Background
Colorectal cancer is the 3rd most common cancer and ranks 4th among the dominant killer cancers worldwide [
1,
2]. Epigenetic regulation is widely reported to modulate the aetiology and pathogenesis of CRC [
3], and histone methyltransferase has a major role in these processes. For example, as a member of Polycomb repressive complex 2 (PRC2), enhancer of zeste homolog 2 (EZH2) has been found to have a prominent function in colorectal cancer tumourigenesis [
4,
5]. However, in many cases, the role of histone demethylase in tumourigenesis still remains unclear, especially with regards to CRC. The interaction between active and inhibitory histone modifications determines gene expression. Generally, the trimethylation of histone H3 lysine 27 (H3K27me3) suppresses gene expression, while the trimethylation of histone H3 lysine 4 (H3K4me3) activates genes expression [
6]. In mammalian cells, UTX is one of the primary enzymes that catalyse the demethylation of H3K27me3, a histone marker associated with actively transcribed regions [
7], and is generally a tumour suppressor [
8]. However, studies have revealed that UTX expression can enhance the proliferation of breast cancer cells [
9], although it remains unclear whether and how UTX influences the development of CRC. The primary objective of this study was to determine the role of UTX in tumourigenesis of colorectal cancer and explore its regulatory mechanisms to provide a potential new target for the treatment of colorectal cancer.
KIF14 expression was shown to promote the proliferation of colorectal cancer cells. KIF14 belongs to the kinesin superfamily (KIFs). The proteins are a conserved type of essential molecular motors that are microtubule-dependent and transport transcripts, proteins and organelles while utilizing ATP [
10,
11]. At present, at least 45 mammalian KIFs are known and have been classified in 14 separate families [
12]. KIF14 is an N-type kinesin of the kinesin-3 superfamily [
13,
14] and binds chromatin and microtubules when the bipolar spindle is formed [
15‐
17]. The cell cycle is altered when KIF14 is silenced, thus explaining the role of KIF14 in oncogenesis [
17]. The expression level of KIF14 has been reported to be increased in many tumour types, such as glioma, lung cancer, hepatocellular carcinoma, ovarian cancer, breast cancer, and laryngeal carcinoma [
17‐
23], compared to normal tissues. Recently, KIF14 was found to promote cell proliferation via the activation of AKT in colorectal cancer [
24].
Here, we reported that UTX expression was elevated in human colorectal cancer and enhanced CRC cell proliferation by promoting the expression of KIF14. Knockdown of UTX inhibited CRC cell proliferation both in vitro and in vivo. Therefore, our studies emphasize that inhibition of UTX activity can be a new strategy for CRC treatment.
Materials and methods
Analysis of human specimens
Colorectal cancer specimens were obtained from patients who underwent surgery from 2008 to 2013 in the Shanghai Ninth People's Hospital. None of the patients underwent preoperative chemotherapy or radiation therapy prior to surgery. The study protocol was approved by the ethics committee of the Shanghai Ninth People's Hospital (SH9H-2018-A662-1). In the follow-up of 206 cases, 155 cases returned and 51 cases were lost to follow-up. The actual follow-up rate was 75.24%. From the specimen library, 30 patients with paracancerous tissues were used to assess UTX expression in tumour tissues compared with the normal counterparts. Eighty-seven patients with staging formation were chosen to analyse UTX expression in different stages of colorectal cancer. Dukes staging was used in our study. Tissue microarrays used in this study included 105 CRC specimens with survival information grouped according to the UTX expression level. The scoring method of the tissue microarray has been described in “
Materials and methods” section in red. Fundamentally, the quantification method was a multiplicative index of staining proportion and staining extent in the cores confirmed by two independent pathologists. Scores ≥ 2 were considered to be high levels of UTX, while scores < 2 were considered to be low levels of UTX.
Immunohistochemical (IHC) analysis
For colorectal cancer patient samples and mouse tumour-forming tissue samples, we first performed paraffin embedding. Immunohistochemical staining was performed on 4-μm sections of paraffin-embedded tissues to determine the expression level of UTX protein. In brief, the slides were incubated in UTX (33510, CST) and KIF14 antibody (ab71155, Abcam) and diluted 1:200 at 4 °C overnight. Haematoxylin staining was performed to identify nuclei. Images were acquired using a Leica DM 4000B microscope.
Extraction of RNA and q-PCR
We extracted total RNA using RNAiso Plus reagent (TaKaRa), and 1.0 µg RNA was subjected to reverse transcription using a RT-PCR kit (Perfect Real Time, TaKaRa) as instructed by the manufacturer. An ABI-7500 Fast Real-Time PCR Detection System was used to perform all qRT-PCR experiments. GAPDH was used as a control to normalize the amplified transcript level of each indicated gene. The primers used were as follows:
UTX
F: GAACAGCTCCGCGCAAATAG
R: CGTACCTGTGCAACTCCTGT
GAPDH
F: TCTGATTTGGTCGTATTGGG
R: GGAAGATGGTGATGGGATT
CCK-8 assay
We performed the CCK-8 assay using a CCK-8 kit (Dojindo, Japan) as instructed by its manufacturer. In short, we seeded a total of 2000 cells into each well in a 96-well plate. We then added 10 µl CCK-8 solution to each well and incubated the cells for 2–4 h in the incubator. We measured the absorbance at 450 nm of the plate using a microplate reader.
We seeded 1000 cells into one well of 6-well plates. Crystal Violet Staining Solution (Beyotime C0121) was used to stain the cells after 10 days. Then, we counted colonies containing ≥ 20 cells.
Flow cytometry
We seeded 1 × 105 stable UTX knockdown and control cells into a six-well plate, and the cells were later harvested after 48 h and subjected to flow cytometry. Cell cycle analysis was performed with the Cell Light Edu Kit (C10338: Ruibo) as instructed by the manufacturer.
Tumourigenesis assay
We injected 0.2 ml from medium of lentivirally transduced HCT116 cells (1–3 × 106) subcutaneously into the right armpits of the nude mice. We then evaluated the size of the tumour after 3 days and used the formula V = 1/2(a * b * b) to calculate tumour volume, where a and b denote the major and minor tumour axis, respectively. The tumour weight was quantified 3 to 4 weeks after injection when the mice were killed. We strictly followed the European Community guidelines for the use of experimental animals (86/609/EEC) when handling the experimental animals.
Immunoblotting assay
Cells were lysed using a loading lysis buffer. Lowry protein assays were used to calculate protein concentration. Then, we separated 30 μg of protein lysate using SDS-PAGE analysis. The protein was transferred to a PVDF membrane (Immobilon P; Millipore, Milford, MA). The indicated protein was detected by immunoblotting with specific antibodies in 5% albumin from bovine serum. The antibody used were as follows: UTX (33510, CST), KIF14 (ab71155, Abcam), pAKT S473 (4501, CST), pAKT T308 (4506, CST), AKT (4658, CST), and P21 (2947, CST).
Statistical analysis
All of the results were repeated at least thrice except when indicated otherwise. The mean ± SEM of repeats was used to represent the data. To compare the differences between groups, 2-tailed paired Student’s t-test was applied. We then used Pearson’s correlation test to determine the correlation between UTX and KIF14 in human tissues. Log-rank tests were used to calculate the Kaplan–Meier survival curve comparison. We did not exclude any material or data in the study when doing the statistical analysis.
Discussion
KIF14 is upregulated in multiple types of tumours and act as an oncogene. Sustained high expression promotes tumour cell proliferation [
17‐
23]. Therefore, the specific targeting of KIF14 to inhibit tumour cell proliferation can be used to yield therapeutic benefits. Here, we showed that UTX is highly expressed in CRC cells, and the expression level of UTX was positively correlated with the degree of progression of CRC. UTX expression served as an independent predictor for risk stratification of overall survival in CRC patients. Knockdown of UTX inhibited CRC cell proliferation and caused cell cycle arrest at the G0/G1 phase by downregulating the expression of KIF14 and pAKT. Therefore, UTX can be a new diagnostic biomarker and a potential therapeutic target in the management of CRC.
So far, there have been few reports on the role of UTX in cancer [
8]. Most studies suggest that UTX is a tumour suppressor gene, and there are reports that UTX can promote tumourigenesis [
9]. The function of UTX in colorectal cancer has not yet been elucidated. Only one study showed that UTX can induce E-cad and promote colorectal cancer metastasis [
25]. Nevertheless, we observed that the morphology of CRC cell lines after UTX knockdown did not change significantly, but the cell growth was significantly slower in our study. The mechanism of UTX regulation of colorectal cancer cell proliferation in this study also has some shortcomings. Although we found that the expression of KIF14 was regulated by UTX, ChIP experiments showed that there was no obvious H3K27me3 enrichment in the promoter region of KIF14, indicating that KIF14 is indirectly regulated by UTX. Thus, identification of a key gene, which is directly regulated by UTX, that regulates KIF14 expression, further exploration is still needed.
Furthermore, UTY, a homologous gene of UTX, has been considered to have no demethylase activity, but recent studies have shown that UTY can partially compensate for UTX demethylase activity in UTX knockout mice [
26]. Therefore, considering the difference in incidence of colorectal cancer between different sexes, it is important to study the role of UTY in colorectal cancer. Whether UTY also promotes the development of colorectal cancer by participating in the regulation of KIF14 expression requires further research. At the same time, the role of JMJD3, which is the same as UTX in the demethylation of H3K27, in colorectal cancer is still unclear. The mutual compensatory effects of the two enzymes in the pathogenesis of colorectal cancer also require further study.
In summary, we first reported the high expression of UTX in colorectal cancer and found its regulation of KIF14 expression. The relevance of this regulation in the aetiology and the pathogenesis of CRC yields a new view on how epigenetics and tumourgenesis are related. Inhibition of colorectal cancer cell proliferation by inhibiting UTX enzyme activity may be a potential new therapeutic strategy that can be used for the benefit of patients with CRC.
Conclusions
In summary, we demonstrated that UTX is highly expressed in CRC cells, and the expression of UTX is positively correlated with the degree of progression of CRC. Patients with CRC that express high levels of UTX have shorter survival. Knockdown of UTX inhibited CRC cell proliferation and caused cell cycle arrest at G0/G1 phase by downregulating the expression of KIF14 and pAKT. Therefore, UTX can serve as both a new diagnostic biomarker and a potential target for CRC therapy.
Authors’ contributions
XT and JS made substantial contributions to the conception and design. WC, JC, PL, SM, CY, YS, CW and YW acquired data. XL and PH analysed and interpreted data. All authors read and approved the final manuscript.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.