Background
Methods
Study sites and Plasmodium falciparum field isolates
PfRh2b genotyping
Statistical analysis
Results
Evolution of the prevalence of PfRh2b deletion in fields isolates from Thiès and Western Gambia
Prevalence of PfRh2b deletion according to age in Thiès and western Gambia
Temporal differentiation of PfRh2b polymorphisms in Senegal and Gambia populations
Years | THIES | WESTERN GAMBIA | ||||
---|---|---|---|---|---|---|
PfRh2bdel
|
PfRh2bfull
| Gene diversity (h) |
PfRh2bdel
|
PfRh2bfull
| Gene diversity (h) | |
1984 | – | – | 0.58 | 0.42 | 0.487 | |
2005 | – | – | 0.69 | 0.31 | 0.428 | |
2007 | 0.67 | 0.33 | 0.442 | 0.47 | 0.53 | 0.498 |
2008 | 0.65 | 0.35 | 0.455 | 0.66 | 0.34 | 0.449 |
2009 | 0.58 | 0.42 | 0.487 | – | – | – |
2010 | 0.39 | 0.61 | 0.372 | 0.73 | 0.27 | 0.394 |
2011 | 0.37 | 0.63 | 0.466 | – | – | – |
2012 | 0.44 | 0.56 | 0.493 | 0.83 | 0.17 | 0.282 |
2013 | 0.38 | 0.62 | 0.471 | 0.58 | 0.42 | 0.487 |
Average | 0.497 | 0.503 | 0.455 | 0.648 | 0.351 | 0.432 |
Fst = 0.09 | Fst = 0.057 |
Prevalence of PfRh2b in isolates grouped by molecular barcode
Haplotype cluster | Molecular barcodes | N (%) | N (isolats) | PfRh2bdel (%) | PfRh2bfull (%) |
---|---|---|---|---|---|
Haplotype cluster 36 | CACTGCAGACCGCACCCAAGCCTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 38 | CACTCGAGATCGTCACCACGCTTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 45 | TATTCCGGTCCGTCCCCTCGCTTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 51 | TACTCCGGTTCGCACACACGACTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 49 | TATTCGAAATCGCACCCTAGATTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 48 | TACTCCAGTCCATACACACGATTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 46 | TACTGCAGATTGTACCCAAAACTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 57 | CACTGCGGATTGTACCTAAGACTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 54 | CGCTCCAGACTACACCCTAAACTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 53 | TACTCCGGATTGTCACCAAGACTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 59 | TACTCCGGTTTATACCTTAGACTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 61 | TACCGGAGTCCGTACCTAAGCCTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 15 | TACTCCGGTTCGTAAACTCGCCTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 63 | TACTCCAGACCGCCCCTAAAATTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 9 | TATTCCAGATXGCAACTTCGACTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 62 | TACTCGAGACTGCNCATACACTTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 13 | TACTCGAAACTXCCCATAAGCTTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 68 | TACCCCGGACCACCAATAAGACTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 69 | TACTGGGATCCGCACCTAAGACTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 67 | CACTCCGGATTGCCACTTAGATTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 70 | TATTCCGGACXACACACTAGCTTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 22 | TACTCCGGATCGCACCCTAGATTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 74 | TACTCCAGACTATCCATTCGATTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 71 | CACTCGGGATTXCCACTAAGCTTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 80 | CATTCCAGTCCXCCAATAAGATTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 72 | TATTGGGGATCGCAACCAAGATTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 77 | TACTGGAGTCCGTACCTTAGCTTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 97 | CACTCGAAATXATACCTTAGCTTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 87 | TACTCGGGTCTATAAATAAGACTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 89 | TACTCGAGTTTATACCTTAGACTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 92 | TATTGCAGTCCXCAAATAAGCTTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 84 | CACTCCAGTCCACCACNTAGATTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 96 | TATTCCAGACCGCACATTAGCCTG | 0.345 | 2 | 50 | 50 |
Haplotype cluster 93 | TACTCCAGTCCGTCACTTAGACTG | 0.345 | 2 | 100 | 0 |
Haplotype cluster 44 | TACTCCAGACTACAACTACGCCTG | 0.345 | 2 | 0 | 100 |
Haplotype cluster 43 | TATTCCAGATTGCAACTTCGCCTG | 0.517 | 3 | 100 | 0 |
Haplotype cluster 58 | CACTCGAGTTXACAACCTAGCCTG | 0.517 | 3 | 33 | 67 |
Haplotype cluster 7 | CACTCCGGATTGCCACTAAGATTG | 0.517 | 3 | 33 | 67 |
Haplotype cluster 19 | TATTCGAGTCTACACCTTCACTTG | 0.517 | 3 | 100 | 0 |
Haplotype cluster 21 | TACCCCGGTCCACCACTAAAATTG | 0.517 | 3 | 0 | 100 |
Haplotype cluster 23 | CACCCGAGTCCACCAACAAGACTG | 0.517 | 3 | 0 | 100 |
Haplotype cluster 95 | CACCCCGAATCXCACCTAAGACTG | 0.517 | 3 | 0 | 100 |
Haplotype cluster 99 | TACTCCGAACTGCACATTAGATTG | 0.517 | 3 | 100 | 0 |
Haplotype cluster 55 | TACTCCGGTTTGCACACACGACTG | 0.69 | 4 | 100 | 0 |
Haplotype cluster 64 | TACTCGAGATXATACATACACTTG | 0.69 | 4 | 0 | 100 |
Haplotype cluster 10 | CATTGCGATCTGCAACCTAAACTG | 0.69 | 4 | 100 | 0 |
Haplotype cluster 24 | CATTCCAGTCCXCCCATTAGATTG | 0.69 | 4 | 25 | 75 |
Haplotype cluster 81 | TACTCCAGATCGCACCCAAGCCTG | 0.69 | 4 | 75 | 25 |
Haplotype cluster 98 | CACTCGAGTTTACAACTAAGATTG | 0.69 | 4 | 25 | 75 |
Haplotype cluster 5 | TACTCGAAACTGCCCATAAGCTTG | 0.69 | 4 | 0 | 100 |
Haplotype cluster 65 | CACTCCAAATCGTACCTTAGATTG | 0.862 | 5 | 100 | 0 |
Haplotype cluster 8 | TACCCCGGTCCACACCTTAACTTG | 0.862 | 5 | 100 | 0 |
Haplotype cluster 11 | TACTCGAGATCATACATACACTTG | 0.862 | 5 | 0 | 100 |
Haplotype cluster 12 | CACTGCGATCTGCAACCTAAACTG | 0.862 | 5 | 100 | 0 |
Haplotype cluster 6 | CATTCCAGTCCGCCAATAAGATTG | 1.034 | 6 | 0 | 100 |
Haplotype cluster 26 | CACTCCAGTCCGTCACCAAGATTG | 1.034 | 6 | 17 | 83 |
Haplotype cluster 17 | TACCCCGGTCCACCAATAAGATTG | 1.207 | 7 | 0 | 100 |
Haplotype cluster 16 | TACTCCAGATTACAACCTAGCCTG | 1.207 | 7 | 100 | 0 |
Haplotype cluster 66 | TGTTCCAGTTTATCACCACGCCTG | 1.379 | 8 | 12.50 | 87.50 |
Haplotype cluster 18 | TATTCCAGTCCACCCATAAGACTG | 1.552 | 9 | 89 | 11 |
Haplotype cluster 4 | TACTCCGGTTXGCACACACGACTG | 2.586 | 15 | 100 | 0 |
Haplotype cluster 29 | TACCCCGGTCCACCAATAAGACTG | 7.241 | 42 | 9.50 | 90.50 |
UNIQUES | 58.27 | 338 | 49.11 | 50.89 |