Skip to main content
Erschienen in: BMC Gastroenterology 1/2014

Open Access 01.12.2014 | Research article

The EPIYA-ABCC motif pattern in CagA of Helicobacter pyloriis associated with peptic ulcer and gastric cancer in Mexican population

verfasst von: Fredy Omar Beltrán-Anaya, Tomás Manuel Poblete, Adolfo Román-Román, Salomón Reyes, José de Sampedro, Oscar Peralta-Zaragoza, Miguel Ángel Rodríguez, Oscar del Moral-Hernández, Berenice Illades-Aguiar, Gloria Fernández-Tilapa

Erschienen in: BMC Gastroenterology | Ausgabe 1/2014

Abstract

Background

Helicobacter pylori chronic infection is associated with chronic gastritis, peptic ulcer, and gastric cancer. Cytotoxin-associated gene A (cagA)-positive H. pylori strains increase the risk of gastric pathology. The carcinogenic potential of CagA is linked to its polymorphic EPIYA motif variants. The goals of this study were to investigate the frequency of cagA-positive Helicobacter pylori in Mexican patients with gastric pathologies and to assess the association of cagA EPIYA motif patterns with peptic ulcer and gastric cancer.

Methods

A total of 499 patients were studied; of these, 402 had chronic gastritis, 77 had peptic ulcer, and 20 had gastric cancer. H. pylori DNA, cagA, and the EPIYA motifs were detected in total DNA from gastric biopsies by PCR. The type and number of EPIYA segments were determined by the electrophoretic patterns. To confirm the PCR results, 20 amplicons of the cagA 3′ variable region were sequenced, and analyzed in silico, and the amino acid sequence was predicted with MEGA software, version 5. The odds ratio (OR) was calculated to determine the associations between the EPIYA motif type and gastric pathology and between the number of EPIYA-C segments and peptic ulcers and gastric cancer.

Results

H. pylori DNA was found in 287 (57.5%) of the 499 patients, and 214 (74%) of these patients were cagA-positive. The frequency of cagA-positive H. pylori was 74.6% (164/220) in chronic gastritis patients, 73.6% (39/53) in peptic ulcer patients, and 78.6% (11/14) in gastric cancer patients. The EPIYA-ABC pattern was more frequently observed in chronic gastritis patients (79.3%, 130/164), while the EPIYA-ABCC sequence was more frequently observed in peptic ulcer (64.1%, 25/39) and gastric cancer patients (54.5%, 6/11). However, the risks of peptic ulcer (OR = 7.0, 95% CI = 3.3–15.1; p < 0.001) and gastric cancer (OR = 5.9, 95% CI = 1.5–22.1) were significantly increased in individuals who harbored the EPIYA-ABCC cagA gene pattern.

Conclusions

cagA-positive H. pylori is highly prevalent in southern Mexico, and all CagA variants were of the western type. The cagA alleles that code for EPIYA-ABCC motif patterns are associated with peptic ulcers and gastric cancer.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12876-014-0223-9) contains supplementary material, which is available to authorized users.
Fredy Omar Beltrán-Anaya, Tomás Manuel Poblete and Gloria Fernández-Tilapa contributed equally to this work.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

GFT and ARR designed and coordinated the research. SR and JS conducted the endoscopic study and obtained patient biopsies. FOBA and TMP conducted the research. MAR and OMH conducted the sequencing reactions. OPZ conducted the bioinformatics analysis. FOBA, BIA, and GFT analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.

Background

Chronic Helicobacter pylori infection is etiologically related to chronic gastritis, gastric ulcers, and gastric cancer [1]-[4]. Cytotoxin-associated gene A (CagA)-producing strains seem to induce gastrointestinal disease more frequently than non-producing strains [5],[6]. While the presence of CagA does not explain the variability in the clinical results, this oncoprotein is associated with severe gastroduodenal pathology [7]-[15]. CagA-positive strains are known to induce more intense gastric mucosal inflammation compared to cagA-negative strains. This pro-inflammatory potential of cagA-positive H. pylori could explain its association with severe atrophic gastritis and gastric adenocarcinoma [16],[17]. The CagA oncoprotein is released within epithelial cells via a type IV secretion system [18],[19]. Upon translocation, CagA localizes to the internal surface of the plasma membrane, where it is phosphorylated on C-terminal variable region tyrosine residues by multiple host Src tyrosine kinase family member proteins [20]-[22]. The phosphorylation motifs are defined by the Glu-Pro-Ile-Tyr-Ala (EPIYA) sequence and are classified as EPIYA-A, B, C, or D according to the amino acids that flank these motifs. Western CagA strains have the A and B segments and 1 or more C segments. CagA strains from Eastern Asia have the A, B, and D segments. This explains the size variability of CagA proteins (range, 120–145 kDa) [3],[9],[23]. The main phosphorylation target in CagA is the tyrosine in the EPIYA-C and EPIYA-D motifs. The phosphorylation level is proportional to the number of EPIYA-C motifs, and thus, increased motif numbers increase the pro-inflammatory and carcinogenic potential of the protein. Phosphorylated CagA forms complexes with the SHP-2 phosphatase, resulting in abnormal signaling. This leads to subsequent cellular alterations that increase the risk of cells altered by pre-cancerous genetic changes [3],[23]-[28]. In epithelial cells, SHP-2 binds more tightly to EPIYA-D than to EPIYA-C. However, CagA proteins with EPIYA-ABCCC have the same carcinogenic potential as those with EPIYA-D [25]. Western CagA-producing H. pylori strains with EPIYA-C sequences are more virulent and carcinogenic than CagA-producing strains with EPIYA-A and B motifs [15],[29],[30].
The prevalence of cagA-positive H. pylori is 90–95% in Asian countries and 50–60% in western countries [3],[23]. CagA genotype distribution varies among regions and ethnic groups. For example, the Amerindian (AM) cagA allelic variants, which are found in the inhabitants of the Peruvian Shimaa village, encode CagA isoforms that contain altered or degenerate EPIYA-B motifs, specifically ESIYT in AM-I and GSIYD in AM-II. Additionally, the AM CagA contains attenuated conserved repeats that are responsible for phosphorylation-independent activity (CRPIA). The AM strains have attenuated proliferation and induce low-grade inflammation, resulting in low virulence and a decreased risk of severe pathology [26],[31].
CagA is one of the most studied genes worldwide. In Mexico, the seroprevalence of cagA-positive H. pylori varies between 40% and 90% in patients with gastric pathology from different zones throughout the country [8],[32]-[36]. In patients from Mexico City who presented gastroduodenal pathology, the EPIYA segments of cagA-positive strain were of the western type [37]. In another study conducted in children with abdominal pain and adults with duodenal ulcers, gastric ulcers, or non-ulcerous dyspepsia, the identified EPIYA patterns were ACC, ABC, ABCC, ABCCC, and ABABC [37]. The following sequences were identified in gastric cancer and chronic gastritis cases: ABC, ABCC, ABABC, AABCC, and ABCCC [38]. However, to date, no studies have been conducted to explore the association between the type and number of EPIYA segments and severe gastric pathologies in southern Mexico. The analysis of the association between the EPIYA-C motif number and peptic ulcers and gastric cancer, will help to clarify the relationship between CagA variants and gastric disease severity in H. pylori-infected Mexican patients. The goal of this study was to investigate the prevalence of cagA-positive H. pylori and the EPIYA motif types in the gastric mucosa of patients with chronic gastritis, peptic ulcers, and gastric cancer to determine whether the EPIYA-C motif number is associated with ulcers and gastric cancer.
In this study, we found a high prevalence of western-type cagA-positive H. pylori infection, with a predominant EPIYA-ABCC pattern in Mexican patients with peptic ulcers and gastric cancer. Interestingly, the presence of a CagA protein with 2 or more EPIYA-C motifs was associated with severe gastric pathology.

Methods

Patients

A total of 499 patients were studied. The study subjects were sequentially selected from patients who suffered from dyspepsia symptoms and had been subjected to upper gastrointestinal tract endoscopy at the Chilpancingo’s General Hospital “Dr. Raymundo Abarca Alarcón” or at the State Institute of Oncology in Acapulco, Guerrero, Mexico. The subjects were recruited between April 18, 2007 and April 19, 2013. Patients in this study had not received treatment with anti-microbial agents, proton pump inhibitors, or gastric pH-neutralizing agents for a month before the endoscopic treatment. Patients who received immunosuppressive or non-steroid anti-inflammatory treatment were excluded from the study. Either the patients or their parents signed an informed consent letter. This project was approved by the Bioethics Committee of the Autonomous University of Guerrero and the participating hospitals.

Biopsy collection

Endoscopies were conducted after an overnight fast with a video processor and a video gastroscope (Fujinon, Wayne, NJ, USA). Two biopsies from the gastric antrum or body, the ulcer edge, or the tumor were collected. One biopsy was immediately fixed in 10% formalin for histological analysis, while the other was placed in a buffered solution (10 mM Tris, pH 8.0, 20 mM EDTA, pH 8.0, 0.5% SDS) for the molecular diagnosis of H. pylori. The latter biopsies were stored at −20°C until processing.

Histology

The formalin-fixed biopsies were embedded in paraffin, and 4-μm sections were stained with hematoxylin-eosin for histological analysis. Histopathological findings were used to determine each patient’s diagnosis. Gastritis was classified according to the updated Sydney system.

H. pyloridetection

Total DNA was extracted from gastric biopsies according to the phenol-chloroform-iso-amyl alcohol technique after proteinase K digestion [39]. The specific presence of the H. pylori 16S rRNA gene was assessed according to the methods previously described by Román-Román et al. [40]. For all reactions, DNA samples from the cagA-positive ATCC43504 and J99 H. pylori strains were used as positive controls. For negative controls, DNA was substituted with sterile deionized water. All reactions were performed in a Mastercycler Ep gradient thermocycler (Eppendorf, Hamburg, Germany).

CagAgene amplification

H. pylori 16S rRNA gene-positive samples were subjected to PCR to detect the cagA gene using the primers described previously by Figura et al., [9]. These oligonucleotides amplified a 298-bp fragment within the constant region [9]. To amplify a 550- to 850-bp region within the 3′ variable region of the cagA gene the primers cag2 and cag4 described previously by Argent et al., were using [41],[42], Table 1. The reaction mix consisted of 1.7 mM MgCl2, 0.2 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 5 pmol of each oligonucleotide, 1 U of Platinum® Taq DNA polymerase (Invitrogen Carlsbad, CA, USA), and 300 ng of total DNA in a total volume of 25 μl. The following amplification conditions were used: 1 cycle at 94°C for 5 min; 30 cycles at 94°C for 40 s, 56°C for 30 s, and 72°C for 50 s; and a final extension cycle at 72°C for 10 min. The PCR products were subjected to electrophoresis on a 1.5% agarose gel, followed by ethidium bromide staining and analysis under an ultraviolet (UV) light. Samples were considered CagA-positive when at least 1 of the 2 bands was observed.
Table 1
PCR primers used in this study
Primer name and reference
Primer sequence (5′to 3′)
Motif amplied
Size (bp)
cagAF D008 [9]
ACAATGCTAAATTAGACAACTTGAGCGA
Constant region of the cagA gene
298
cagAR R008 [9]
TTAGAATAATCAACAAACATCACGCCAT
 
cag2F [30],[41]
GGAACCCTAGTCGGTAATG
cagA 3′ variable region
550 to 850
cag4 [30],[41]
ATCTTTGAGCTTGTCTATCG
cagA28F [41]
TTCTCAAAGGAGCAATTGGC
Forward for all EPIYA motifs
 
cagA-P1C [41],[42]
GTCCTGCTTTCTTTTTATTAACTTKAGC
EPIYA-A
264
cagA-P2TA [41],[42]
TTTAGCAACTTGAGTATAAATGGG
EPIYA-B
306
cagAWest [42]
TTTCAAAGGGAAAGGTCCGCC
EPIYA-C
501
cagAEast [42]
AGAGGGAAGCCTGCTTGATT
EPIYA-D
495

Amplification of the cagAgene 3′ variable region and EPIYA motif prediction

Each cagA-positive sample was subjected to 4 PCR reactions to identify the EPIYA motifs. The sense oligonucleotide primer cag28F was used in all 4 reactions, while the antisense oligonucleotide primers cagA-P1C, cagAP2TA [41], CagAWest, and CagAEast [42] were used in separate reactions to amplify the EPIYA-A (~264 bp), B (~306 bp), C (~501 bp), and D (495 bp) motifs, respectively, Table 1. All PCR samples were prepared with 0.2 mM dNTPs (Invitrogen Carlsbad, CA, USA), 1.5 mM MgCl2, 10 pmol of each oligonucleotide, 1 U of Platinum® Taq DNA Polymerase (Invitrogen Carlsbad, CA, USA), and 300 ng of total gastric biopsy DNA in a final volume of 25 μl. The following amplification conditions were used: 1 cycle at 94°C for 5 min; 35 cycles at 94°C for 1 min, 58°C for 30 s, and 72°C for 1 min; and a final extension cycle at 72°C for 10 min. The PCR products were separated by electrophoresis on a 1.5% agarose gel, followed by ethidium bromide staining and UV light analysis.

Sequencing and bioinformatics analysis of the cagAgene 3′ variable region

A subset of 20 samples was randomly selected for sequencing to confirm the PCR results. Cag28F and cag4 primers were used to amplify the variable region and generate ~650 to ~850-bp amplicons. The PCR reaction was conducted in a 50-μl volume with 15 pmol of each primer, 0.3 mM dNTPs, 2 mM MgCl2, and 1 U of Platinum® Taq DNA Polymerase (Invitrogen Carlsbad, CA, USA) per reaction. The amplification conditions were as follows: 1 cycle at 94°C for 5 min; 30 cycles at 94°C for 40 s, 55.5°C for 30 s, and 72°C for 50 s; and a final extension cycle at 72°C for 7 min. The PCR products were purified with the PureLink® PCR Purification Kit (Invitrogen Carlsbad, CA, USA) according to the manufacturer’s instructions. The purified products were sequenced with the BigDye terminator v1.1 sequencing kit (Applied Biosystems, Foster City, CA, USA) and analyzed with an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). The nucleotide sequences were transformed into amino acid sequences with MEGA v5 software [43]. The ClustalW option within the MEGA software was used to generate a multiple amino acid sequence alignment. The partial CagA protein sequence from the H. pylori strain 43526 (GenBank: AF001357.1) was used as a reference.

Statistical analysis

Kruskal-Wallis, ANOVA, χ2, and Fisher’s exact test analyses were used to determine significant differences. Associations between the presence of H. pylori, CagA, and the EPIYA-C motif number were determined in multinomial logistic regression models at a confidence interval of 95%. A p-value < 0.05 indicated statistical significance. All analyses were conducted with the Stata v11.1 software package (StataCorp, College Station, TX, USA).

Results

Population characteristics

Of the 499 studied patients, 402 (80.6%) were diagnosed with chronic gastritis, 77 (15.4%) with peptic ulcers, and 20 (4%) with gastric cancer. The age of patients ranged from 11 to 80 years old. The cancer patients were significantly older (p < 0.001) than those in the other groups, and the female gender was predominant in all 3 groups. Education years were significantly different among the groups (p < 0.001), Table 2.
Table 2
Sociodemographic characteristics in Mexican patients with chronic gastritis, peptic ulcers, and gastric cancer
 
Diagnosis
 
 
Chronic gastritis
n = 402
Peptic ulcer
n = 77
Gastric cancer
n = 20
p value
Age (mean ± SD)
47.4 ± 16.7
52.8 ± 16.5
58.7 ± 16)
0.0009
Gender n (%)
 Male
155 (38.6)
33 (42.9)
9 (45)
0.682
 Female
247 (61.4)
44 (57.1)
11 (55)
Smoking habit n (%)
 No
239 (59.5)
36 (41.8)
10 (50)
0.096
 Current smoker or former smoker
163 (40.5)
41 (53.2)
10 (50)
Alcohol consumption n (%)
 No
100 (24.9)
22 (28.6)
6 (30)
0.716
 Consumes or consumed
302 (75.1)
55 (71.4)
14 (70)
Education [median (ranges), years]
12 (6–17)
12 (6–17)
6 (0–7.5)
0.0001
†ANOVA test; Kruskal-Wallis test; ◊ χ2 test.

CagA status of Helicobacter pyloriinfections

The presence of the H. pylori 16S rRNA gene was detected in the gastric mucosa samples from 287 (57.5%) patients. The difference in the infection frequencies according to the diagnosis was significant (p = 0.037), and a higher prevalence was observed in gastric cancer patients (70%), Figure 1A. The H. pylori cagA gene was found in 214 (74%) of the 287 infected patients, Figure 1B. However, no significant differences in the frequencies of cagA-positive H. pylori were found among the study groups (p = 0.930). The congruence between the two PCR assays for determining cagA status was 88% (Kappa correlation coefficient = 0.8857 p <0.001), data not shown

EPIYA segments and EPIYA-C motif numbers

The PCR products amplified from cagA-positive samples showed four electrophoretic patterns that corresponded to the following combinations of EPIYA motifs: ABC, ABCC, ABBC, and ABBCCC. The EPIYA-D motif was not detected, Figure 2.
The EPIYA-ABC segment was detected in 148 (69.2%) patients, while the ABCC motif was detected in 64 (29.9%) of the 214 H. pylori cagA-positive subjects. The EPIYA ABBCCC motif was only detected in one patient with chronic gastritis, while the ABBC motif was only detected in one patient with gastric cancer, Figure 1C. The EPIYA-ABC pattern was found in 130 (79.3%) of the 164 cagA-positive H. pylori patients with chronic gastritis and was more frequent in this group than in ulcer and cancer. CagA-positive H. pylori with two EPIYA-C motifs was more frequently detected in patients with ulcers and gastric cancer (64.1% and 54.6%, respectively), Table 3, Figure 1C. The results were confirmed by sequencing a ~650- to ~850-bp fragment within the 3′ variable region of the cagA gene in 20 randomly selected samples. The agreement between the results of PCR and sequencing was 100%.
Table 3
Association of H. pylori, cagA and EPIYA-C motif number with chronic gastritis, peptic ulcer and gastric cancer
 
H. pylori
Diagnosis
Negative
Positive
OR
CI 95%
G
182
220
1.0
-
PU
24
53
1.8c
1.0-3.0
GC
6
14
1.9
0.72-5.1
Total
212
287
  
 
CagA
 
Negative
Positive
OR
CI 95%
G
56
164
1.0
-
PU
14
39
0.9
0.5- 1.9
GC
3
11
1.2
0.3 – 4.6
Total
73
214
  
 
EPIYA motif
 
ABC
ABCC
OR
IC95%
G
130
33
1.0
-
PU
14
25
7.0a
3.3 – 15.1
GC
4
6
5.9b
1.5-22.1
Total
148
64
  
 
Number of EPIYA-C
 
1 C*
≥2 Cϕ
OR
IC95%
G
130
34
1.0
-
PU
14
25
6.8a
3.2-15.6
GC
5
6
4.5c
1.3-15.9
Total
149
65
  
G; chronic gastritis, UP peptic ulcer, CG: gastric cancer. ap < 0.001 ; bp <0.01; cp < 0.05. * The EPIYA-ABBC was added; ϕ the EPIYA-ABBCCC was added
Note: Only the most frequent EPIYA motifs were considered.

Bioinformatic analysis of the CagA amino acid sequence

The cagA DNA sequences from the following amplicons were analyzed: 9 gastric cancer amplicons (MX02-C, MX21-C, MX22-C, MX05-C, MX12-C, MX03-C, MX08-C, MX17-C, MX16-C); 9 chronic gastritis amplicons (MX66-G, MX51-G, MX52-G, MX637-G, MX006-G, MX44-G, MX43-G, MX45-G, MX392-G) and two peptic ulcer amplicons (MX204-GU, MX327-GU). An in silico amino acid prediction was conducted to identify the EPIYA and CagA multimerization (CM, also known as CRPIA) motifs [26]. The following motifs and corresponding patterns were found: EPIYA-A with the EPIYA(K/Q)VNKKK (A/T/V/S)GQ pattern, EPIYA-B with the E(P/S)IY(A/T)(Q/K)VAKKV(N/T)(A/Q)KI pattern, and EPIYA-C with the EPIYATIDDLGGP pattern, Figure 3. Two EPIYA-B motif variants were found; one chronic gastritis sample (MX44-G) had an ESIYT sequence, while 10 (50%) of the 20 sequences contained the EPIYT pattern (MX02-C, MX22-C, MX05-C, MX637-G, MX03-C, MX08-C, MX327-GU, MX43-G, MX16-C). The following changes were found among the 16 amino acid residues that comprise the CRPIA motif: FPLK(R/K)H(D/G)KVD(D/N)LSKVG for the first CRPIA motif in the N-terminus of EPIYA-C, FPLK(R/K)H(D/G)KVDDLSKVG for the second CRPIA motif, and FPLKRHDKVDDLSKV for the last CRPIA motif in the C-terminus. A CRPIA motif was identified in the N-terminus of one of the two EPIYA-B motifs in the CagA-containing MX16-C gastric cancer sample. Within this sequence, the amino acids GKDKGPE were found in the N-terminus of the EPIYA-A motif (Figure 3). All CRPIA motifs were of the western type, Figure 3. Nucleotide and predict protein sequences of all strains were deposited in GenBank, accession numbers [GenBank:KF800898.1- GenBank:KF800917.1].

Association between H. pylori infection, cagA-positive strains, peptic ulcers, and gastric cancer

H. pylori infection was associated with peptic ulcers (OR = 1.8; 95% CI = 1.0–3.0) but not with gastric cancer (OR = 1.9; 95% CI = 0.72–5.1). On the other hand, infection with cagA-positive strains was not associated with either ulcers or gastric cancer, Table 3.

Association between the EPIYA-C motifs number with peptic ulcers, and gastric cancer

The presence of the EPIYA-ABCC segment was associated with peptic ulcers (OR = 7.0; 95% CI = 3.3–15.1; p < 0.001) and gastric cancer (OR = 5.9; 95% CI = 1.5–22.1; p = 0.008). The increase in the number of EPIYA-C repeats was also associated with peptic ulcers (OR = 6.8; 95% CI = 3.2–15.6; p < 0.001), as well as cancer (OR = 4.5; 95% CI = 1.3-15.9; p = 0.017), Table 3.

Discussion

Infection with a cagA-positive H. pylori strain is recognized as the most important risk factor for gastric cancer and is also associated with atrophic gastritis and duodenal ulcers [29],[44]. Nonetheless, the majority of infected patients do not develop serious diseases.
In the present study, we found that 57.5% of patients with gastric pathologies were H. pylori-positive, and 74% of the infecting strains harbored the cagA gene. The global prevalence of cagA-positive H. pylori, which ranges from 43% to 90%, is in accordance with the previously reported seroprevalence in a Mexican population with gastric pathologies [8],[32]-[36]. However, serology might overestimate the frequency of H. pylori and cagA-positive strains as it is unable to differentiate between current and past infections. The discrepancies in the prevalence of H. pylori can be explained by differences in the diagnostic method used, age of patients, geographic area and the environmental health conditions in which people live. Another possible explanation is that the rate of infection is decreasing [36]. In our study, the prevalence of cagA-positive H. pylori in patients with chronic gastritis was higher (74.6%) than the rate reported in 2009 by Paniagua et al. (52.4%) via multiplex PCR [45]. In gastric cancer patients, the prevalence of cagA was higher (78.6%) than the seroprevalence reported in 2008 by Carmolinga et al. (66.2%) [8]. In this work, the frequency of H. pylori cagA-positive that we found was similar to antibodies prevalence in Mexican subjects and, unlike to other studies, the strengths of our study are in the sample size and the high sensitivity and specificity of the methods used to detect H. pylori and cagA.
Some authors have found an association between CagA and the severity of gastric pathologies [7],[11]-[14]. It has been proposed that this relationship might be explained by the number of EPIYA-C motifs in the protein as these motifs influence the degree of virulence and oncogenic potential of cagA-positive H. pylori [7],[46]. It is likely that determining the EPIYA motifs in CagA, rather than detecting cagA per se, would be a better marker for assessing the risk of serious gastric pathology [41],[47]. In our study, 100% of the EPIYA motifs identified in CagA were of the western type, and their distributions among the pathologies were significantly different (p ≤ 0.001). In 69.1% of the cases, the cagA gene contained an EPIYA-C motif in the typical ABC sequence, and this was more frequent in patients with chronic gastritis (79.3%). This result was similar to that reported by Batista et al. for Brazilian populations (70.6% in total of cases and 79.4% in patients with gastritis), [48] but higher than that found in Colombian patients by Quiroga et al. (49% in total of cases and 59.6% in patients with gastriris), [29] and by Acosta et al. (62.3% in total of cases and 52.6%, in gastritis) [49]. Interestingly, Rizzato et al. [38] detected the EPIYA-ABC pattern in 82% of Venezuelan and Mexican patients with chronic gastritis and gastric cancer, without finding frequency differences between the groups. Reyes-León et al. [37] found that the ABC sequence was more frequent (50%) in children from Mexico City with chronic abdominal pain. These findings emphasize the differences in the geographic distribution of H. pylori strains, and these differences might be related to the uneven prevalence of gastric cancer in the inhabitants of different Mexican regions.
The frequency of cases that harbored cagA-positive H. pylori with two EPIYA-C motifs was higher in gastric cancer patients (64%) and thus higher than the frequencies reported by Acosta (27.7%) and Quiroga (35.3%) in Colombia and by Batista in Brazil (34.6%) [29],[48],[49]. We found that the cagA allele that encoded two EPIYA-C segments was also predominant in patients with peptic ulcers (54.5%). This frequency is higher than that reported by Torres in Cuban patients (15.7%) [50]. Unexpectedly, the only motif with three EPIYA-C repeats (ABBCCC) was found in a patient with chronic gastritis. Reportedly, an increase in the number of phosphorylation sites in the C-terminus of CagA is associated with the carcinogenic potential of H. pylori [15],[37],[49]. Thus, it is likely that those patients with chronic gastritis infected with a H. pylori strain with cagA gene that encodes two or more EPIYA-C motifs (21%) are at higher risk of developing more serious diseases.
The amino acid sequences obtained during a bioinformatics analysis revealed that the alanine-to-threonine substitution in the EPIYA-B (EPIYT) motif occurred frequently (10 out of 20 sequences) in the studied groups. These findings are in accordance with those reported by Rizzato et al. in 2012 for Mexican and Venezuelan subjects with chronic gastritis and gastric cancer (50% of the B motifs harbored the EPIYT variant, with no significant differences between the groups) [38]. ABCC isolates bearing this modification have also been reported to cause decreased levels of cellular elongation and IL-8 secretion compared to those that bear the normal ABCC pattern [37]. It is possible that, in a Mexican population, the frequency of CagA isoforms with the EPIYT amino acid sequence in EPIYA-B is associated with the prevalence of gastroduodenal diseases. However, the existing epidemiological and experimental studies are insufficient to further support this hypothesis.
The ESIYT modification in EPIYA-B was identified in one chronic gastritis sample. This sequence belonged to the AM-I CagA variant, which has been associated with low H. pylori virulence in comparison to the western or Asian strains [26]. However, the AM-I and II CagA variants, such as those found in indigenous Mexican groups with Amerindian ancestry, show degeneration or elimination in their CRPIA motifs [26],[31],[51]. Interestingly, the CagA variants with the ESIYT sequence found in the present study contained western-type CRPIA and therefore differed from the Amerindian variants [31]. A CRPIA sequence in the N-terminus of the EPIYA-B motif was also detected in a gastric cancer sample. This finding agrees with those reported by Sicinschi et al., Sgouras et al. and Acosta et al., who noted that in some CagA variants, the CRPIA segment can be found in the N-termini of the EPIYA-A and B motifs [15],[49],[52]. The localization of the CRPIA motif within EPIYA-B might result from recombination between H. pylori strains with different cagA allelotypes or from the insertion of DNA sequences that contribute to H. pylori diversification [53],[54]. The CRPIA sequences stabilize the CagA protein, influence its half-life and are associated with oncoprotein activity in epithelial cells [15]. Thus, our results highlight the need to evaluate the functional importance of the EPIYT and ESIYT variants in EPIYA-B. Furthermore, it is necessary to assess the effects that the observed sequence variants and the localization of the CRPIA motifs in the ABCC pattern exert on CagA activity. It is likely that the prevalence of some of these variants could explain why the gastric cancer incidence rates of male and female Mexican patients (9.4 and 6.7/100,000, respectively) are similar to those reported in Southeastern Asian countries (10.2 and 4.7/100,000 in men and women, respectively) [55], despite the differences in the cagA-positive H. pylori prevalence (90–95% in Japan, Korea, and China; 50–60% in Mexico).
The association of cagA polymorphisms with severe gastric pathologies [7],[29],[48]-[50],[52] or with pre-cancerous lesions is controversial [10],[15],[30],[32], and only a few studies have been conducted in Hispanic populations with gastric ulcers [50]. This is the first study to investigate the prevalence of cagA variants in southern Mexico. Our results show that the presence of two or more EPIYA-C repeats within the cagA gene represents a higher risk of peptic ulcers and gastric cancer. It is likely that this increase in the number of EPIYA-C repeats plays an important role in the development of such diseases in individuals from this particular geographic region. A total of 51.5% of the samples with two EPIYA-C repeats came from patients with chronic gastritis. It is likely that some of these individuals have a higher risk of cancer development [29] given that the increase in the number of EPIYA-C motifs increases the CagA phosphorylation status and its interactions with cellular proteins that induce epithelial cell elongation, cell turnover, and pro-inflammatory cytokine production, thus facilitating the development of gastric cancer [29],[41]. These findings might also be related to other clinical results.
The virulence factors of H. pylori are important risk determinants but are not sufficient to induce the full development of severe gastroduodenal disease. The host’s genetic and sociocultural factors also contribute to the risk of pre-cancerous lesions and gastric cancer [56],[57].

Conclusions

In conclusion, the present study shows that cagA-positive H. pylori infection is highly prevalent in patients from southern Mexico with chronic gastritis, peptic ulcers, and gastric cancer. All CagA isoforms were of the western type. The cagA allele that encodes the EPIYA-ABC pattern was most frequently observed in chronic gastritis samples, while the EPIYA-ABCC isoform predominated in peptic ulcer and gastric cancer samples. CagA variants that encode two or more EPIYA-C motifs are associated with peptic ulcer and gastric cancer. Likely, either the EPIYA-ABCC sequence or patterns with two or more EPIYA-C motifs are a risk marker for severe gastric pathologies.

Acknowledgements

The authors wish to thank gastroenterologists as well as the nurses and support personnel who assisted in obtaining samples. We also want to thank Martín O. Morrugares Ixtepan, Specialist in Pathological Anatomy with subspecialty in Oncological Pathology, who was responsible for the histopathological diagnosis. Special thanks to Dr. Victor Hugo Garzon Barrientos and Dr. José Eduardo Navarro Zarza, who approved the project. This study was supported by the Autonomous University of Guerrero (2010–2012 funding period) and the Secretariat of Public Education (via PROMEP 2007 key PROMEP UAGUER-EXB-096 and PIFI-2010 support for ex-fellows). During the investigation, Tomás Manuel Poblete and Fredy Omar Beltrán were fellows of CONACYT, Mexico.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The Creative Commons Public Domain Dedication waiver (https://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

GFT and ARR designed and coordinated the research. SR and JS conducted the endoscopic study and obtained patient biopsies. FOBA and TMP conducted the research. MAR and OMH conducted the sequencing reactions. OPZ conducted the bioinformatics analysis. FOBA, BIA, and GFT analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Literatur
1.
Zurück zum Zitat de Martel C, Forman D, Plummer M: Gastric cancer: epidemiology and risk factors. Gastroenterol Clin N Am. 2013, 42: 219-40. 10.1016/j.gtc.2013.01.003.CrossRef de Martel C, Forman D, Plummer M: Gastric cancer: epidemiology and risk factors. Gastroenterol Clin N Am. 2013, 42: 219-40. 10.1016/j.gtc.2013.01.003.CrossRef
2.
Zurück zum Zitat Wroblewski LE, Peek RM, Wilson KT: Helicobacter pylori and gastric cancer: factors that modulate disease risk. Clin Microbiol Rev. 2010, 23: 713-39. 10.1128/CMR.00011-10.CrossRefPubMedPubMedCentral Wroblewski LE, Peek RM, Wilson KT: Helicobacter pylori and gastric cancer: factors that modulate disease risk. Clin Microbiol Rev. 2010, 23: 713-39. 10.1128/CMR.00011-10.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Hatakeyama M: Helicobacter pylori and gastric carcinogenesis. J Gastroenterol. 2009, 44: 239-48. 10.1007/s00535-009-0014-1.CrossRefPubMed Hatakeyama M: Helicobacter pylori and gastric carcinogenesis. J Gastroenterol. 2009, 44: 239-48. 10.1007/s00535-009-0014-1.CrossRefPubMed
4.
Zurück zum Zitat Kuipers EJ, Perez-Perez GI, Meuwissen SG, Blaser MJ: Helicobacter pylori and atrophic gastritis: importance of the cagA status. J Natl Cancer Inst. 1995, 87: 1777-80. 10.1093/jnci/87.23.1777.CrossRefPubMed Kuipers EJ, Perez-Perez GI, Meuwissen SG, Blaser MJ: Helicobacter pylori and atrophic gastritis: importance of the cagA status. J Natl Cancer Inst. 1995, 87: 1777-80. 10.1093/jnci/87.23.1777.CrossRefPubMed
5.
Zurück zum Zitat Proenca Modena JL, Lopes Sales AI, Olszanski Acrani G, Russo R, Vilela Ribeiro MA, Fukuhara Y, da Silveira WD, Modena JL, de Oliveira RB, Brocchi M: Association between Helicobacter pylori genotypes and gastric disorders in relation to the cag pathogenicity island. Diagn Microbiol Infect Dis. 2007, 59: 7-16. 10.1016/j.diagmicrobio.2007.03.019.CrossRefPubMed Proenca Modena JL, Lopes Sales AI, Olszanski Acrani G, Russo R, Vilela Ribeiro MA, Fukuhara Y, da Silveira WD, Modena JL, de Oliveira RB, Brocchi M: Association between Helicobacter pylori genotypes and gastric disorders in relation to the cag pathogenicity island. Diagn Microbiol Infect Dis. 2007, 59: 7-16. 10.1016/j.diagmicrobio.2007.03.019.CrossRefPubMed
6.
Zurück zum Zitat Secka O, Antonio M, Berg DE, Tapgun M, Bottomley C, Thomas V, Walton R, Corrah T, Thomas JE, Adegbola RA: Mixed infection with cagA positive and cagA negative strains of Helicobacter pylori lowers disease burden in The Gambia. PLoS One. 2011, 6: e27954-10.1371/journal.pone.0027954.CrossRefPubMedPubMedCentral Secka O, Antonio M, Berg DE, Tapgun M, Bottomley C, Thomas V, Walton R, Corrah T, Thomas JE, Adegbola RA: Mixed infection with cagA positive and cagA negative strains of Helicobacter pylori lowers disease burden in The Gambia. PLoS One. 2011, 6: e27954-10.1371/journal.pone.0027954.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Basso D, Zambon CF, Letley DP, Stranges A, Marchet A, Rhead JL, Schiavon S, Guariso G, Ceroti M, Nitti D, Rugge M, Plebani M, Atherton JC: Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology. 2008, 135: 91-9. 10.1053/j.gastro.2008.03.041.CrossRefPubMed Basso D, Zambon CF, Letley DP, Stranges A, Marchet A, Rhead JL, Schiavon S, Guariso G, Ceroti M, Nitti D, Rugge M, Plebani M, Atherton JC: Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology. 2008, 135: 91-9. 10.1053/j.gastro.2008.03.041.CrossRefPubMed
8.
Zurück zum Zitat Camorlinga-Ponce M, Flores-Luna L, Lazcano-Ponce E, Herrero R, Bernal-Sahagun F, Abdo-Francis JM, Aguirre-Garcia J, Munoz N, Torres J: Age and severity of mucosal lesions influence the performance of serologic markers in Helicobacter pylori-associated gastroduodenal pathologies. Cancer Epidemiol Biomarkers Prev. 2008, 17: 2498-504. 10.1158/1055-9965.EPI-08-0289.CrossRefPubMed Camorlinga-Ponce M, Flores-Luna L, Lazcano-Ponce E, Herrero R, Bernal-Sahagun F, Abdo-Francis JM, Aguirre-Garcia J, Munoz N, Torres J: Age and severity of mucosal lesions influence the performance of serologic markers in Helicobacter pylori-associated gastroduodenal pathologies. Cancer Epidemiol Biomarkers Prev. 2008, 17: 2498-504. 10.1158/1055-9965.EPI-08-0289.CrossRefPubMed
9.
Zurück zum Zitat Figura N, Vindigni C, Covacci A, Presenti L, Burronim D, Vernillo R, Banducci T, Roviello F, Marrelli D, Biscontri M, Kristodhullu S, Gennari C, Vaira D: cagA positive and negative Helicobacter pylori strains are simultaneously present in the stomach of most patients with non-ulcer dyspepsia: relevance to histological damage. Gut. 1998, 42: 772-8. 10.1136/gut.42.6.772.CrossRefPubMedPubMedCentral Figura N, Vindigni C, Covacci A, Presenti L, Burronim D, Vernillo R, Banducci T, Roviello F, Marrelli D, Biscontri M, Kristodhullu S, Gennari C, Vaira D: cagA positive and negative Helicobacter pylori strains are simultaneously present in the stomach of most patients with non-ulcer dyspepsia: relevance to histological damage. Gut. 1998, 42: 772-8. 10.1136/gut.42.6.772.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Flores-Luna L, Camorlinga-Ponce M, Hernandez-Suarez G, Kasamatsu E, Martinez ME, Murillo R, Lazcano E, Torres J: The utility of serologic tests as biomarkers for Helicobacter pylori-associated precancerous lesions and gastric cancer varies between Latin American countries. Cancer Causes Control. 2013, 24: 241-8. 10.1007/s10552-012-0106-8.CrossRefPubMed Flores-Luna L, Camorlinga-Ponce M, Hernandez-Suarez G, Kasamatsu E, Martinez ME, Murillo R, Lazcano E, Torres J: The utility of serologic tests as biomarkers for Helicobacter pylori-associated precancerous lesions and gastric cancer varies between Latin American countries. Cancer Causes Control. 2013, 24: 241-8. 10.1007/s10552-012-0106-8.CrossRefPubMed
11.
Zurück zum Zitat Huang JQ, Zheng GF, Sumanac K, Irvine EJ, Hunt RH: Meta-analysis of the relationship between cagA seropositivity and gastric cancer. Gastroenterology. 2003, 125: 1636-44. 10.1053/j.gastro.2003.08.033.CrossRefPubMed Huang JQ, Zheng GF, Sumanac K, Irvine EJ, Hunt RH: Meta-analysis of the relationship between cagA seropositivity and gastric cancer. Gastroenterology. 2003, 125: 1636-44. 10.1053/j.gastro.2003.08.033.CrossRefPubMed
12.
Zurück zum Zitat Palli D, Masala G, Del Giudice G, Plebani M, Basso D, Berti D, Numans ME, Ceroti M, Peeters PH, de Mesquita HB B, Buchner FL, Clavel-Chapelon F, Boutron-Ruault MC, Krogh V, Saieva C, Vineis P, Panico S, Tumino R, Nyrén O, Simán H, Berglund G, Hallmans G, Sanchez MJ, Larrãnaga N, Barricarte A, Navarro C, Quiros JR, Key T, Allen N, Bingham S: CagA+ Helicobacter pylori infection and gastric cancer risk in the EPIC-EURGAST study. Int J Cancer. 2007, 120 (4): 859-67. 10.1002/ijc.22435.CrossRefPubMed Palli D, Masala G, Del Giudice G, Plebani M, Basso D, Berti D, Numans ME, Ceroti M, Peeters PH, de Mesquita HB B, Buchner FL, Clavel-Chapelon F, Boutron-Ruault MC, Krogh V, Saieva C, Vineis P, Panico S, Tumino R, Nyrén O, Simán H, Berglund G, Hallmans G, Sanchez MJ, Larrãnaga N, Barricarte A, Navarro C, Quiros JR, Key T, Allen N, Bingham S: CagA+ Helicobacter pylori infection and gastric cancer risk in the EPIC-EURGAST study. Int J Cancer. 2007, 120 (4): 859-67. 10.1002/ijc.22435.CrossRefPubMed
13.
Zurück zum Zitat Sahara S, Sugimoto M, Vilaichone RK, Mahachai V, Miyajima H, Furuta T, Yamaoka Y: Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in Southeast Asian countries: a meta-analysis. BMC Infect Dis. 2012, 12: 223-10.1186/1471-2334-12-223.CrossRefPubMedPubMedCentral Sahara S, Sugimoto M, Vilaichone RK, Mahachai V, Miyajima H, Furuta T, Yamaoka Y: Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in Southeast Asian countries: a meta-analysis. BMC Infect Dis. 2012, 12: 223-10.1186/1471-2334-12-223.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Satomi S, Yamakawa A, Matsunaga S, Masaki R, Inagaki T, Okuda T, Suto H, Ito Y, Yamazaki Y, Kuriyama M, Keida Y, Kutsumi H, Azuma T: Relationship between the diversity of the cagA gene of Helicobacter pylori and gastric cancer in Okinawa, Japan. J Gastroenterol. 2006, 41: 668-73. 10.1007/s00535-006-1838-6.CrossRefPubMed Satomi S, Yamakawa A, Matsunaga S, Masaki R, Inagaki T, Okuda T, Suto H, Ito Y, Yamazaki Y, Kuriyama M, Keida Y, Kutsumi H, Azuma T: Relationship between the diversity of the cagA gene of Helicobacter pylori and gastric cancer in Okinawa, Japan. J Gastroenterol. 2006, 41: 668-73. 10.1007/s00535-006-1838-6.CrossRefPubMed
15.
Zurück zum Zitat Sicinschi LA, Correa P, Peek RM, Camargo MC, Piazuelo MB, Romero-Gallo J, Hobbs SS, Krishna U, Delgado A, Mera R, Bravo LE, Schneider BG: CagA C-terminal variations in Helicobacter pylori strains from Colombian patients with gastric precancerous lesions. Clin Microbiol Infect. 2010, 16: 369-78. 10.1111/j.1469-0691.2009.02811.x.CrossRefPubMed Sicinschi LA, Correa P, Peek RM, Camargo MC, Piazuelo MB, Romero-Gallo J, Hobbs SS, Krishna U, Delgado A, Mera R, Bravo LE, Schneider BG: CagA C-terminal variations in Helicobacter pylori strains from Colombian patients with gastric precancerous lesions. Clin Microbiol Infect. 2010, 16: 369-78. 10.1111/j.1469-0691.2009.02811.x.CrossRefPubMed
16.
Zurück zum Zitat Matteo MJ, Granados G, Perez CV, Olmos M, Sanchez C, Catalano M: Helicobacter pylori cag pathogenicity island genotype diversity within the gastric niche of a single host. J Med Microbiol. 2007, 56 (Pt 5): 664-9. 10.1099/jmm.0.46885-0.CrossRefPubMed Matteo MJ, Granados G, Perez CV, Olmos M, Sanchez C, Catalano M: Helicobacter pylori cag pathogenicity island genotype diversity within the gastric niche of a single host. J Med Microbiol. 2007, 56 (Pt 5): 664-9. 10.1099/jmm.0.46885-0.CrossRefPubMed
17.
Zurück zum Zitat Nomura AM, Lee J, Stemmermann GN, Nomura RY, Perez-Perez GI, Blaser MJ: Helicobacter pylori CagA seropositivity and gastric carcinoma risk in a Japanese American population. J Infect Dis. 2002, 186: 1138-44. 10.1086/343808.CrossRefPubMed Nomura AM, Lee J, Stemmermann GN, Nomura RY, Perez-Perez GI, Blaser MJ: Helicobacter pylori CagA seropositivity and gastric carcinoma risk in a Japanese American population. J Infect Dis. 2002, 186: 1138-44. 10.1086/343808.CrossRefPubMed
18.
Zurück zum Zitat Backert S, Ziska E, Brinkmann V, Zimny-Arndt U, Fauconnier A, Jungblut PR, Naumann M, Meyer TF: Translocation of the Helicobacter pylori CagA protein in gastric epithelial cells by a type IV secretion apparatus. Cell Microbiol. 2000, 2: 155-64. 10.1046/j.1462-5822.2000.00043.x.CrossRefPubMed Backert S, Ziska E, Brinkmann V, Zimny-Arndt U, Fauconnier A, Jungblut PR, Naumann M, Meyer TF: Translocation of the Helicobacter pylori CagA protein in gastric epithelial cells by a type IV secretion apparatus. Cell Microbiol. 2000, 2: 155-64. 10.1046/j.1462-5822.2000.00043.x.CrossRefPubMed
19.
Zurück zum Zitat Rohde M, Puls J, Buhrdorf R, Fischer W, Haas R: A novel sheathed surface organelle of the Helicobacter pylori cag type IV secretion system. Mol Microbiol. 2003, 49: 219-34. 10.1046/j.1365-2958.2003.03549.x.CrossRefPubMed Rohde M, Puls J, Buhrdorf R, Fischer W, Haas R: A novel sheathed surface organelle of the Helicobacter pylori cag type IV secretion system. Mol Microbiol. 2003, 49: 219-34. 10.1046/j.1365-2958.2003.03549.x.CrossRefPubMed
20.
Zurück zum Zitat Mueller D, Tegtmeyer N, Brandt S, Yamaoka Y, De Poire E, Sgouras D, Wessler S, Torres J, Smolka A, Backert S: c-Src and c-Abl kinases control hierarchic phosphorylation and function of the CagA effector protein in Western and East Asian Helicobacter pylori strains. J Clin Invest. 2012, 122: 1553-66. 10.1172/JCI61143.CrossRefPubMedPubMedCentral Mueller D, Tegtmeyer N, Brandt S, Yamaoka Y, De Poire E, Sgouras D, Wessler S, Torres J, Smolka A, Backert S: c-Src and c-Abl kinases control hierarchic phosphorylation and function of the CagA effector protein in Western and East Asian Helicobacter pylori strains. J Clin Invest. 2012, 122: 1553-66. 10.1172/JCI61143.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Selbach M, Moese S, Hauck CR, Meyer TF, Backert S: Src is the kinase of the Helicobacter pylori CagA protein in vitro and in vivo. J Biol Chem. 2002, 277: 6775-8. 10.1074/jbc.C100754200.CrossRefPubMed Selbach M, Moese S, Hauck CR, Meyer TF, Backert S: Src is the kinase of the Helicobacter pylori CagA protein in vitro and in vivo. J Biol Chem. 2002, 277: 6775-8. 10.1074/jbc.C100754200.CrossRefPubMed
22.
Zurück zum Zitat Tegtmeyer N, Backert S: Role of Abl and Src family kinases in actin-cytoskeletal rearrangements induced by the Helicobacter pylori CagA protein. Eur J Cell Biol. 2011, 90: 880-90. 10.1016/j.ejcb.2010.11.006.CrossRefPubMed Tegtmeyer N, Backert S: Role of Abl and Src family kinases in actin-cytoskeletal rearrangements induced by the Helicobacter pylori CagA protein. Eur J Cell Biol. 2011, 90: 880-90. 10.1016/j.ejcb.2010.11.006.CrossRefPubMed
23.
Zurück zum Zitat Murata-Kamiya N: Pathophysiological functions of the CagA oncoprotein during infection by Helicobacter pylori . Microbes Infect. 2011, 13: 799-807. 10.1016/j.micinf.2011.03.011.CrossRefPubMed Murata-Kamiya N: Pathophysiological functions of the CagA oncoprotein during infection by Helicobacter pylori . Microbes Infect. 2011, 13: 799-807. 10.1016/j.micinf.2011.03.011.CrossRefPubMed
24.
Zurück zum Zitat Backert S, Tegtmeyer N, Selbach M: The versatility of Helicobacter pylori CagA effector protein functions: the master key hypothesis. Helicobacter. 2010, 15: 163-76. 10.1111/j.1523-5378.2010.00759.x.CrossRefPubMed Backert S, Tegtmeyer N, Selbach M: The versatility of Helicobacter pylori CagA effector protein functions: the master key hypothesis. Helicobacter. 2010, 15: 163-76. 10.1111/j.1523-5378.2010.00759.x.CrossRefPubMed
25.
Zurück zum Zitat Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M: SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science. 2002, 295: 683-6. 10.1126/science.1067147.CrossRefPubMed Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M: SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science. 2002, 295: 683-6. 10.1126/science.1067147.CrossRefPubMed
26.
Zurück zum Zitat Suzuki M, Kiga K, Kersulyte D, Cok J, Hooper CC, Mimuro H, Sanada T, Suzuki S, Oyama M, Kozuka-Hata H, Kamiya S, Zou QM, Gilman RH, Berg DE, Sasakawa C: Attenuated CagA oncoprotein in Helicobacter pylori from Amerindians in Peruvian Amazon. J Biol Chem. 2011, 286: 29964-72. 10.1074/jbc.M111.263715.CrossRefPubMedPubMedCentral Suzuki M, Kiga K, Kersulyte D, Cok J, Hooper CC, Mimuro H, Sanada T, Suzuki S, Oyama M, Kozuka-Hata H, Kamiya S, Zou QM, Gilman RH, Berg DE, Sasakawa C: Attenuated CagA oncoprotein in Helicobacter pylori from Amerindians in Peruvian Amazon. J Biol Chem. 2011, 286: 29964-72. 10.1074/jbc.M111.263715.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Suzuki M, Mimuro H, Kiga K, Fukumatsu M, Ishijima N, Morikawa H, Nagai S, Koyasu S, Gilman RH, Kersulyte D, Berg DE, Sasakawa C: Helicobacter pylori CagA phosphorylation-independent function in epithelial proliferation and inflammation. Cell Host Microbe. 2009, 5: 23-34. 10.1016/j.chom.2008.11.010.CrossRefPubMed Suzuki M, Mimuro H, Kiga K, Fukumatsu M, Ishijima N, Morikawa H, Nagai S, Koyasu S, Gilman RH, Kersulyte D, Berg DE, Sasakawa C: Helicobacter pylori CagA phosphorylation-independent function in epithelial proliferation and inflammation. Cell Host Microbe. 2009, 5: 23-34. 10.1016/j.chom.2008.11.010.CrossRefPubMed
28.
Zurück zum Zitat Yamazaki S, Yamakawa A, Ito Y, Ohtani M, Higashi H, Hatakeyama M, Azuma T: The CagA protein of Helicobacter pylori is translocated into epithelial cells and binds to SHP-2 in human gastric mucosa. J Infect Dis. 2003, 187: 334-7. 10.1086/367807.CrossRefPubMed Yamazaki S, Yamakawa A, Ito Y, Ohtani M, Higashi H, Hatakeyama M, Azuma T: The CagA protein of Helicobacter pylori is translocated into epithelial cells and binds to SHP-2 in human gastric mucosa. J Infect Dis. 2003, 187: 334-7. 10.1086/367807.CrossRefPubMed
29.
Zurück zum Zitat Quiroga AJ, Huertas A, Combita AL, Bravo MM: Variation in the number of EPIYA-C repeats in CagA protein from Colombian Helicobacter pylori strains and its ability middle to induce hummingbird phenotype in gastric epithelial cells. Biomedica. 2010, 30: 251-8. 10.7705/biomedica.v30i2.188.CrossRefPubMed Quiroga AJ, Huertas A, Combita AL, Bravo MM: Variation in the number of EPIYA-C repeats in CagA protein from Colombian Helicobacter pylori strains and its ability middle to induce hummingbird phenotype in gastric epithelial cells. Biomedica. 2010, 30: 251-8. 10.7705/biomedica.v30i2.188.CrossRefPubMed
30.
Zurück zum Zitat Salih BA, Bolek BK, Arikan S: DNA sequence analysis of cagA 3′ motifs of Helicobacter pylori strains from patients with peptic ulcer diseases. J Med Microbiol. 2010, 59 (Pt 2): 144-8. 10.1099/jmm.0.014894-0.CrossRefPubMed Salih BA, Bolek BK, Arikan S: DNA sequence analysis of cagA 3′ motifs of Helicobacter pylori strains from patients with peptic ulcer diseases. J Med Microbiol. 2010, 59 (Pt 2): 144-8. 10.1099/jmm.0.014894-0.CrossRefPubMed
31.
Zurück zum Zitat Camorlinga-Ponce M, Perez-Perez G, Gonzalez-Valencia G, Mendoza I, Penaloza-Espinosa R, Ramos I, Kersulyte D, Reyes-Leon A, Romo C, Granados J, Muñoz L, Berg DE, Torres J: Helicobacter pylori genotyping from American indigenous groups shows novel Amerindian vacA and cagA alleles and Asian. African and European admixture. PLoS One. 2011, 6: e27212-10.1371/journal.pone.0027212.CrossRefPubMedPubMedCentral Camorlinga-Ponce M, Perez-Perez G, Gonzalez-Valencia G, Mendoza I, Penaloza-Espinosa R, Ramos I, Kersulyte D, Reyes-Leon A, Romo C, Granados J, Muñoz L, Berg DE, Torres J: Helicobacter pylori genotyping from American indigenous groups shows novel Amerindian vacA and cagA alleles and Asian. African and European admixture. PLoS One. 2011, 6: e27212-10.1371/journal.pone.0027212.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Bosques-Padilla FJ, Tijerina-Menchaca R, Perez-Perez GI, Flores-Gutierrez JP, Garza-Gonzalez E: Comparison of Helicobacter pylori prevalence in symptomatic patients in northeastern Mexico with the rest of the country: its association with gastrointestinal disease. Arch Med Res. 2003, 34: 60-3. 10.1016/S0188-4409(02)00459-9.CrossRefPubMed Bosques-Padilla FJ, Tijerina-Menchaca R, Perez-Perez GI, Flores-Gutierrez JP, Garza-Gonzalez E: Comparison of Helicobacter pylori prevalence in symptomatic patients in northeastern Mexico with the rest of the country: its association with gastrointestinal disease. Arch Med Res. 2003, 34: 60-3. 10.1016/S0188-4409(02)00459-9.CrossRefPubMed
33.
Zurück zum Zitat Lopez-Carrillo L, Camargo MC, Schneider BG, Sicinschi LA, Hernandez-Ramirez RU, Correa P, Cebrian ME: Capsaicin consumption, Helicobacter pylori CagA status and IL1B-31C > T genotypes: a host and environment interaction in gastric cancer. Food Chem Toxicol. 2012, 50: 2118-22. 10.1016/j.fct.2012.02.043.CrossRefPubMedPubMedCentral Lopez-Carrillo L, Camargo MC, Schneider BG, Sicinschi LA, Hernandez-Ramirez RU, Correa P, Cebrian ME: Capsaicin consumption, Helicobacter pylori CagA status and IL1B-31C > T genotypes: a host and environment interaction in gastric cancer. Food Chem Toxicol. 2012, 50: 2118-22. 10.1016/j.fct.2012.02.043.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Lopez-Carrillo L, Torres-Lopez J, Galvan-Portillo M, Munoz L, Lopez-Cervantes M: Helicobacter pylori-CagA seropositivity and nitrite and ascorbic acid food intake as predictors for gastric cancer. Eur J Cancer. 2004, 40: 1752-9. 10.1016/j.ejca.2004.04.025.CrossRefPubMed Lopez-Carrillo L, Torres-Lopez J, Galvan-Portillo M, Munoz L, Lopez-Cervantes M: Helicobacter pylori-CagA seropositivity and nitrite and ascorbic acid food intake as predictors for gastric cancer. Eur J Cancer. 2004, 40: 1752-9. 10.1016/j.ejca.2004.04.025.CrossRefPubMed
35.
Zurück zum Zitat Sicinschi LA, Lopez-Carrillo L, Camargo MC, Correa P, Sierra RA, Henry RR, Chen J, Zabaleta J, Piazuelo MB, Schneider BG: Gastric cancer risk in a Mexican population: role of Helicobacter pylori CagA positive infection and polymorphisms in interleukin-1 and −10 genes. Int J Cancer. 2006, 118: 649-57. 10.1002/ijc.21364.CrossRefPubMed Sicinschi LA, Lopez-Carrillo L, Camargo MC, Correa P, Sierra RA, Henry RR, Chen J, Zabaleta J, Piazuelo MB, Schneider BG: Gastric cancer risk in a Mexican population: role of Helicobacter pylori CagA positive infection and polymorphisms in interleukin-1 and −10 genes. Int J Cancer. 2006, 118: 649-57. 10.1002/ijc.21364.CrossRefPubMed
36.
Zurück zum Zitat Torres J, Lopez L, Lazcano E, Camorlinga M, Flores L, Munoz O: Trends in Helicobacter pylori infection and gastric cancer in Mexico. Cancer Epidemiol Biomarkers Prev. 2005, 14: 1874-7. 10.1158/1055-9965.EPI-05-0113.CrossRefPubMed Torres J, Lopez L, Lazcano E, Camorlinga M, Flores L, Munoz O: Trends in Helicobacter pylori infection and gastric cancer in Mexico. Cancer Epidemiol Biomarkers Prev. 2005, 14: 1874-7. 10.1158/1055-9965.EPI-05-0113.CrossRefPubMed
37.
Zurück zum Zitat Reyes-Leon A, Atherton JC, Argent RH, Puente JL, Torres J: Heterogeneity in the activity of Mexican Helicobacter pylori strains in gastric epithelial cells and its association with diversity in the cagA gene. Infect Immun. 2007, 75: 3445-54. 10.1128/IAI.01951-06.CrossRefPubMedPubMedCentral Reyes-Leon A, Atherton JC, Argent RH, Puente JL, Torres J: Heterogeneity in the activity of Mexican Helicobacter pylori strains in gastric epithelial cells and its association with diversity in the cagA gene. Infect Immun. 2007, 75: 3445-54. 10.1128/IAI.01951-06.CrossRefPubMedPubMedCentral
38.
Zurück zum Zitat Rizzato C, Torres J, Plummer M, Munoz N, Franceschi S, Camorlinga-Ponce M, Fuentes-Panana EM, Canzian F, Kato I: Variations in Helicobacter pylori cytotoxin-associated genes and their influence in progression to gastric cancer: implications for prevention. PLoS One. 2012, 7: e29605-10.1371/journal.pone.0029605.CrossRefPubMedPubMedCentral Rizzato C, Torres J, Plummer M, Munoz N, Franceschi S, Camorlinga-Ponce M, Fuentes-Panana EM, Canzian F, Kato I: Variations in Helicobacter pylori cytotoxin-associated genes and their influence in progression to gastric cancer: implications for prevention. PLoS One. 2012, 7: e29605-10.1371/journal.pone.0029605.CrossRefPubMedPubMedCentral
39.
Zurück zum Zitat Green MR, Sambrook J: Molecular cloning: a laboratory manual. 2012, Cold Spring Harbor Laboratory Press, New York Green MR, Sambrook J: Molecular cloning: a laboratory manual. 2012, Cold Spring Harbor Laboratory Press, New York
40.
Zurück zum Zitat Roman-Roman A, Giono-Cerezo S, Camorlinga-Ponce M, Martinez-Carrillo DN, Loaiza-Loeza S, Fernandez-Tilapa G: vacA genotypes of Helicobacter pylori in the oral cavity and stomach of patients with chronic gastritis and gastric ulcer. Enferm Infecc Microbiol Clin. 2013, 31: 130-5. 10.1016/j.eimc.2012.09.002.CrossRefPubMed Roman-Roman A, Giono-Cerezo S, Camorlinga-Ponce M, Martinez-Carrillo DN, Loaiza-Loeza S, Fernandez-Tilapa G: vacA genotypes of Helicobacter pylori in the oral cavity and stomach of patients with chronic gastritis and gastric ulcer. Enferm Infecc Microbiol Clin. 2013, 31: 130-5. 10.1016/j.eimc.2012.09.002.CrossRefPubMed
41.
Zurück zum Zitat Argent RH, Zhang Y, Atherton JC: Simple method for determination of the number of Helicobacter pylori CagA variable-region EPIYA tyrosine phosphorylation motifs by PCR. J Clin Microbiol. 2005, 43: 791-5. 10.1128/JCM.43.2.791-795.2005.CrossRefPubMedPubMedCentral Argent RH, Zhang Y, Atherton JC: Simple method for determination of the number of Helicobacter pylori CagA variable-region EPIYA tyrosine phosphorylation motifs by PCR. J Clin Microbiol. 2005, 43: 791-5. 10.1128/JCM.43.2.791-795.2005.CrossRefPubMedPubMedCentral
42.
Zurück zum Zitat Schmidt HM, Goh KL, Fock KM, Hilmi I, Dhamodaran S, Forman D, Mitchell H: Distinct cagA EPIYA motifs are associated with ethnic diversity in Malaysia and Singapore. Helicobacter. 2009, 14: 256-63. 10.1111/j.1523-5378.2009.00684.x.CrossRefPubMed Schmidt HM, Goh KL, Fock KM, Hilmi I, Dhamodaran S, Forman D, Mitchell H: Distinct cagA EPIYA motifs are associated with ethnic diversity in Malaysia and Singapore. Helicobacter. 2009, 14: 256-63. 10.1111/j.1523-5378.2009.00684.x.CrossRefPubMed
43.
Zurück zum Zitat Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011, 28: 2731-9. 10.1093/molbev/msr121.CrossRefPubMedPubMedCentral Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011, 28: 2731-9. 10.1093/molbev/msr121.CrossRefPubMedPubMedCentral
44.
Zurück zum Zitat Queiroz DM, Silva CI, Goncalves MH, Braga-Neto MB, Fialho AB, Fialho AM, Rocha GA, Rocha AM, Batista SA, Guerrant RL, Lima AA, Braga LL: Higher frequency of cagA EPIYA-C phosphorylation sites in H. pylori strains from first-degree relatives of gastric cancer patients. BMC Gastroenterol. 2012, 12: 107-10.1186/1471-230X-12-107.CrossRefPubMedPubMedCentral Queiroz DM, Silva CI, Goncalves MH, Braga-Neto MB, Fialho AB, Fialho AM, Rocha GA, Rocha AM, Batista SA, Guerrant RL, Lima AA, Braga LL: Higher frequency of cagA EPIYA-C phosphorylation sites in H. pylori strains from first-degree relatives of gastric cancer patients. BMC Gastroenterol. 2012, 12: 107-10.1186/1471-230X-12-107.CrossRefPubMedPubMedCentral
45.
Zurück zum Zitat Paniagua GL, Monroy E, Rodriguez R, Arroniz S, Rodriguez C, Cortes JL, Camacho A, Negrete E, Vaca S: Frequency of vacA, cagA and babA2 virulence markers in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis. Ann Clin Microbiol Antimicrob. 2009, 8: 14-10.1186/1476-0711-8-14.CrossRefPubMedPubMedCentral Paniagua GL, Monroy E, Rodriguez R, Arroniz S, Rodriguez C, Cortes JL, Camacho A, Negrete E, Vaca S: Frequency of vacA, cagA and babA2 virulence markers in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis. Ann Clin Microbiol Antimicrob. 2009, 8: 14-10.1186/1476-0711-8-14.CrossRefPubMedPubMedCentral
46.
Zurück zum Zitat Azuma T, Ohtani M, Yamazaki Y, Higashi H, Hatakeyama M: Meta-analysis of the relationship between CagA seropositivity and gastric cancer. Gastroenterology. 2004, 126: 1926-7. 10.1053/j.gastro.2004.04.049. author reply 1927–1928CrossRefPubMed Azuma T, Ohtani M, Yamazaki Y, Higashi H, Hatakeyama M: Meta-analysis of the relationship between CagA seropositivity and gastric cancer. Gastroenterology. 2004, 126: 1926-7. 10.1053/j.gastro.2004.04.049. author reply 1927–1928CrossRefPubMed
47.
Zurück zum Zitat Kumar S, Kumar A, Dixit VK: Diversity in the cag pathogenicity island of Helicobacter pylori isolates in populations from North and South India. J Med Microbiol. 2010, 59 (Pt 1): 32-40. 10.1099/jmm.0.013763-0.CrossRefPubMed Kumar S, Kumar A, Dixit VK: Diversity in the cag pathogenicity island of Helicobacter pylori isolates in populations from North and South India. J Med Microbiol. 2010, 59 (Pt 1): 32-40. 10.1099/jmm.0.013763-0.CrossRefPubMed
48.
Zurück zum Zitat Batista SA, Rocha GA, Rocha AM, Saraiva IE, Cabral MM, Oliveira RC, Queiroz DM: Higher number of Helicobacter pylori CagA EPIYA C phosphorylation sites increases the risk of gastric cancer, but not duodenal ulcer. BMC Microbiol. 2011, 11: 61-10.1186/1471-2180-11-61.CrossRefPubMedPubMedCentral Batista SA, Rocha GA, Rocha AM, Saraiva IE, Cabral MM, Oliveira RC, Queiroz DM: Higher number of Helicobacter pylori CagA EPIYA C phosphorylation sites increases the risk of gastric cancer, but not duodenal ulcer. BMC Microbiol. 2011, 11: 61-10.1186/1471-2180-11-61.CrossRefPubMedPubMedCentral
49.
Zurück zum Zitat Acosta N, Quiroga A, Delgado P, Bravo MM, Jaramillo C: Helicobacter pylori CagA protein polymorphisms and their lack of association with pathogenesis. World J Gastroenterol. 2010, 16: 3936-43. 10.3748/wjg.v16.i31.3936.CrossRefPubMedPubMedCentral Acosta N, Quiroga A, Delgado P, Bravo MM, Jaramillo C: Helicobacter pylori CagA protein polymorphisms and their lack of association with pathogenesis. World J Gastroenterol. 2010, 16: 3936-43. 10.3748/wjg.v16.i31.3936.CrossRefPubMedPubMedCentral
50.
Zurück zum Zitat Torres LE, Gonzalez L, Melian K, Alonso J, Moreno A, Hernandez M, Reyes O, Bermudez L, Campos J, Perez-Perez G, Rodríguez BL: EPIYA motif patterns among Cuban Helicobacter pylori CagA positive strains. Biomedica. 2012, 32: 23-31.PubMed Torres LE, Gonzalez L, Melian K, Alonso J, Moreno A, Hernandez M, Reyes O, Bermudez L, Campos J, Perez-Perez G, Rodríguez BL: EPIYA motif patterns among Cuban Helicobacter pylori CagA positive strains. Biomedica. 2012, 32: 23-31.PubMed
51.
Zurück zum Zitat Kersulyte D, Kalia A, Gilman RH, Mendez M, Herrera P, Cabrera L, Velapatino B, Balqui J, Paredes Puente dela Vega F, Rodriguez Ulloa CA, Cok J, Hooper CC, Dailide G, Tamma S, Berg DE: Helicobacter pylori from Peruvian amerindians: traces of human migrations in strains from remote Amazon, and genome sequence of an Amerind strain. PLoS One. 2010, 5: e15076-10.1371/journal.pone.0015076.CrossRefPubMedPubMedCentral Kersulyte D, Kalia A, Gilman RH, Mendez M, Herrera P, Cabrera L, Velapatino B, Balqui J, Paredes Puente dela Vega F, Rodriguez Ulloa CA, Cok J, Hooper CC, Dailide G, Tamma S, Berg DE: Helicobacter pylori from Peruvian amerindians: traces of human migrations in strains from remote Amazon, and genome sequence of an Amerind strain. PLoS One. 2010, 5: e15076-10.1371/journal.pone.0015076.CrossRefPubMedPubMedCentral
52.
Zurück zum Zitat Sgouras DN, Panayotopoulou EG, Papadakos K, Martinez-Gonzalez B, Roumbani A, Panayiotou J, VanVliet-Constantinidou C, Mentis AF, Roma-Giannikou E: CagA and VacA polymorphisms do not correlate with severity of histopathological lesions in Helicobacter pylori-infected Greek children. J Clin Microbiol. 2009, 47: 2426-34. 10.1128/JCM.00159-09.CrossRefPubMedPubMedCentral Sgouras DN, Panayotopoulou EG, Papadakos K, Martinez-Gonzalez B, Roumbani A, Panayiotou J, VanVliet-Constantinidou C, Mentis AF, Roma-Giannikou E: CagA and VacA polymorphisms do not correlate with severity of histopathological lesions in Helicobacter pylori-infected Greek children. J Clin Microbiol. 2009, 47: 2426-34. 10.1128/JCM.00159-09.CrossRefPubMedPubMedCentral
53.
Zurück zum Zitat Furuta Y, Yahara K, Hatakeyama M, Kobayashi I: Evolution of cagA oncogene of Helicobacter pylori through recombination. PLoS One. 2011, 6: e23499-10.1371/journal.pone.0023499.CrossRefPubMedPubMedCentral Furuta Y, Yahara K, Hatakeyama M, Kobayashi I: Evolution of cagA oncogene of Helicobacter pylori through recombination. PLoS One. 2011, 6: e23499-10.1371/journal.pone.0023499.CrossRefPubMedPubMedCentral
54.
Zurück zum Zitat Ishikawa S, Ohta T, Hatakeyama M: Stability of Helicobacter pylori CagA oncoprotein in human gastric epithelial cells. FEBS Lett. 2009, 583: 2414-8. 10.1016/j.febslet.2009.06.043.CrossRefPubMed Ishikawa S, Ohta T, Hatakeyama M: Stability of Helicobacter pylori CagA oncoprotein in human gastric epithelial cells. FEBS Lett. 2009, 583: 2414-8. 10.1016/j.febslet.2009.06.043.CrossRefPubMed
55.
Zurück zum Zitat Ferlay J, Shin H, Bray F, Forman D, Mathers C, Parkin D: GLOBOCAN 2008 v2.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 10 [Internet]. Lyon, France: International Agency for Research on Cancer; 2010. Available from: http://globocan.iarc.fr. Ferlay J, Shin H, Bray F, Forman D, Mathers C, Parkin D: GLOBOCAN 2008 v2.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 10 [Internet]. Lyon, France: International Agency for Research on Cancer; 2010. Available from: http://​globocan.​iarc.​fr.
56.
Zurück zum Zitat Tarkhashvili N, Chakvetadze N, Mebonia N, Chubinidze M, Bakanidze L, Shengelidze V, Mirtskhulava M, Chachava T, Katsitadze G, Gabunia U, Kordzaia D, Imnadze P, Guarner J, Sobel J: Traditional risk factors for Helicobacter pylori infection not found among patients undergoing diagnostic upper endoscopy-Republic of Georgia, 2007–2008. Int J Infect Dis. 2012, 16: e697-702. 10.1016/j.ijid.2012.05.1031.CrossRefPubMed Tarkhashvili N, Chakvetadze N, Mebonia N, Chubinidze M, Bakanidze L, Shengelidze V, Mirtskhulava M, Chachava T, Katsitadze G, Gabunia U, Kordzaia D, Imnadze P, Guarner J, Sobel J: Traditional risk factors for Helicobacter pylori infection not found among patients undergoing diagnostic upper endoscopy-Republic of Georgia, 2007–2008. Int J Infect Dis. 2012, 16: e697-702. 10.1016/j.ijid.2012.05.1031.CrossRefPubMed
57.
Zurück zum Zitat Wu Y, Fan Y, Jiang Y, Wang Y, Liu H, Wei M: Analysis of risk factors associated with precancerous lesion of gastric cancer in patients from eastern China: a comparative study. J Cancer Res Ther. 2013, 9: 205-9. 10.4103/0973-1482.122522.CrossRefPubMed Wu Y, Fan Y, Jiang Y, Wang Y, Liu H, Wei M: Analysis of risk factors associated with precancerous lesion of gastric cancer in patients from eastern China: a comparative study. J Cancer Res Ther. 2013, 9: 205-9. 10.4103/0973-1482.122522.CrossRefPubMed
Metadaten
Titel
The EPIYA-ABCC motif pattern in CagA of Helicobacter pyloriis associated with peptic ulcer and gastric cancer in Mexican population
verfasst von
Fredy Omar Beltrán-Anaya
Tomás Manuel Poblete
Adolfo Román-Román
Salomón Reyes
José de Sampedro
Oscar Peralta-Zaragoza
Miguel Ángel Rodríguez
Oscar del Moral-Hernández
Berenice Illades-Aguiar
Gloria Fernández-Tilapa
Publikationsdatum
01.12.2014
Verlag
BioMed Central
Erschienen in
BMC Gastroenterology / Ausgabe 1/2014
Elektronische ISSN: 1471-230X
DOI
https://doi.org/10.1186/s12876-014-0223-9

Weitere Artikel der Ausgabe 1/2014

BMC Gastroenterology 1/2014 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.