [
55]. However, whether SCD1 is induced in the process of diabetes-related CRC progression is elusive. In this study, we used CRC cell lines to verify high glucose promoted CRC cells migration and invasion. These data are consistent with epidemiological studies that diabetic CRC patients have a poor outcome and higher mortality [
54]. In addition, the promotion of migration and invasion by high glucose showed positive correlation with the level of SCD1. Our results indicate that SCD1 may be part of the diabetic CRC development mechanism.
As mentioned above, high SCD1 activity and elevated unsaturated fatty acids levels are common signs of cancers. Several previous studies suggest that unsaturated fatty acids can promote hepatoma and hepatic steatosis progression through downregulation of PTEN [
41,
42,
56]. Our data showed high glucose increased expression of SCD1, leading to MUFA-induced CRC progression by suppressing PTEN and promoting EMT. The results were consistent with findings that loss of function of PTEN can promote cancers progression by regulating EMT in many cancers [
57,
58]. Furthermore, after changing PTEN expression levels, the inhibitory or promoting effect caused by SCD1 knockdown or overexpression alleviated. Previous study showed that high glucose could promote cancer progression by suppressing PTEN in human breast cancer cells [
59]. The relationship between hyperglycemia and EMT has been revealed in several cancers [
58‐
61]. We observed that high glucose conditions led to decreased PTEN expression and increased EMT, accompanied by increased SCD1 expression in HCT116 cells, compared with physiological glucose concentrations. Consequently, protein levels of EMT markers and phosphorylation of AKT, which were under the regulation of PTEN, altered accordingly after SCD1 knockdown. Therefore, these data indicate that high glucose-induced CRC progression may be partly due to downregulation of PTEN and its downstream EMT.
Acknowledgements
We thank Dr. Yu Liang,Lei Liu and Kai Wang at Shanghai Jiao Tong University School of Medicine for providing skills for database analysis and tail vein injection.