Temozolomide promotes genomic and phenotypic changes in glioblastoma cells

To reveal the TMZ-promoted karyotypic and phenotypic changes, U251TMZ1, U251TMZ2, T98GTMZ, and C6TMZ cells were derived by repetitively exposing U251, T98G and C6 cells to TMZ (100 µM) in vitro, whereas C6R1 and C6R2TMZ cells were established in vivo [50 mg/kg, 10 intraperitoneal (i.p.) injections]. The vehicle-treated U251 cells were predominantly hyperdiploid with the mean number of chromosomes 53 ± 9.2; 11 % of cells contained more than 60 chromosomes/cell and 4.5 % of cells had more than 90 chromosomes/cell (calculated from 200 metaphases). In contrast, U251TMZ1 cells were mainly hypertetraploid with the mean number of chromosomes 100 ± 8.2 (90 %). The U251TMZ2 cells consisted of two subpopulations: a predominant subpopulation with a hyperdiploid karyotype (53.9 ± 7.5; 60 %) and a subpopulation with a hypertetraploid karyotype (108.2 ± 13.4; 27 %). A total portion of U251TMZ2 cells with more than 60 chromosomes/cell increased up to 40 % (Fig. 1a, b).

It was reported [11] that TMZ-resistant lines derived from a hyperdiploid SNB19 cell line (which is itself a derivative of U251 cells [23]) had deviations from a parental modal chromosome number or ploidy change, however, no analysis of CIN was performed. To visualize and compare CIN between cell lines, we used karyographs, 3-dimensional graphs, where x-axis designates the normal and aberrant chromosomes (clonal and non-clonal chromosome aberrations (CCAs/NCCAs), y-axis—the chromosome copy numbers, and z-axis—the numbers of metaphases arrayed for comparison to each other [33]. The karyographs show the degree of clonality and variability of chromosomes between individual cells of a cell line by comparing the copy numbers of intact and abnormal chromosomes of metaphases to each other. The karyotype differences between cell lines were demonstrated by alignment and comparison of karyographs of vehicle- and TMZ-treated derivatives. Karyotype changes of U251TMZ1 cells were accompanied by a loss of 5 CCAs, an acquisition of 21 new CCAs and a higher total number, frequency and per cell variation of NCCAs. Karyotype changes of U251TMZ2 hyperdiploid subpopulation were a loss of 5 and a gain of 8 new CCAs with an increase in the total number and per cell variation of NCCAs, whereas polyploid subpopulation was characterized by a loss of 4 and an acquisition of 17 new CCAs with an increase in the total number and per cell variation of NCCAs (Fig. 1c, d; Additional file 1: Table S1). Many CCAs were distinct between U251TMZ1 and U251TMZ2 cells. Analysis of array comparative genome hybridization (aCGH) data revealed striking differences in copy number alterations (CNAs) between U251, U251TMZ1 and U251TMZ2 cells (Fig. 1e; Additional file 2: Table S2).

Both T98G and T98GTMZ cells had a near-pentaploid karyotype with the mean numbers of chromosomes 121.5 ± 8.7 and 120 ± 8.3, respectively. Karyotype changes of T98GTMZ cells were accompanied by a loss of 13 CCAs, an acquisition of 20 new CCAs and a higher total number, frequency and per cell variation of NCCAs (Fig. 2a, b; Additional file 3: Table S3). The most obvious differences of CNAs between T98GTMZ and T98G cells were a loss of 4p15.2-p14 and 10p15.3-p11.21 in T98GTMZ cells and a gain of 2q37.1-q37.3, 5q35.1-q35.3, 6p22.1-p21.31, 17q25.1q25.3, and a loss of 18q11.2-q12.1 in T98G cells (Fig. 2c; Additional file 4: Table S4).

A morphometric analysis of C6R1 and C6R2TMZ glioma volume after 2 weeks of i.p. injection of DMSO or TMZ showed apparent differences in growth (≈75 versus ≈30 mm³) (Fig. 3a). C6TMZ, C6R1 and C6R2TMZ cells were near-diploid with the mean chromosome numbers 40–41 (±4.1–7.1) (Fig. 3b, c) and presented the selected subclones of karyotypically heterogeneous C6 cell line. Karyotype changes of C6TMZ cells and to a larger extent of C6R2TMZ cells were characterized by a reduction of a total number of CCAs and NCCAs. Interestingly, C6R1 also demonstrated a reduction of a total number of CCAs and NCCAs, suggesting that in vivo TMZ-treated cells underwent a two-stage selection: by the rat brain microenvironment and TMZ treatment (Fig. 3d, e; Additional file 5: Table S5). The major aberrations detected by aCGH and shared by C6 derivatives were a gain of 7p21.1-q31.1 and a loss of 16q12.1-q24.3. Additionally, C6TMZ but not C6R2TMZ cells demonstrated a gain of 4p16.1-q26 (Fig. 3f; Additional file 6: Table S6). Using the DAVID bioinformatics resource [39], a list of 613 well-annotated genes in this region was retrieved (Additional file 7: Table S7a). We also manually curated a list of published proteins/miRNAs that were shown to contribute to TMZ resistance (Additional file 8: Table S8). Then we cross-checked both lists and revealed at least 15 hits (marked in Additional file 7: Table S7a). Cross-checking with a list of 1221 putative genes extracted from the NCBI Map Viewer for the chromosomal region of interest produced several additional hits (marked in Additional file 7: Table S7B). Thus, TMZ treatment in vitro favoured selection of cells with a gain of the chromosomal region enriched in genes conferring resistance to TMZ. Copy number gain of the 4p16.1-q26 region in only in vitro TMZ-treated C6 cells may potentially result from a different TMZ concentration as well as in vitro versus in vivo cytotoxic effects. Firstly, tumour TMZ C_max varied at 20.6 ± 13.4 µM/L across glioma bearing rats after 20 mg/kg intra-venous (i.v.) injections [40]. Hence TMZ tumour concentration following 50 mg/kg i.p. injections, a dose used in this study, should still be lower than that used in culture (100 µM). Secondly, we and others demonstrated the formation in vivo of connexin 43-mediated gap junction channels between glioma cells and astroglia [41, 42]; this communication significantly reduces TMZ cytotoxicity [43].

To elucidate how TMZ affected oncogenic characteristics of cells, we first analyzed cell proliferation. Previous studies demonstrated that the proliferation of long-term TMZ-treated glioblastoma cells was increased, decreased or unchanged (Table 1). U251 cells proliferated faster than U251TMZ1 cells but slower than U251TMZ2 cells. No difference in proliferation between T98G and T98GTMZ cells was observed. C6TMZ and C6R2TMZ cells proliferated slower than C6 and C6R1 cells, respectively. Furthermore, C6R1 and C6R2TMZ cells proliferated slower than C6 and C6TMZ cells, respectively (Fig. 4a), suggesting that the rat brain microenvironment might preferentially select for slower-dividing C6 cells. On the other hand, in vivo grown C6 derivatives, adapted for the different metabolic and growth-stimulating microenvironment within the brain, may undergo stress, when reintroduced to an in vitro culture. Additionally, we cannot exclude an effect of DMSO as it induced cytotoxicity at certain concentrations in vivo [44]. However, much lower DMSO concentration/volume (20 %/200 µl) was injected during this study than was previously reported in ([44] and refs therein).

Previous studies showed that TMZ or radiotherapy with TMZ treatment of glioblastoma cells was associated with a reduced glucose uptake [10, 22]. To test the sensitivity of cell growth to a glucose concentration reduction, proliferation was analyzed in low-glucose medium (1 g/L glucose) and compared to high-glucose medium (4.5 g/L glucose). Proliferation of U251cells did not change, was slightly increased for U251TMZ1 cells but reduced for U251TMZ2 cells. Furthermore, in contrast to high-glucose medium, no significant difference in proliferation was observed between U251, U251TMZ1 and U251TMZ2 cells in low-glucose medium (Fig. 4b). Both T98G and T98GTMZ cells were highly sensitive to a reduction in glucose concentration, demonstrating significantly inhibited, comparable growth. Proliferation of C6 cells was also reduced in low-glucose medium, whereas no change in proliferation was detected for C6TMZ, C6R1 and C6R2TMZ cells (Fig. 4b). Significantly, C6TMZ and C6R1 cells proliferated faster than C6 cells in low-glucose medium, whereas proliferation of C6 and C6R2TMZ cells was comparable (Fig. 4b).

An analysis of colony formation efficiency showed no significant difference between U251 and U251TMZ1 or U251TMZ2 cells; however, U251TMZ2 cells formed more colonies than U251TMZ1 cells. T98GTMZ cells formed more colonies than T98G cells, whereas C6TMZ and C6R2TMZ cells formed a fewer number of colonies than C6 and C6R1 cells, respectively (Fig. 4c). This is in agreement with the previous studies where it was demonstrated that colony formation efficiency or growth in vivo of long-term TMZ-treated cells was increased, decreased or unchanged (Table 1).

U251TMZ1 cells migrated faster than U251 cells but no difference in migration was observed between U251 and U251TMZ2 cells (Fig. 5a). Furthermore, no difference in migration was detected between T98G and T98GTMZ cells, whereas C6TMZ and C6R2TMZ cells migrated slower than C6 and C6R1 cells, respectively. In contrast to a migration analysis, transwell invasion assay demonstrated a lower and higher invasion rate of U251TMZ1 and U251TMZ2 cells, respectively (Fig. 5b). Similar to a migration analysis, no difference in invasion rate was observed between T98G and T98GTMZ cells. Similar results were obtained in the previous studies where migration or invasion of long-term TMZ-treated cells was found to be increased, decreased or unaffected (Table 1).

Quantitative real time PCR (qRT-PCR) analysis of the expression of stem cell markers CD133, OCT4, SOX2 and NANOG showed more than a twofold up-regulation of only CD133 in U251TMZ1 and U251TMZ2 cells, whereas more than a twofold down-regulation of CD133 was observed in T98GTMZ cells, OCT4 in T98GTMZ cells, and SOX2 in U251TMZ1 cells (Additional file 9: Figure S1a).

The TMZ-treated cell lines had individual patterns in expression/activation of signal transduction proteins (Fig. 6). An analysis of epithelial-mesenchymal transition (EMT) markers showed increased expression of Vimentin, Slug and Claudin-1 in U251TMZ2 cells and Vimentin in U251TMZ1 cells. No significant changes in EMT markers expression were revealed between T98G and T98GTMZ cells. U251TMZ2 but not U251TMZ1 cells had increased expression of MDM2. In contrast, U251TMZ1 but not U251TMZ2 cells had increased pAKT1, pERK1/2, and ASK1. T98GTMZ cells had increased pAKT1, pERK but not ASK1 and MDM2. Both U251TMZ1 and U251TMZ2 cells but not T98GTMZ cells had increased total and phosphorylated p53 levels. T98GTMZ cells but not U251TMZ1 or U251TMZ2 cells expressed MGMT. In addition, no MGMT expression in U251, U251TMZ1 or U251TMZ2 cells was detected by qRT-PCR (Additional file 9: Figure S1b). No PARP expression changes or cleavage was observed. If we extrapolate this low-scale Western blot analysis data on the whole (phospho)proteome, a striking difference and individuality of each TMZ-treated cell line in comparison to control cells would be revealed as it was demonstrated previously [13‐15].

Finally, we analyzed whether the TMZ-treated cells changed sensitivity to TMZ re-challenge. U251TMZ1 and U251TMZ2 cells were less responsive to 20 µM TMZ. T98GTMZ but not T98G cells grew slightly faster in the presence of 20 µM TMZ, whereas their growth was comparably inhibited by 100 µM TMZ. Proliferation of C6 cells was significantly inhibited by 20 or 100 µM TMZ, whereas the relative ratios of growth inhibition after TMZ re-challenge of C6 derivatives were C6 > C6R1 > C6TMZ ≈ C6R2TMZ (Fig. 7a). All cell lines were highly sensitive to 2 µM temsirolimus (TEM, mTOR kinase inhibitor) with no changes in the sensitivity after long-term TMZ treatment (Fig. 7b). 5 µM U0126 (an extensively studied experimental MEK1/2 inhibitor [45]) inhibited proliferation of U251TMZ2 but not U251 or U251TMZ1 cells. Proliferation of both T98G and T98GTMZ cells was insensitive to U0126. In contrast, C6 derivatives were highly sensitive to U0126 with no change in response after TMZ treatment (Fig. 7c).

Human U251 (Bank of Cell Lines from Human and Animal Tissues, R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, Kyiv, Ukraine), T98G (ATCC) and rat C6 (Pirogov Russian State Medical University, Moscow, Russia) glioma cell lines were grown in DMEM (HyClone, Thermo Scientific, UK) supplemented with 10 % fetal bovine serum (FBS, HyClone) and 100 µg/ml penicillin/100 u/ml streptomycin (Sigma, USA) in an environment of 95 % air/5 % CO2. U251, T98G, and C6 cell lines are isocitrate dehydrogenase 1 (IDH1)-wild-type. U251 is MGMT-negative; T98G is MGMT-positive.

Temozolomide (TMZ, Sigma), Temsirolimus (TEM, Abcam Biochemicals, USA) and U0126 (Abcam Biochemicals) were dissolved in DMSO to a concentration of 100 mM. The final DMSO concentration in the culture medium did not exceed 0.4 %. Stock solutions of all drugs were stored at −20 °C.

U251, T98G, and C6 glioblastoma cell lines were treated with DMSO or TMZ (Sigma) twice with 25 μM, twice with 50 μM and then with 100 μM TMZ twice per week during 5 weeks (U251TMZ2, T98GTMZ and C6TMZ) or 10 weeks (U251TMZ1), followed by several weeks of washout (in the TMZ-free medium) before in vitro tests. DMSO did not exceed 0.1 % of the culture medium.

The animals were kept in accordance with the Guidelines on Laboratory Practices adopted by the Ministry of Health of the Russian Federation (Order 267, 19 June 2003). The protocol stipulating animal treatment was approved by the Ethics Committee of N. I. Pirogov Russian State Medical University, and all rules and regulations were followed during experimentation on animals. Glioma modeling was performed by the intracerebral stereotactic implantation (Leica stereotactic device, USA) of C6 cells (5 × 10⁵) into the striatum region of ketamine-anesthetized adult female Wistar rats as described previously [59]. Rats with C6 glioma received 20 % DMSO (n = 1, C6R1) or TMZ (n = 1, C6R2TMZ) injected intraperitoneally (i.p.) three times per week at a dose of 50 mg/kg. Rats were sacrificed after 10 injections. Gliomas were aseptically harvested, mechanically disaggregated, and a cell suspension was seeded into adherent dishes. Cells were used at the passages 3–10 for analysis.

Chromosome samples were prepared as described previously [23]. 200 metaphase plates were calculated for distribution of chromosome across cells. 20 metaphases (U251 and T98G derivatives) or 10 metaphases (C6 derivatives) were described for chromosome abnormalities, according to the International System for Human Cytogenetic Nomenclature (ISCN 2013). Clonal chromosome aberrations (CCAs) were defined as aberrations found at least in two cells among examined metaphases, whereas non-CCAs (NCCAs) as aberrations detected in only one cell. The frequency of NCCAs in a cell line was calculated by dividing the number of metaphases displaying NCCAs to the total number of examined metaphases (×100 %). Only structural NCCAs were considered.

A total DNA was isolated using NucleoSpin Blood DNA extraction kit (Macherey–Nagel, Germany) according to the manufacturer’s instructions. To analyze copy number alterations (CNAs), aCGH was performed as detailed previously [23]. Human and rat cell lines were analyzed on the CytoSure Aneuploidy Array 15 k (Oxford Gene Technologies, UK) and 180 K microarrays (Agilent Technologies, USA), respectively. Image analysis of human and rat samples was carried out with CytoSure Analysis Software (Oxford Gene Technologies) and Agilent CytoGenomics Edition 2.9.2.4, respectively.

Cells were seeded onto 6 cm dishes at a density of 5 × 10⁴ (U251 and T98G derivatives) or 1 × 10⁴ (C6 derivatives) and grown in high-glucose (4.5 g/L) or low-glucose (1 g/L) DMEM with 10 % FBS. On the 7th day of seeding, cells were harvested, incubated with trypan blue, and calculated using hemocytometer. Experiments were repeated at least three times.

U251, T98G (5 × 10⁴ cells) and C6 (1 × 10⁴ cells) derivatives were seeded onto 6 cm dishes and incubated overnight. The cells were treated for 7 days with a single dose of TMZ (20 and 100 µM), TEM (2 µM), U0126 (5 µM) or DMSO. Experiments were repeated at least three times. Cell viability was evaluated by trypan blue exclusion assay instead of metabolically-based MTT or ATP assays, which are prone to over/underestimate cell viability under cytotoxic stress [45].

5 × 10³ cells were placed in 1.5 ml of 0.35 % low gelling temperature agarose (Gibco, Life Technologies, USA) with DMEM supplemented with 10 % FBS. 0.35 % top agarose was poured on 1.5 ml of solidified 0.5 % base agarose/10 % FBS/DMEM. Cells were seeded in triplicates in a 35-mm dish and grown at 37 °C for 21 days to allow colony formation. Colonies were visualized by staining with 0.005 % crystal violet, photographed, counted using OpenCFU software [60], and expressed as the means of triplicates of four independent experiments.

Using a P200 pipette tip, the scratches were made by scraping across the confluent cell monolayer. Pictures were taken at 0 and 16 h (C6 derivatives) or 24 h (U251 and T98G derivatives) and automated image analysis was carried out using TScratch software [61] to avoid any potential bias in quantifying an extent of migration. At least twelve wound healing areas for each cell line were photographed and analyzed to take into account the differences in cell density and widths of scratches. The per cent of wound area closure was calculated taking open wound area at 0 h for 100 %.

A 24-well tissue culture plate-based Chemicon cell invasion assay (QCM ECMatrix 550, Millipore, USA) was performed according to the manufacturer’s protocol. 2 × 10⁵ cells were seeded to the inserts. After 24 h, five fields of invaded cells in each well were randomly photographed and counted manually. Test was performed two times.

Total RNA was extracted from cell lines using TRI Reagent (Sigma, #T9424) according to the manufacturer’s recommendations. Equal amounts of total RNA (5 μg for 20 μl reaction mixture) were transcribed into cDNA with random hexamer primers and RevertAid Reverse Transcriptase (Thermo Scientific, #EP0441). Twofold diluted cDNA and gene specific primers were mixed with Maxima SYBR Green qPCR Master Mix (2X) (Fermentas, #K0251) according to the manufacturer’s recommendations. qRT-PCR was run in triplicates on CFX96 RT-PCR Detection System (Bio-Rad). The amplification procedure of target genes was as follows: initial denaturing step at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 59 °C for 30 s and extension at 72 °C for 30 s. Melting curve analysis was performed to confirm amplification specificity. To calculate the relative gene expression ratios (fold-change), C_T method (also known as the 2^−ΔΔCT method, expressed as ratios relative to control values after normalization to the internal control TBP—TATA-binding protein) was applied. C_T values were derived using Bio-Rad CFX Manager 3.1.

TBP Forward: TGCACAGGAGCCAAGAGTGAA; Reverse: CACATCACAGCTCCCCACCA; CD133 Forward: CGTGGATGCAGAACTTGACAACGT; Reverse: ATACCTGCTACGACAGTCGTGGT; SOX2 Forward: GCCGAGTGGAAACTTTTGTCGGA; Reverse: CGTGTACTTATCCTTCTTCATGAGCGTC; OCT4 Forward: GGAGAAGGAGAAGCTGGAGCA; Reverse: GGCAGATGGTCGTTTGGCTGAATA; NANOG Forward: GTCTGGACACTGGCTGAATCCT; Reverse: CTCGCTGATTAGGCTCCAACCAT; MGMT Forward: CCTGGCTGAATGCCTATTTCCACCA; Reverse: GGATGAGGATGGGGACAGGATTGC.

Total cell lysates were analyzed as described earlier [23]. The following antibodies were used: mouse anti-MGMT (Novus Biologicals; #NB100-168), rabbit anti-PTCH2 (Cell Signaling; #2464), rabbit anti-ASK1 (Cell Signaling; #8662), rabbit anti-MDM2 (Thermo Fisher Scientific Pierce; #PA5-11353), rabbit anti-p53 (Millipore; #04-1083), rabbit anti-phospho-p53 (Ser6) (Millipore; #04-540), rabbit anti-PARP (Cell Signaling; #9542), rabbit anti-ERK1/2 (Millipore; #06-182), rabbit anti-phospho-ERK1/2 (Thermo Scientific Pierce; #MA5-1574), rabbit anti-AKT1 (Millipore; #07-416), mouse anti-phospho-AKT1 (Santa Cruz; sc-52940), mouse anti-β-actin (Sigma-Aldrich; A1978), the Epithelial-Mesenchymal Transition antibody sampler kit (Cell Signaling; #9782), anti- rabbit (Cell Signaling, #7074) and anti-mouse (Cell Signaling, #44209).

A two-sided t test was used to calculate the significance values (Statistica 10 Software, USA). Data showing p values of *P < 0.05, **P < 0.01, and ***P < 0.001 were considered significant. All experimental data are reported as mean and the error bars represent the experimental standard error (±standard deviation, SD).