Background
Materials and methods
Reagents
Cell lines and cell culture
MTT assay
Real-time RT-PCR
Gene | RefSeq | Forward oligo sequence | Reverse oligo sequence |
---|---|---|---|
ABCB1 | NM_000927 | AGCTCGTGCCCTTGTTAGACA | GTCCAGGGCTTCTTGGACAA |
ABCB5 | NM_178559 | CACAAAAGGCCATTCAGGCT | GCTGAGGAATCCACCCAATCT |
ABCB8 | NM_007188 | CATCGCCTTCAACTGCATGG | GACCTTTGCACTGTCTGGGA |
ABCB10 | NM_012089 | TGCGGTTGGATTTCTCACGA | CACACAGAAACACGGCACTG |
ABCC1 | NM_004996 | CGCTCTGGGACTGGAATGT | AGGTAAAAACAAGGCACCCA |
ABCC2 | NM_000392 | TGCACAAGCAACTGCTGAAC | CCTCTGGCCTATGCTCAGGTT |
ABCC3 | NM_020038 | ACCCAGTTTGATACCTGCACTGT | GGACCCTGGTGTAGTCCATGA |
ABCC4 | NM_005845 | TTGGACACGGTAACTGTTGCA | GGAATGTCGGTTAGAGGTTTGG |
ABCC5 | NM_005688 | ATTTGGACCCCTTCAACCAGTAC | GGTAGCTGAGCAATACATTCTTTCAT |
ABCC10 | NM_033450 | CCTGTTGTTGGTGCTCTTCC | GGCCCTGTCCTTATGTAGGC |
ABCG2 | NM_004827 | TATAGCTCAGATCATTGTCACAGTC | GTTGGTCGTCAGGAAGAAGAG |
GAPDH | NM_002046 | CCACCCATGGCAAATTCC | TCGCTCCTGGAAGATGGTG |
Efflux assay of doxorubicin
Gel electrophoresis
In-gel digestion
LC–MS/MS
Results
Sulbactam potentiates doxorubicin sensitivity in breast cancer cells
Cell line | IC50 of Doxorubicin (Dox, μM) | Resistance fold | |
---|---|---|---|
Dox | Dox + Sul | Dox + Sul/Dox | |
MCF10A | 2.51 | 2.50 | 1.00 |
BT474 | 1.14 | 0.54 | 0.47 |
MCF-7 | 0.69 | 0.37 | 0.54 |
MDA-MB-231 | 3.16 | 1.25 | 0.40 |
MDA-MB-361 | 0.89 | 0.46 | 0.51 |
MDA-MB-435 | 1.22 | 0.51 | 0.42 |
MDA-MB-453 | 0.69 | 0.27 | 0.39 |
MDA-MB-468 | 0.27 | 0.05 | 0.20 |
T47D | 8.53 | 3.83 | 0.45 |
Proteomic profiling of total proteins from MDA-MB-468 cells treated with and without sulbactam in presence of doxorubicin
Protein name | Abbreviation | UniProt ID | Mass (Da) | pI | Spectrum count | Dox + Sul/Dox | p value | Biological process | |
---|---|---|---|---|---|---|---|---|---|
Dox | Dox + Sul | Folda | |||||||
Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 | DHX15 | O43143 | 90,932.8 | 7.1 | 0.00 | 0.82 | 100.00 | 2.57E−07 | RNA processing |
U5 small nuclear ribonucleoprotein 200 kDa helicase | SNRNP200 | O75643 | 244,507.6 | 5.7 | 0.00 | 1.10 | 100.00 | 2.41E−02 | RNA processing |
Spliceosome RNA helicase DDX39B | DDX39B | Q5STU3 | 48,826.1 | 7.2 | 0.00 | 1.85 | 100.00 | 2.52E−05 | RNA processing |
ATP-dependent RNA helicase DDX3X | DDX3X | O00571 | 73,112.2 | 6.7 | 0.00 | 1.39 | 100.00 | 7.43E−04 | RNA processing |
Nucleolar protein 14 | NOP14 | P78316 | 97,668.7 | 9.1 | 0.00 | 0.96 | 100.00 | 1.50E−03 | RNA processing |
Growth arrest and DNA damage-inducible proteins-interacting protein 1 | GADD45GIP1 | Q8TAE8 | 25,383.9 | 9.5 | 0.00 | 1.09 | 100.00 | 2.70E−02 | Response to DNA damage |
26S protease regulatory subunit 6A | PSMC3 | P17980 | 49,203.5 | 5.1 | 0.27 | 1.11 | 4.06 | 4.64E−02 | Response to DNA damage |
Proteasome subunit beta type-4 | PSMB4 | P28070 | 29,204.3 | 9.1 | 0.00 | 0.96 | 100.00 | 1.08E−03 | Response to DNA damage |
Transformation/transcription domain-associated protein | TRRAP | Q9Y4A5 | 437,601.8 | 9.1 | 0.00 | 0.55 | 100.00 | 3.412E−05 | Response to DNA damage |
Protein DEK | DEK | P35659 | 42,674.4 | 9.3 | 0.00 | 1.53 | 100.00 | 6.37E−03 | Response to DNA damage |
Serine/threonine-protein kinase BRSK1 | BRSK1 | Q8TDC3 | 85,087.0 | 9.5 | 0.00 | 0.55 | 100.00 | 2.57E−07 | Response to DNA damage |
Adenomatous polyposis coli protein | APC | E7EMH9 | 32,790.8 | 5.4 | 0.00 | 0.55 | 100.00 | 3.41E−05 | Response to DNA damage |
Dihydropyrimidinase-related protein 2 | DPYSL2 | Q16555 | 62,293.6 | 5.9 | 0.00 | 0.98 | 100.00 | 1.32E−02 | Response to stress |
Sodium/potassium-transporting ATPase subunit beta-1 | ATP1B1 | P05026 | 35,061.3 | 9.1 | 0.00 | 1.11 | 100.00 | 7.81E−03 | Response to stress |
ERO1-like protein alpha | ERO1L | Q96HE7 | 51,991.8 | 5.4 | 0.00 | 0.56 | 100.00 | 1.12E−04 | Response to stress |
STE20-like serine/threonine-protein kinase | SLK | Q9H2G2 | 142,695.4 | 3.7 | 0.00 | 0.70 | 100.00 | 2.30E−02 | Response to stress |
Heat shock-related 70 kDa protein 2 | HSPA2 | P54652 | 70,021.0 | 5.6 | 0.00 | 2.69 | 100.00 | 9.41E−04 | Response to stress |
Putative heat shock 70 kDa protein 7 | HSPA6 | P48741 | 40,244.4 | 7.7 | 0.00 | 3.08 | 100.00 | 5.50E−03 | Response to stress |
Lipoprotein, Lp(A) | LPA | Q1HP67 | 226,516.1 | 7.2 | 0.00 | 0.55 | 100.00 | 2.57E−07 | Response to stress |
Apolipoprotein(a) | LPA | P08519 | 501,319.8 | 7.2 | 0.00 | 0.55 | 100.00 | 2.57E−07 | Response to stress |
Peroxiredoxin-6 | PRDX6 | P30041 | 24,903.8 | 6.0 | 0.27 | 1.68 | 6.15 | 1.42E−02 | Response to stress |
Solute carrier family 12 member 2 | SLC12A2 | P55011 | 131,447.1 | 6.0 | 0.37 | 2.21 | 6.03 | 4.53E−03 | Response to stress |
Thioredoxin-related transmembrane protein 1 | TMX1 | Q9H3N1 | 31,791.3 | 3.7 | 0.00 | 0.83 | 100.00 | 2.70E−04 | Response to stress |
Transmembrane protein 109 | TMEM109 | Q9BVC6 | 26,210.1 | 11.2 | 0.00 | 0.56 | 100.00 | 2.70E−04 | Response to stress |
MICOS complex subunit MIC60 | IMMT | Q16891 | 80,026.5 | 5.7 | 1.12 | 2.74 | 2.45 | 1.34E−04 | Response to stress |
Signal transducer and activator of transcription | STAT1 | J3KPM9 | 83,360.6 | 7.2 | 0.00 | 0.83 | 100.00 | 2.70E−04 | Response to stress |
cDNA FLJ78587 | TUBA1B | A8JZY9 | 50,135.7 | 5.4 | 4.80 | 14.97 | 3.12 | 5.22E−03 | Cytoskeleton organization |
Myosin regulatory light chain 12A | MYL12A | P19105 | 19,794.1 | 4.7 | 1.23 | 5.81 | 4.71 | 3.07E−02 | Cytoskeleton organization |
Myosin regulatory light chain 12B | MYL12B | O14950 | 19,779.2 | 4.7 | 1.23 | 5.81 | 4.71 | 3.07E−02 | Cytoskeleton organization |
Actin-like protein 8 | ACTL8 | Q9H568 | 41,360.4 | 7.2 | 0.27 | 1.11 | 4.06 | 4.64E−02 | Cytoskeleton organization |
Plastin-1 | PLS1 | Q14651 | 70,253.6 | 5.4 | 0.00 | 0.97 | 100.00 | 7.05E−03 | Cytoskeleton organization |
F-actin-capping protein subunit beta | CAPZB | P47756 | 31,219.3 | 5.4 | 0.00 | 2.46 | 100.00 | 4.59E−02 | Cytoskeleton organization |
Vimentin | VIM | B0YJC5 | 26,858.9 | 3.7 | 0.00 | 0.69 | 100.00 | 2.03E−02 | Cytoskeleton organization |
Filamin A | FLNA | Q60FE5 | 278,226.9 | 7.2 | 2.51 | 7.53 | 3.01 | 2.05E−02 | Cytoskeleton organization |
Tubulin-folding cofactor B | TBCB | Q99426 | 27,325.5 | 8.7 | 0.00 | 0.70 | 100.00 | 2.30E−02 | Cytoskeleton organization |
Tubulin beta-3 chain | TUBB3 | Q13509 | 50,432.7 | 4.8 | 1.41 | 6.70 | 4.75 | 3.23E−02 | Cytoskeleton organization |
Tubulin beta-4A chain | TUBB4A | P04350 | 49,585.8 | 4.8 | 0.00 | 1.94 | 100.00 | 2.70E−04 | Cytoskeleton organization |
Kinesin heavy chain isoform 5C | KIF5C | O60282 | 109,494.8 | 5.9 | 0.00 | 1.10 | 100.00 | 3.85E−02 | Cytoskeleton organization |
Septin-9 | SEPTIN9 | Q9UHD8 | 65,401.6 | 9.5 | 0.00 | 1.40 | 100.00 | 1.64E−02 | Cytoskeleton organization |
Laminin subunit alpha-2 | LAMA2 | A0A087WYF1 | 343,419.0 | 7.2 | 0.28 | 1.26 | 4.46 | 4.32E−02 | Cytoskeleton organization |
Malectin | MLEC | Q14165 | 32,233.9 | 7.2 | 0.00 | 0.70 | 100.00 | 2.15E−02 | Protein folding |
T-complex protein 1 subunit gamma | CCT3 | Q2TU64 | 60,579.1 | 7.2 | 0.00 | 3.62 | 100.00 | 1.49E−02 | Protein folding |
Vesicle-associated membrane protein-associated protein B/C | VAPB | E5RK64 | 7801.0 | 9.5 | 0.00 | 1.54 | 100.00 | 3.83E−02 | Protein folding |
PEST proteolytic signal-containing nuclear protein | PCNP | Q8WW12 | 18,924.9 | 6.9 | 0.28 | 1.91 | 6.95 | 2.46E−02 | Ubiquitin-dependent protein catabolic process |
NEDD8-conjugating enzyme Ubc12 | UBE2 M | P61081 | 20,900.0 | 9.1 | 0.00 | 0.83 | 100.00 | 2.70E−04 | Ubiquitin-dependent protein catabolic process |
Cullin-3 | CUL3 | A0A087WTG3 | 39,147.2 | 9.5 | 0.00 | 1.94 | 100.00 | 2.70E−04 | Ubiquitin-dependent protein catabolic process |
Coatomer subunit beta | COPB1 | P53618 | 107,142.6 | 7.2 | 0.00 | 1.10 | 100.00 | 3.02E−02 | Vesicle-mediated transport |
Endoplasmic reticulum resident protein 29 | ERP29 | F8VY02 | 18,115.9 | 9.1 | 0.00 | 0.55 | 100.00 | 3.41E−05 | Vesicle-mediated transport |
Kinesin-like protein KIF16B | KIF16B | Q96L93 | 152,011.7 | 7.2 | 0.00 | 1.12 | 100.00 | 3.33E−02 | Vesicle-mediated transport |
Phosphatidylinositol N-acetylglucosaminyltransferase subunit A | PIGA | P37287 | 54,126.7 | 9.1 | 0 | 0.55 | 100.00 | 2.574E−07 | Vesicle-mediated transport |
Ras-related protein Rab-35 | RAB35 | Q15286 | 23,025.3 | 9.1 | 0.00 | 0.98 | 100.00 | 8.01E−03 | Vesicle-mediated transport |
Ras-related protein Rab-15 | RAB15 | P59190 | 24,390.6 | 5.5 | 0.00 | 0.98 | 100.00 | 8.01E−03 | Vesicle-mediated transport |
Ras-related protein Rab-15 isoform AN2 | RAB15 | G5ELZ5 | 13,781.8 | 9.1 | 0.00 | 0.98 | 100.00 | 8.01E−03 | Vesicle-mediated transport |
Ras-related protein Rab-15 isoform AN3 | RAB15 | G5ELZ6 | 12,759.7 | 9.1 | 0.00 | 0.98 | 100.00 | 8.01E−03 | Vesicle-mediated transport |
Enolase | ENO1 | F5H0C8 | 34,762.3 | 3.6 | 0.00 | 0.83 | 100.00 | 2.70E−04 | Carbohydrate metabolism |
Phosphoglycerate mutase | PGAM1 | A4D2J6 | 28,219.6 | 9.5 | 0.00 | 1.40 | 100.00 | 2.15E−02 | Carbohydrate metabolism |
ATP-dependent 6-phosphofructokinase, platelet type | PFKP | B1APP8 | 22,939.3 | 9.1 | 0.00 | 0.56 | 100.00 | 1.12E−04 | Carbohydrate metabolism |
Gamma-enolase | ENO2 | P09104 | 47,268.6 | 4.9 | 0.00 | 0.83 | 100.00 | 2.70E−04 | Carbohydrate metabolism |
Transaldolase | TALDO1 | F2Z393 | 35,328.9 | 9.5 | 0.00 | 2.75 | 100.00 | 3.85E−02 | Carbohydrate metabolism |
Ganglioside-induced differentiation-associated protein 1 | GDAP1 | Q8TB36 | 41,345.8 | 9.1 | 0.00 | 0.56 | 100.00 | 2.70E−04 | Amino acid metabolic process |
Multifunctional methyltransferase subunit TRM112-like protein | TRMT112 | F5GX77 | 11,972.0 | 7.8 | 0.00 | 0.56 | 100.00 | 1.12E−04 | Amino acid metabolic process |
GCSH protein | GCSH | Q6IAT2 | 19,025.8 | 3.7 | 0.00 | 0.96 | 100.00 | 8.84E−03 | Amino acid metabolic process |
Elongation factor 1-alpha 2 | EEF1A2 | Q05639 | 50,470.2 | 9.1 | 0.00 | 3.21 | 100.00 | 1.94E−02 | Positive regulation of apoptotic process |
Apoptotic chromatin condensation inducer in the nucleus | ACIN1 | Q9UKV3 | 151,861.9 | 5.4 | 0.00 | 0.82 | 100.00 | 1.30E−02 | Positive regulation of apoptotic process |
Protein name | Abbreviation | UniProt ID | Mass (Da) | pI | Spectrum count | Dox + sul/Dox | p value | Biological process | |
---|---|---|---|---|---|---|---|---|---|
Dox | Dox + Sul | Folda | |||||||
60S ribosomal protein L4 | RPL4 | P36578 | 47,566.1 | 11.1 | 4.53 | 1.96 | − 2.31 | 2.25E−02 | Translation |
60S ribosomal protein L17 | RPL17 | J3QLC8 | 20,246.8 | 9.5 | 1.84 | 0.27 | − 6.76 | 4.24E−02 | Translation |
60S ribosomal protein L24 | RPL24 | C9JXB8 | 14,368.8 | 11.3 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Translation |
60S ribosomal protein L27a | RPL27A | P46776 | 16,430.2 | 11.0 | 3.20 | 1.47 | − 2.17 | 1.42E−02 | Translation |
60S ribosomal protein L37a | RPL37A | P61513 | 10,275.3 | 9.5 | 1.39 | 0.00 | − 100.00 | 4.08E−03 | Translation |
40S ribosomal protein S3a | RPS3A | D6RAT0 | 25,887.1 | 9.5 | 7.51 | 0.00 | − 100.00 | 4.01E−03 | Translation |
Eukaryotic translation initiation factor 1A, Y-chromosomal | EIF1AY | O14602 | 16,442.4 | 4.6 | 0.65 | 0.00 | − 100.00 | 1.43E−03 | Translation |
Eukaryotic translation initiation factor 1A, X-chromosomal | EIF1AX | P47813 | 16,460.4 | 4.6 | 0.65 | 0.00 | − 100.00 | 1.43E−03 | Translation |
Eukaryotic translation initiation factor 4 gamma 1 | EIF4G1 | B2RU10 | 176,207.3 | 5.4 | 1.12 | 0.00 | − 100.00 | 3.18E−02 | Translation |
Eukaryotic translation initiation factor 3 subunit J | EIF3 J | O75822 | 29,062.4 | 3.7 | 1.38 | 0.27 | − 5.10 | 1.16E−02 | Translation |
Eukaryotic translation initiation factor 6 | EIF6 | P56537 | 26,599.2 | 3.7 | 0.70 | 0.00 | − 100.00 | 2.17E−02 | Translation |
Nascent polypeptide-associated complex subunit alpha | NANA2 | Q13765 | 23,383.9 | 4.5 | 1.57 | 0.00 | − 100.00 | 1.47E−03 | Translation |
Nascent polypeptide-associated complex subunit alpha, muscle-specific form | NANA | F8VZJ2 | 15,016.0 | 4.9 | 1.57 | 0.00 | − 100.00 | 1.47E−03 | Translation |
Eukaryotic translation elongation factor 1 beta 2 | EEF1B2 | A4D1M6 | 24,891.0 | 3.7 | 1.26 | 0.00 | − 100.00 | 7.44E−03 | Translation |
Heterogeneous nuclear ribonucleoprotein D0 | HNRNPD | Q14103 | 38,434.2 | 7.6 | 4.25 | 2.39 | − 1.78 | 2.07E−02 | Translation |
MAP kinase-interacting serine/threonine-protein kinase 1 | MKNK1 | E9PMF1 | 12,586.3 | 9.5 | 0.84 | 0.00 | − 100.00 | 8.80E−07 | Translation |
Heterogeneous nuclear ribonucleoproteins C1/C2 | HNPNPC | G3V2Q1 | 33,570.9 | 5.0 | 3.50 | 0.81 | − 4.30 | 2.30E−02 | Translation |
KH domain-containing, RNA-binding, signal transduction-associated protein 1 | KHDRBS1 | Q07666 | 48,227.3 | 8.7 | 0.97 | 0.00 | − 100.00 | 1.21E−02 | Regulation of transcription |
High mobility group protein HMG-I/HMG-Y | HMGA1 | P17096 | 11,544.8 | 10.3 | 1.53 | 0.70 | − 2.19 | 2.87E−02 | Regulation of transcription |
cDNA FLJ54188, moderately similar to High mobility group protein HMG-I/HMG-Y | HMGA1 | B4DWA0 | 34,301.4 | 10.4 | 1.53 | 0.70 | − 2.19 | 2.87E−02 | Regulation of transcription |
Serrate RNA effector molecule homolog | SRRT | Q9BXP5 | 100,666.7 | 7.2 | 0.97 | 0.00 | − 100.00 | 7.88E−03 | Regulation of transcription |
Protein SIX6OS1 | C14orf39 | Q8N1H7 | 68,166.0 | 5.4 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Regulation of transcription |
Heterogeneous nuclear ribonucleoprotein D-like | HNRPDL | O14979 | 46,437.5 | 9.6 | 2.23 | 0.00 | − 100.00 | 9.63E−03 | Regulation of transcription |
Zinc finger and BTB domain-containing protein 14 | ZFP161 | O43829 | 50,956.5 | 5.4 | 0.74 | 0.00 | − 100.00 | 9.26E−03 | Regulation of transcription |
Golgin-45 | BLZF1 | Q9H2G9 | 44,910.4 | 9.1 | 0.70 | 0.00 | − 100.00 | 1.68E−02 | Regulation of transcription |
Zinc finger protein neuro-d4 | DPF1 | E9PDV3 | 45,285.6 | 7.2 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Regulation of transcription |
Histone cluster 1, H1e | HIST1H1E | Q4VB24 | 21,893.3 | 9.5 | 4.44 | 0.00 | − 100.00 | 1.25E−02 | Regulation of transcription |
Serine/arginine-rich splicing factor 10 | SRSF10 | O75494 | 31,300.5 | 11.2 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | RNA processing |
Heterogeneous nuclear ribonucleoprotein Q | SYNCRIP | O60506 | 69,471.4 | 8.7 | 5.98 | 1.95 | − 3.07 | 3.52E−02 | RNA processing |
Transformer-2 protein homolog alpha | TRA2A | Q13595 | 32,688.6 | 11.2 | 1.11 | 0.18 | − 6.02 | 3.23E−02 | RNA processing |
Multidrug resistance protein 1 | ABCB1 | P08183 | 141,479.1 | 9.1 | 3.47 | 0.84 | − 4.13 | 5.08E−04 | Transporters |
ATP-binding cassette sub-family G member 2 | ABCG2 | Q9UNQ0 | 72,314.0 | 8.9 | 1.66 | 0.36 | − 4.56 | 1.05E−03 | Transporters |
ATP-binding cassette sub-family A member 8 | ABCA8 | O94911 | 179,245.9 | 9.1 | 0.56 | 0.00 | − 100.00 | 8.80E−07 | Transporters |
Sodium/potassium-transporting ATPase subunit alpha-4 | ATP1A4 | E9PRA5 | 57,244.4 | 9.1 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Transporters |
Syntaxin-8 | STX8 | Q9UNK0 | 26,906.8 | 3.7 | 0.56 | 0.00 | − 100.00 | 8.80E−07 | Transporters |
Wiskott-Aldrich syndrome protein family member 1 | WASF1 | Q92558 | 61,652.4 | 5.4 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Cytoskeleton organization |
Actin-related protein 2/3 complex subunit 2 | ARPC2 | O15144 | 34,333.1 | 9.1 | 1.23 | 0.00 | − 100.00 | 5.68E−03 | Cytoskeleton organization |
Actin-related protein 2/3 complex subunit 3 | ARPC3 | O15145 | 20,415.5 | 8.8 | 0.97 | 0.00 | − 100.00 | 7.88E−03 | Cytoskeleton organization |
Ras GTPase-activating-like protein IQGAP1 | IQGAP1 | P46940 | 189,120.8 | 6.1 | 1.25 | 0.00 | − 100.00 | 4.32E−04 | Cytoskeleton organization |
Myosin light chain 6B | MYL6B | P14649 | 22764.1 | 6.3 | 2.23 | 0.00 | − 100.00 | 8.80E−07 | Cytoskeleton organization |
TBC1 domain family member 31 | WDR67 | Q96DN5 | 124189.8 | 9.1 | 1.11 | 0.00 | − 100.00 | 9.75E−04 | Cytoskeleton organization |
Prelamin-A/C | LMNA | Q5TCI8 | 55762.4 | 6.6 | 10.73 | 0.28 | − 37.73 | 1.74E−02 | Cytoskeleton organization |
Lamin A/C | LMNA | W8QEH3 | 65116.9 | 9.1 | 11.69 | 0.00 | − 100.00 | 8.86E−03 | Cytoskeleton organization |
Calumenin | CALU | O43852 | 34961.1 | 4.5 | 1.66 | 0.36 | − 4.60 | 2.73E−02 | Cytoskeleton organization |
Lamina-associated polypeptide 2, isoforms beta/gamma | TMPO | P42167 | 50670.3 | 9.5 | 1.85 | 0.74 | − 2.49 | 2.75E−02 | Cytoskeleton organization |
Kinesin-like protein | KIF15 | A0A087X0P0 | 312105.2 | 5.5 | 2.19 | 0.00 | − 100.00 | 6.76E−06 | Cytoskeleton organization |
DnaJ homolog subfamily A member 1 | DNAJA1 | P31689 | 44868.4 | 7.2 | 1.26 | 0.36 | − 3.44 | 2.12E−02 | Protein folding |
T-complex protein 1 subunit epsilon | CCT5 | P48643 | 59539.8 | 5.4 | 3.47 | 0.41 | − 8.39 | 9.26E−03 | Protein folding |
T-complex protein 1 subunit beta | CCT2 | P78371 | 57357.0 | 6.0 | 1.11 | 0.00 | − 100.00 | 1.30E−04 | Protein folding |
Cysteine and histidine-rich domain-containing protein 1 | CHORDC1 | Q9UHD1 | 37489.9 | 7.2 | 0.55 | 0.00 | − 100.00 | 6.76E−06 | Protein folding |
CDC37 protein | CDC37 | Q6FG59 | 44453.5 | 3.7 | 1.78 | 0.41 | − 4.38 | 4.29E−02 | Protein folding |
26S proteasome non-ATPase regulatory subunit 7 | PSMD7 | P51665 | 37025.4 | 6.3 | 0.69 | 0.00 | − 100.00 | 1.95E−02 | Protein catabolic process |
Proteasome subunit beta type-3 | PSMB3 | P49720 | 22949.0 | 9.1 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Protein catabolic process |
Proteasome subunit alpha type-4 | PSMA4 | P25789 | 29483.8 | 7.6 | 0.65 | 0.00 | − 100.00 | 1.01E−03 | Protein catabolic process |
Ubiquitin carboxyl-terminal hydrolase 43 | USP43 | Q70EL4 | 122809.5 | 9.5 | 0.83 | 0.00 | − 100.00 | 4.42E−02 | Protein catabolic process |
Enolase-like protein ENO4 | ENO4 | J3KNX1 | 68464.9 | 6.3 | 1.11 | 0.00 | − 100.00 | 5.54E−03 | Carbohydrate metabolism |
PCK2 protein | PCK2 | Q6IB91 | 70697.2 | 7.2 | 0.70 | 0.00 | − 100.00 | 2.17E−02 | Carbohydrate metabolism |
Fructose-bisphosphate aldolase | ALDOC | A8MVZ9 | 36295.3 | 7.6 | 1.53 | 0.00 | − 100.00 | 2.78E−03 | Carbohydrate metabolism |
Cytochrome c oxidase subunit 5A, mitochondrial | COX5A | H3BNX8 | 17234.9 | 7.2 | 1.24 | 0.00 | − 100.00 | 4.42E−02 | Mitochondrial metabolic process |
Cytochrome b5 type B | CYB5B | J3KNF8 | 16694.6 | 6.3 | 0.82 | 0.00 | − 100.00 | 4.69E−02 | Mitochondrial metabolic process |
Cytochrome b-c1 complex subunit 1, mitochondrial | UQCRC1 | P31930 | 52646.0 | 7.2 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Mitochondrial metabolic process |
MICOS complex subunit MIC19 | CHCHD3 | Q9NX63 | 26152.4 | 9.1 | 0.70 | 0.00 | − 100.00 | 1.68E−02 | Mitochondrial metabolic process |
Phosphoenolpyruvate carboxykinase [GTP], mitochondrial | PCK2 | Q16822 | 70730.2 | 7.2 | 0.70 | 0.00 | − 100.00 | 2.17E−02 | Mitochondrial metabolic process |
Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial | DLST | P36957 | 48755.5 | 9.5 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Mitochondrial metabolic process |
Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial | PDHA1 | P08559 | 43295.8 | 9.1 | 0.56 | 0.00 | − 100.00 | 1.30E−04 | Mitochondrial metabolic process |
Apoptosis inhibitor 5 | API5 | Q9BZZ5 | 59004.7 | 9.1 | 1.21 | 0.27 | − 4.44 | 4.79E−02 | Negative regulation of apoptotic process |
Epidermal growth factor receptor | EGFR | A9CB80 | 132022.7 | 6.2 | 6.03 | 0.54 | − 11.12 | 5.65E−03 | Signal transduction |
A-kinase anchor protein 9 | AKAP9 | Q99996 | 453668.7 | 3.7 | 0.84 | 0.00 | − 100.00 | 7.75E−05 | Signal transduction |
Rho GDP-dissociation inhibitor 1 | ARHGDIA | J3KS60 | 9944.0 | 4.2 | 0.65 | 0.00 | − 100.00 | 5.33E−03 | Signal transduction |
Serine/threonine-protein phosphatase PP1-alpha catalytic subunit | PPP1CA | P62136 | 37512.2 | 7.2 | 1.81 | 0.00 | − 100.00 | 4.26E−03 | Signal transduction |