Background
Hormonal induction of the estrus is commonly used in commercial swine breeding to improve production efficiency and facilitate animal management. It also serves as a fundamental technique in the preparation of recipients and donors for embryo transfer procedures, as well as in the recovery of a large number of embryos used later for both biotechnological purposes and in basic studies. However, the administration of gonadotropins may be to some extent detrimental to the reproductive performance of the treated animals. Estrus induction in gilts has an impact on follicular development, as reflected by the changes in follicle diameter and follicular fluid volume compared to naturally cyclic pigs [
1]. In our earlier studies, a higher number of degenerated porcine embryos and a lower number of blastocysts hatched
in vitro were found after hormonal induction of the estrus [
2]. Moreover, studies have shown that hormonal treatment affects the expression of genes crucial for pre-implantation events in the uterus and conceptus during early pregnancy [
3] and increases embryonic losses in pigs [
4].
One of the predominant factors affecting proper embryo development and successful pregnancy is oocyte quality. During cytoplasmic maturation, the oocyte increases its size and volume, and a large number of mRNAs and proteins are accumulated at that time. These molecules, identified as maternal effect genes products, regulate events crucial for oocyte meiosis completion (nuclear maturation), organization of two pronuclei, and first embryo cleavages [
5,
6]. An expression of
ZAR-1 (zygote arrest 1), one of the maternal effect genes, was found in porcine oocytes and early embryos recovered
in vivo; but it decreased significantly at the morula and blastocyst stages [
7]. These indicate that
ZAR-1 has a significant function in oocyte development and during the first embryonic cleavages.
MATER (maternal antigen that an embryo requires or
NALP5), which also belongs to the maternal effect genes, was found to play a role in activating embryonic genome and maintaining chromosome stability and euploidy in mice [
8,
9]. Interestingly, recent data show that, during folliculogenesis,
MATER is expressed and exerts its biological role also in the surrounding cumulus cells [
10], which confirms the importance of the intimate relationship between oocyte and cumulus cells for the production of a fully competent gamete.
An example of another kind of maternal effect gene is bone morphogenetic protein 15 (
BMP15).
BMP15 belongs to the TGF-β superfamily and is known as a granulosa cell mitosis and proliferation inducer [
11,
12]. The production of adequate amounts of BMP15 protein by the oocyte is necessary to promote cumulus cells expansion [
13]. The expression of
BMP15 mRNA was also found in cumulus cells and it decreased along with the oocyte maturation and cumulus expansion
in vitro[
14]. Knockout of
BMP15 in female mice decreased fertility and diminished embryonic development [
15]. There are studies demonstrating that the BMP15 level in follicular fluid (FF) appears to be a potential marker in predicting oocyte quality and subsequent embryo development [
15,
16].
Although there are some reports on maternal effect genes expression and their cellular localization during porcine oocyte maturation and embryo development
in vitro[
5,
7,
17‐
19], there is no evidence showing the effect of hormonal treatment on their expression in this species. The most commonly applied protocols of estrus induction include the use of a combination of PMSG to stimulate follicular development and hCG to induce ovulation. However, it was suggested by Sommer et al. [
20] that including PGF2α into the PMSG/hCG protocol was very effective for collecting pronuclear stage embryos. Taking the following into consideration: (1) our previous results that estrus induction decreased embryo quality in pigs, (2) the information that genetic material within the oocyte plays an important role in directing the numerous events required for successful folliculogenesis and early embryo development, and (3) the fact that an luteinizing hormone (LH) surge causes the change from estradiol (E
2) to domination of progesterone (P
4), we investigated the effect of the two mentioned regimens of exogenous gonadotropins treatment on selected maternal effect gene expression (
MATER, ZAR-1 and
BMP15) in COCs, steroid hormones concentration in FF, and P
4 synthesis pathway gene expression (
P450scc and
3βHSD) in granulosa cells. Additionally, we examined apoptosis-related gene expression (antiapoptotic
BCL-2 and proapoptotic
BAX) and
BCL-2/BAX mRNA ratios in COCs in response to hormonal induction of the estrus.
Methods
Animals
The experiment was performed on gilts from one commercial herd, each 6.5 months old and on average weighing 115 kg. Gilts were divided into three groups (five to eight animals per group). Briefly, from the group of animals, the gilts entering into their natural estrus cycle were assigned to the natural cyclic group (group I), and the remaining gilts were assigned to groups II and III and treated hormonally to induce first and second estrus. Animals from group I (n = 8), exhibiting first and second estrus naturally, were not hormonally stimulated. Gilts were considered to be in estrus when they responded to boar exposure. The animals assigned to groups II and III were treated with PMSG [Folligon®; Intervet, Netherlands; 750 IU im], followed by hCG [Chorulon®; Intervet, Netherlands; 500 IU im] 72 h later. After seventeen days, the second estrus in animals from group II (n = 5) was induced by an identical treatment of PMSG and hCG. Animals from group III (n = 7), between days twelve and sixteen of the second estrus, were treated with PGF2α [Dinolitic®; Pfizer, Poland; 10 mg im], followed 24 h later with 10 mg of PGF2α simultaneously with 750 IU of PMSG, then followed 72 h later with 500 IU of hCG. This procedure was a modification of the method described previously by Sommer et al. [
20]. The gilts were slaughtered about 36 h after hCG administration. Blood samples were collected, incubated overnight at 4°C and then centrifuged 3000 X g for 20 min at 4°C. Serum was harvested and frozen at -20°C for P
4 and E
2 analysis.
All procedures were conducted in accordance with the national guidelines for agricultural animal care and were approved by the Local Animal Ethics Committee, University of Warmia and Mazury in Olsztyn, Poland.
Recovery of COCs and granulosa cells
The number of preovulatory follicles on each ovary was counted. Cumulus oocyte complexes (COCs) were recovered by cutting the follicles with a scalpel on a Petri dish. They were washed twice in Medium 199 (Sigma, St. Louis, MO, USA) supplemented with 0.68 mM L-glutamine (Sigma), 20 mM Hepes (Sigma), 100 U/ml penicillin (Sigma), 0.1 mg/ml streptomycin (Sigma) and 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA). After washing twice in phosphate-buffered saline, the COCs from one animal were pooled in groups of ten to fifteen per tube, snap frozen in liquid nitrogen, and kept at -80°C until further RNA isolation. At the same time, FF was collected (per animal – FF from all preovulatory follicles from both ovaries was pooled), centrifuged to remove cell debris, and frozen at -20°C for P4 and E2 analysis. The granulosa cells were gently scraped from the inner follicle wall and transferred to a 1.5 ml microcentrifuge tube in phosphate-buffered saline and centrifuged at 90 X g for 10 min at room temperature. After centrifugation, the supernatant was removed and the cells were snap frozen in liquid nitrogen and stored at -80°C for further RNA isolation.
Evaluation of nuclear maturation
For evaluation of oocyte nuclear maturation, additional animals prepared as described previously were used [natural estrus (group I) n = 4; PMSG/hCG (group II) n = 3; PMSG/hCG + PGF2α (group III) n = 3]. After the recovery of COCs, cumulus cells were removed completely by vortexing in 0.1% (w/v) hyaluronidase (Sigma). Denuded oocytes were placed on a glass slide under a cover slip (supported with Vaseline corners) and fixed for up to 72 h in an acetic acid/ethanol fixative (1:3, v:v). Nuclear structures were then visualized by staining with aceto-orcein (1% orcein in 45% acetic acid). Oocytes were evaluated under a phase-contrast microscope for the stage of nuclear maturation. Based on the stage of nuclear maturation, oocytes were divided into two groups: immature oocytes (GV) and oocytes that resumed meiosis (prometaphase I – metaphase II).
P4 and E2measurement
Concentrations of P4 and E2 in FF and serum were determined using commercial ELISA kits (Enzo Life Sciences, New York, NY, USA) according to the supplier’s instructions. The standard curves for P4 and E2 ranged from 15.6 to 500 pg/ml and from 15.6 to 1000 pg/ml, respectively. The concentrations of P4 and E2 in FF and serum were measured in duplicates for each sample and the final concentration was expressed as an average. Assay sensitivity was 8.57 pg/ml for P4 and 14.00 pg/ml for E2. The intra-assay coefficients of variation were 5.9% for P4 and 4.9% for E2.
RNA isolation and qPCR
Total RNA from COCs and granulosa cells was isolated using Qiagen RNeasy® Plus Micro Kit (Qiagen, Valencia, CA, USA) and checked for quantity and quality with NanoDrop® (ND-1000; Thermo Scientific, Waltham, MA, USA). DNase treatment with gDNA eliminator columns (Qiagen) was included in the RNA isolation protocol. The RNA obtained was reversely transcribed with the use of a transcriptor high fidelity cDNA synthesis kit (Roche, Basel, Switzerland). For reverse transcription, 15 ng of total RNA from COCs and 1 μg of RNA from granulosa cells were used. The reaction was performed in a total volume of 20 μl, including RNA, water, 60 μM of random hexamer primers, reaction buffer, 5 mM DTT, 20 U Protector RNase inhibitor, 1 mM deoxynucleotide mix, and 10 U of reverse transcriptase. At first, the template-primer mixture was denatured by heating the tube for 10 min at 65°C in a thermo cycler (SensoQuest GmbH, Göttingen, Germany). Then, after adding the remaining components of the mixture, the following thermal profile of the reaction was applied: 30 min at 45°C followed by inactivation of reverse transcriptase at 85°C for 5 min, with subsequent cooling to 4°C. cDNA was kept at -20°C for further qPCR analysis.
Power SYBR Green PCR Master Mix (Life Technologies, Carlsbad, CA, USA) was used for qPCR analysis. The primers used for qPCR, products sizes, and GenBank accession numbers and/or references are included in Table
1. The qPCR mix consisted of 2 μl of RT product, 1 μl of forward and reverse primer (0.4 μM), 8.5 μl of nuclease-free water, and 12.5 μl of SYBR Green. The reaction was performed manually in duplicates for each sample, at a final volume of 25 μl in 96-well plates using ABI 7300 (Life Technologies). Each run included a non-template control (NTC). A standard curve was generated by amplifying serial dilutions of a known quantity of cDNA. The amplification efficiency for each gene was found to be between 90 and 100% for all the investigated genes. The thermal profile for amplification of the investigated genes was as follows: preincubation at 95°C for 15 min, followed by 45 cycles of denaturation at 95°C for 15 s, annealing at either 52°C (for glyceraldehyde-3-phosphate dehydrogenase;
GAPDH), 55°C (for
BMP15, MATER, ZAR-1), 57°C (for
BCL-2), or 60°C (for
BAX, P450scc, 3βHSD) for 30 s, and elongation at 72°C for 30 s. After the end of the last cycle, the melting curve was generated. Product purity was confirmed by electrophoresis and its specificity was confirmed by sequencing (Genomed, Warsaw, Poland). The obtained sequences were compared with the expected sequences of the investigated genes using BLAST (bl2seq). The final quantification was reported as a relative expression (average value from duplicates) after normalization to reference gene (
GAPDH) expression in the same samples.
GAPDH was selected as a good reference gene candidate for pig oocytes and embryos for the reasons suggested by Kuijk et al. [
21]. There was no statistically significant impact of the treatments on
GAPDH transcript level in our study, confirming its usefulness as a good endogenous control.
Table 1
Primers used for qPCR
MATER
| F: GATTAACGCCCAGCTCTTGT | 154 | AM748274.1 |
R: AGCTTCTGCAGAGTGCAGTG |
ZAR-1
| F: TGGTGTGTCCAGGGCACTAA | 213 | NM_001129956 |
R: GTCACAGGAGAGGCGTTTGC |
BMP15
| F: AGCTTCCACCAACTGGGTTGG | 285 | |
R: TCATCTGCATGTACAGGGCTG |
BAX
| F: AAGCGCATTGGAGATGAACT | 159 | |
R: AAAGTAGAAAAGCGCGACCA |
BCL-2
| F: GAAACCCCTAGTGCCATCAA | 196 | |
R: GGGACGTCAGGTCACTGAAT |
P450scc
| F: TTTACAGGGAGAAGCTCGGCAAC | 251 | |
R: TTACCTCCGTGTTCAGGACCAAC |
3βHSD
| F: GGGTTTCTGGGTCAGAGGATC | 236 | |
R: CGTTGACCACGTCGATGATAGAG |
GAPDH
| F: TCGGAGTGAACGGATTTG | 219 | |
| R: CCTGGAAGATGGTGATGG | | |
Western blot
A western blot of the BMP15 protein was carried out according to the method described previously by Wu et al. [
15] and Paradis et al. [
25]. Protein concentration in FF was determined according to the Bradford [
26]. Briefly, 0.75 μg of protein in an SDS-gel loading buffer (50 mM TRIS-HCl, 4% SDS, 20% glycerol, and 2% β-mercaptoethanol) was heated to 95°C for 4 min, electrophoretically separated on a 12% polyacrylamide-SDS gel for 1.5 h at a constant current (200 mA), and then transferred overnight onto a nitrocellulose membrane. After the transfer, the membranes were stained with Ponceau S for total protein loading. They were then blocked in a solution of 5% (w/v) non-fat dry milk for 1.5 h. The expression of BMP15 was determined with the use of a primary polyclonal rabbit anti-human BMP15 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), diluted 1:400 in blocking solution. The secondary antibody used was goat anti-rabbit IgG conjugated with alkaline phosphatase (Sigma), diluted 1:20,000 in blocking solution containing pig protein. The molecular weight of the bands was determined by reference to a standard molecular weight marker. Three immunoreactive bands were found, representing BMP15 promature protein (65 kDa), cleaved proregion (50 kDa), and mature protein (25 kDa). The intensity of the bands was quantified by measuring optical density using Kodak® ID image analysis software (Eastman Kodak, Rochester, NY, USA). A control sample (a mix of all samples analyzed) was loaded on each gel to correct for interblot variability [
15,
25]. Densitometric values for individual FF samples were normalized to a stable protein band quantified after Ponceau S staining. All samples were electrophoresed and analyzed in duplicate, and values were averaged before statistical analysis [
15,
25].
Statistical analysis
The statistical analysis was carried out with the use of GraphPad PRISM v. 5.0 software (GraphPad Software, Inc., San Diego, CA, USA). Normality (bell shaped distribution) and homoscedasticity (variances) of the data were tested before analysis. For the data fitting the assumptions of parametric tests, i.e., following normal distribution and having similar variances, a one-way ANOVA and Bonferroni post-test was applied. For data that did not meet the assumptions of parametric tests (not following normal distribution or having different variances), the non-parametric Kruskal-Wallis test and Dunn post-test were done.
With regard to the pigs’ reproductive parameters (such as the number of follicles, oocyte nuclear maturation, hormone concentration in FF and serum), the data did not show normal distribution and/or similar variances even after logarithmic or arcsine transformation (in case of the data concerning oocyte nuclear maturation); therefore we analyzed them with the non-parametric Kruskal-Wallis test and Dunn post-test. Because of different variances, the data of ZAR-1, BMP15, BAX, and BCL-2/BAX mRNA expression were logarithmically transformed and analysis was done on the transformed data. These data were analyzed with the use of a one-way ANOVA and Bonferroni post-test. MATER, BCL-2, P450scc, 3βHSD mRNA and BMP15 protein expression data, which did not show normal distribution, were analyzed with the use of the non-parametric Kruskal-Wallis test and Dunn post-test. P values less than 0.05 were considered significant. Results are presented as ls mean ± S.E.M.
Discussion
The paper presents the results on the effect of hormonal estrus induction on COCs quality and selected follicular parameters in the pig.
We found that hormonal stimulation of gilts with PMSG/hCG or PMSG/hCG + PGF2α did not affect the follicle number when compared with naturally cyclic animals. It had been previously reported that in pregnant females the number of corpora lutea and the fertilization rate were comparable between non-stimulated and PMSG/hCG-treated pigs [
3]. On the other hand, Kiewisz et al. [
27] showed that treatment with PMSG/hCG + PGF2α generated a higher number of corpora lutea and conceptuses when compared to animals attaining estrus naturally. This observation was not confirmed in the present study with regard to follicular growth; however, the discrepancy may result from differences in animal treatment. In the cited study of Kiewisz et al. [
27], gilts were assigned for hormonal stimulation in their third estrus, while in our study animals with two consecutively stimulated estruses were used.
In the present study, we observed a markedly higher expression of all the investigated maternal effect gene transcripts (
MATER, ZAR-1, BMP15) in COCs recovered from animals treated hormonally with PMSG/hCG or PMSG/hCG + PGF2α, when compared with those observed in naturally cyclic females. This high expression of maternal effect genes, particularly in COCs obtained from PMSG/hCG-stimulated pigs, seems to be associated with a higher number of immature oocytes that did not resume meiosis. It is well known that the intense synthesis of maternal transcripts precedes the onset of transcriptional silencing during the GV stage. The maternal transcripts undergo post-transcriptional regulation through shortening of the polyA tail, which enables their storage and protection from the translation machinery. After meiosis resumption, when the proteins are required, the transcripts are polyadenylated and used for translation, then rapidly degraded [
18,
28]. The high levels of the investigated maternal effect gene transcripts found in our study in COCs from hormonally treated animals, and the lower percentage of oocytes that resumed meiosis, may result from the fact that cellular mechanisms controlling transcription and/or translation in female gametes can be modified in these gilts in response to exogenous gonadotropins. Similarly, in studies on the development of porcine embryos, it was shown that disturbation in maternal mRNA degradation may be responsible for delayed cleavage of porcine embryos
in vitro[
29]. Together, these findings suggest that mechanisms of maternal transcript utilization are potential determinants of oocyte/embryo quality and developmental potential, and may be affected by factors such as hormonal stimulation and
in vitro culture conditions.
The BMP15 protein level in FF is considered as potential marker of oocyte quality. The main role played by BMP15 protein in preovulatory follicles is to stimulate cumulus cell expansion [
13,
14]. The present study has shown that hormonal treatment of gilts markedly increased
BMP15 transcript level in COCs but it did not affect BMP15 protein level in FF. Similar results were obtained by Paradis et al. [
25] who also did not find correlation between
BMP15 mRNA expression in oocytes and protein in FF during different phases of follicle development, suggesting that not necessarily protein by itself but rather its receptor can be influenced by gonadotropins in the pig.
In our experiment, the serum concentration of P
4 did not differ between the experimental groups but was higher in the FF of PMSG/hCG compared to PMSG/hCG + PGF2α-stimulated and non-stimulated females. Similarly, in the studies of Wiesak et al. [
1] the concentration of P
4 in FF, recovered from follicles of non-stimulated gilts, was lower than in follicles obtained from gonadotropin-treated (PMSG/hCG) gilts at all stages of follicle development. The high concentration of P
4 in FF obtained from PMSG/hCG-treated animals was associated with increased percentage of oocytes at the GV stage and increased levels of maternal effect gene transcripts in COCs. Shimada and Terada [
30] found that P
4 induces germinal vesicle breakdown (GVBD) in porcine oocytes, probably through the disruption of gap junction communication. Dynamic changes in the expression of P
4 receptor proteins, following
in vitro maturation in response to supplementation with LH, follicle-stimulating hormone (FSH), or P
4, also indicated the role of P
4 in bovine oocyte maturation [
31]. In the current
in vivo study, the increased concentration of P
4 in FF of PMSG/hCG-treated animals does not seem to support meiosis resumption in the oocytes. On the other hand, it was found that the addition of various concentrations of P
4 to the maturation medium had negative effects on the percentage of oocytes completing nuclear or cytoplasmic maturation in porcine [
32] and bovine oocytes [
33].
Our results also indicate that the inclusion of PGF2α into the synchronization protocol decreases the P
4 concentration in follicles to the levels observed in the follicles of naturally cyclic gilts. A similar effect was observed in
in vitro studies, where PGF2α exerted a concentration-dependent inhibitory influence on gonadotropin-stimulated P
4 production [
34]. It can be suggested that including PGF2α into an estrus stimulation protocol in the pig can be beneficial for obtaining more physiological concentration of P
4 in FF and enhancing the natural hormonal environment for oocyte development. Maintaining the appropriate P
4 concentration in FF is a possible explanation for the results of Sommer et al. [
20], in which inclusion of PGF2α into gonadotropin stimulation protocol was very effective for the collection of pronuclear stage embryos for biotechnological purposes.
From the present study it seems that hormonal stimulation of estrus increases mRNA expression of both investigated enzymes participating in P
4 synthesis (
P450scc and
3βHSD) in granulosa cells. While in the granulosa cells of PMSG/hCG-treated animals only
3βHSD expression was raised, adding PGF2α into the stimulation protocol enhanced the expression of both investigated steroidogenesis-related genes. Similarly to our findings, the studies of Blitek et al. [
35] found that induction of estrus with PMSG/hCG + PGF2α increased the expression of mRNA for steroidogenic pathway genes such as
StAR,
CYP11A, and
3βHSD in the corpus luteum on days 9 and 12 of pregnancy, compared to the animals attaining estrus naturally.
Interestingly, in our study the increase of 3βHSD mRNA expression was observed in granulosa cells after stimulation with both PMSG/hCG and PMSG/hCG + PGF2α; however, the increased P4 concentration was found only in animals treated with PMSG/hCG. It may be that the inclusion of PGF2α in the stimulation protocol increased P4 metabolism, while at the same time not affecting 3βHSD mRNA expression stimulated by gonadotropins. A slightly different situation was found in the case of P450scc mRNA, where we did not observe the effect of gonadotropins treatment on its expression; however, its enhanced expression is rather a result of the increased metabolism of P4 induced by PGF2α.
The intra-follicular concentration of E
2 is considered as a marker for preovulatory maturation, and it increases progressively along with follicle development. In our experiments, both naturally cyclic and hormonally stimulated gilts had a similar E
2 concentration in blood serum and FF. However, the results obtained by Wiesak et al. [
1] revealed lower levels of E
2 in the follicles of hormonally treated gilts compared to naturally cyclic animals. In the present study we did not find a relationship between E
2 concentration and the resumption of meiosis in oocytes. This observation is in agreement with the findings of
in vitro experiments [
36], where it was suggested that E
2 is not involved in nuclear maturation of pig oocytes but rather may promote changes in calcium activity during oocyte cytoplasmic maturation [
37].
It has been suggested that oocytes of inferior quality are predestined to undergo apoptosis. Changes in the balance between anti- and proapoptotic factors play an important role in the regulation of cellular apoptosis. Our observation that gonadotropins increased the
BCL-2/BAX transcript ratio in COCs is in agreement with the antiapoptotic effect on the whole follicles found by Chun et al. [
38]. Moreover, it was revealed that PMSG/hCG may suppress apoptotic machinery in rodent granulosa cells [
39,
40]. In our study, a high level of P
4 in FF was associated with an increased ratio of BCL-2/BAX mRNA in COCs of PMSG/hCG-stimulated animals. It is possible that this gonadotropin-induced antiapoptotic effect in COCs is mediated through a high P
4 content in the FF. In bovine granulosa cells, gonadotropin surges induced the expression of progesterone receptors, promoting their resistance to apoptosis [
41]. This relationship was also found in bovine cumulus cells, where treatment with P
4 for 24 h decreased caspase-3 activity and the ratio of
BAX/BCL2 transcripts, while an inhibition of P
4 synthesis enzymes increased caspase-3 activity and the apoptosis in these cells [
42]. On the other hand, the ability of oocytes to prevent apoptosis may rely on some maternal specific factors, like BMP15 [
43]. The role of BMP15 in apoptosis prevention might be suggested in our study, where high
BMP15 transcript levels were found in COCs recovered from hormonally treated animals.
Competing interests
The authors declare that they do not have competing interests.
Authors’ contributions
MB conceived of the study, participated in its design, coordination and helped to draft the manuscript. MW participated in coordination, collected the tissues and carried out mRNA isolation, qPCR and aceto-orcein staining. AK collected the tissues and carried out Western blot analysis. IB participated in preparation of the manuscript draft and qPCR analysis. BMJ carried out immunoassays. All authors read and approved the final manuscript.