The doses of plasmid backbone plays a major role in determining the HBV clearance in hydrodynamic injection mouse model

Male C57BL/6 mice (5–6 weeks old) were purchased from the Shanghai Experimental Animal Center (Shanghai, China). The mice were maintained under specific pathogen-free conditions and used according to the guidelines outlined in the Guide for the Care and Use of Laboratory Animals.

WT pAAV/HBV1.2 and e/core-null pAAV/HBV1.2 plasmid were kindly provided by Dr. Peijer Chen (National Taiwan University). All the plasmids were isolated by using an endotoxin-free midi kit (Qiagen, Inc., Valencia, CA, USA). Hydrodynamic injection of the different plasmids into mice was performed as described [7]. Serum HBsAg, anti-HBs, and anti-HBc antibody levels were determined using commercially available immunoradiometric assay (IRMA) kits (Beijing North Institute of Biological Technology, Beijing, China).

Liver samples were fixed in 10% neutral buffered formalin and embedded in paraffin. Liver sections were stained for HBcAg using rabbit antibodies against HBcAg (Dako, Carpinteria, CA) followed by biotinylated anti-rabbit IgG and streptavidin-HRP conjugates (Zhongshan Goldenbridge, Beijing, China). The stains were developed with a DAB kit (Vector Laboratories).

Total RNA was isolated from the liver tissues or liver mononuclear cells (MNCs) at day 3 AHI by TRizol reagent (Invitrogen). Reverse transcription was performed by M-MLV (Invitrogen). Realtime fluorescence quantitative PCR was based on SYBR Premix Ex Tap (TaKaRA), and the reactions were performed with a denaturation step at 94 °C for 20s, annealing at 60 °C for 30s, and extension at 72 °C for 30s for 40 cycles. Results were normalized to GAPDH mRNA expression. PCR primers are as followed:

tlr3, TTGTCTTCTGCACGAACCTG (f) and CGCAACGCAAGGATTTTATT (r);

tlr4, ACCTGGCTGGTTACACGTC (f) and CTGCCAGAGACATTGCAGAA(r);

tlr7, GGAAATTGCCCTCGATGTTA (f) and CAAAAATTTGGCCTCCTCAA (r);

tlr8, GAAGCATTTCGAGCATCTCC (f) and GAAGACGATTTCGCCAAGAG (r);

tlr9, ACTGAGCACCCCTGCTTCTA (f) and AGATTAGTCAGCGGCAGGAA (r);

ifn-α, AGGACAGGAAGGATTTTGG (f) and GCTGCTGATGGAGGTCAT (r);

ifn-β, CACAGCCCTCTCCATCAAC (f) and GCATCTTCTCCGTCATCTCC (r);

ifn-γ, TGCATCTTGGCTTTGCAGCTCT (f) and TGGACCTGTGGGTTGTTGACCT (r);

il-6, ACAACCACGGCCTTCCCTAC (f) and ACAATCAGAATTGCCATTGCAC (r);

il-12, GTGAACCTCACCTGTGACACGC (f) and AATACTTCTCATAGTCCCTTTGG (r);

il-15, CCAACTGGATAGATGTAAGATA (f) and GTCAGGACGTGTTGATGAACAT (r);

tgf-β, GTACAGCAAGGTCCTTGCCCT (f) and TAGTAGACGATGGGCAGTGGC (r);

t-bet, GCCAGGGAACCGCTTATATGTC (f) and CTGTGAGATCATATCCTTGGGCTG (r);

cxcr3, TGTAGCCCTCACCTGCATAGTTGT (f) and GTTGTACTGGCAATGGGTGGCATT (r); gapdh, ACCACAGTCCATGCCATCAC (f) and TCCACCACCCTGTTGCTGTA (r).

f and r mean forward and reverse pimers.

Unpaired two-tailed Student’s t-test was used for statistical analyses. Data was expressed as means ± SEM, and data were considered statistically significant when P values were < 0.05. Significance was denoted as *P < 0.05, **P < 0.01, and ***P < 0.001.

Our previous studies have revealed that hydrodynamic injection of 6 μg pAAV/HBV1.2 could establish long-term HBsAg-persistent mice and maintain the tolerant state via induction of HBV specific Tr1 like cells [13, 17]. In this study, C57BL/6 mice were injected with 6 μg or 20 μg pAAV/HBV1.2 plasmids. In the 20 μg group, the serum levels of HBsAg and HBeAg dropped quickly and all the mice were HBsAg negative at 5 weeks post injection (wpi) (Fig. 1a-c), indicating the induction of anti-HBV immunity in theses mice. However, in the 6 μg group, the HBsAg and HBeAg level declined much more slowly (Fig. 1a, b), and all mice were still HBsAg positive at 6 wpi (Fig. 1c). Also, 80% of the mice injected with 20 μg pAAV/HBV1.2 plasmids produced anti-HBs antibody in the serum, while only 25% of those receiving 6 μg pAAV/HBV1.2 plasmid were anti-HBs positive at week 11 AHI (Table 1). In addition, cytoplasmic and nucleic HBcAg was observed in the liver of 6 μg group, but not in that of the 20 μg group, at 6 wpi (Fig. 1d). Overall, hydrodynamic injection of 6 μg pAAV/HBV1.2 induced immune tolerance to keep HBV persistence, while injection of 20 μg pAAV/HBV1.2 triggerd anti-HBV immune responses leading to HBV clearance.

To test whether anti-HBV activity triggered by 20 μg pAAV/HBV1.2 plasmids, as well as IL-12-based vaccination, could reverse 6 μg pAAV/HBV1.2 plasmid -induced HBV persistence [18], HBV-persistent mice established by prior injection with 6 μg pAAV/HBV1.2plasmid were received second hydrodynamic injection with 20 μg pAAV/HBV1.2plasmid (Fig. 2a). After the second injection, serum levels of HBsAg decreased significantly in normal saline (NS)-pretreated mice and became negative at 5 wpi, while 100% of HBV-persistent mice still kept HBsAg positive in serum, as well as HBcAg in liver section, at 5 wpi (Fig. 2b-c).

It was reported that HBcAg played an important role in inducing anti-HBV immunity [19]. Next we tested whether the anti-HBV activity triggered by 20 μg pAAV/HBV1.2 plasmid was dependent on elevated HBcAg expression, which might be due to the higher concentration of injected plasmids. We indeed found that the percentage of HBcAg positive hepatocytes was much higher in the 20 μg group than those in the 6 μg group (Fig. 3a). Consistently, serum level of anti-HBc antibody was increased significantly in the 20 μg group (Fig. 3b). To further address this point, e/core-null pAAV/HBV1.2 plasmids that was lack of e/core gene was tested. Surprisingly, the serum levels and the persistence rates of HBsAg in mice receiving 20 μg e/core-null mutant plasmids were entirely similar to those of the mice receiving 20 μg WT pAAV/HBV1.2 plasmids (Fig. 3c, d). In addition, the serum levels of anti-HBs displayed the similar kinetics at different time points between these two groups (Table 1). These data indicated that HBV clearance caused by injection of 20 μg pAAV/HBV1.2 plasmids was not associated with HBcAg.

Another possibility counting for HBV clearance or persistence is the dose of the injected plasmid DNA, which was reported to be recognized by various pattern recognition receptors (PRRs) and eventually trigger innate immune responses [20]. To test this possibility, pAAV/HBV1.2 plasmids and the control plasmids lacking the HBV genome were injected into C57BL/6 mice. 6 μg pAAV/HBV1.2 plasmids were applied in group A; 6 μg pAAV/HBV1.2 plus14μg the control plasmids in group B; and 20μg pAAV/HBV1.2 plasmids in group C, respectively. The serum HBsAg levels of the group B dropped as quickly as the group C, and revealed similar kinetics of serum HBsAg and anti-HBs at different time points. However, these parameters in the group A were totally different from those in the group B, although the groupA and B received the same doses of 6 μg HBV genome DNA (Fig. 4a, b; Table 1). These data indicated that anti-HBV activity was determined by the dose of plasmid backbone, but not HBV-related proteins in our mouse model.

To test whether 20 μg pAAV/HBV1.2 plasmids-caused HBV clearance was mediated by immune response toward the plasmid backbone or toward HBV-related antigens, we injected 20 μg the control or 20 μg pAAV/HBV1.2 plasmids into mice 1 week prior to injection of 6 μg pAAV/HBV1.2 (Fig. 5a). Three weeks later, the mice pre-treated with 20 μg of the control plasmids still kept HBV persistence, similar to those pre-treated with NS. However, 80% of mice pre-treated with 20 μg pAAV/HBV1.2 developed anti-HBV activity and eliminated the serum HBsAg (Fig. 5b). These data suggested that the plasmid backbone, which must been injected together with 6 μg pAAV/HBV1.2, had an adjuvant effect to induce the immune activity toward HBsAg in a nonspecific manner. To further address this, we found co-injection of 6 μg pAAV/HBV1.2 and 14 μg HBV-irrelevant pRNT-H1.1 plasmid could also lead to the significant decrease of HBsAg levels at week 4 AHI (Fig. 5c).

To explore a possible link between 20 μg plasmid DNA caused HBV clearance and TLRs signaling pathways [21, 22], serum levels of HBsAg were monitored from mice receiving 6 μg pAAV/HBV1.2 mixed with agonists of TLR3, TLR4, TLR7/8, and TLR9 respectively. All these mice have shown the decreased levels of HBsAg at week 1 or week 4, but none of mice were HBsAg negative at week 4 AHI (Fig. 6a-b). Also, the relative mRNA levels of TLR3, TLR4, TLR7, TLR8, or TLR9 kept unaltered in liver tissue of mice receiving NS or 20 μg of the control plasmid (Fig. 6c), suggesting the TLRs signaling pathway did not account for HBV elimination in this model.

We further detected the mRNA levels of cytokines and Th1-related immune factors in the liver MNCs 3 days AHI. No obvious difference in the mRNA levels of ifn-α, ifn-β, tgf-β, il-6, il-12 and il-15 was found between mice receiving NS or 20 μg of the control plasmids. However, the mRNA levels of Th1-related immune factors, including cxcr3 and t-bet, had a dramatic increase in 20μgof the control plasmid group. Also, interferon (IFN)-γ and IL-12 were slightly up-regulated (Fig. 7 and data not shown). These data suggested Th1 cells might play a critical role in HBV clearance caused by high doses of HBV plasmids in the TLRs independent manner.