Background
Nuclear factor-κB (NF-κB) regulates many cellular functions including cell proliferation, apoptosis, angiogenesis, immune response, cell adhesion and differentiation [
1]. The signal pathway involved by NF-κB plays important roles in linking inflammation to tumor development and progression [
2]. NF-κB family contains five members in mammals: NFKB1 encoding p50, NFKB2 encoding p52, RELA encoding p65, REL encoding c-Rel, and RELB encoding Rel-B. The most common dimer is the p65/p50 heterodimer, which is inhibited by IκB in the cytosol [
3]. Internal gene mutations and external stimuli contribute to the release of activated NF-κB [
4]. The elevated NF-κB levels have been reported to be associated with cancers [
5-
7].
Rs4648068 polymorphism locates at NFKB1 promoter region. Polymorphisms in the regulatory regions of the genes have been associated with variation in gene expression [
8,
9]. The rs4648068 polymorphism is hypothesized to have a significant effect on NF-κB1 expression and play a part in tumorigenicity.
In the previous case–control study, we have demonstrated the role of NFKB1 rs4648068 polymorphisms in gastric cancer susceptibility in Chinese Han population. The results further indicated that the subjects with the allelic homozygous GG in rs4648068 had an increased risk in gastric cancer group compared with that in controls (
P = 0.005) [
10]. However, the motility-promoting function of this single nucleotide polymorphism (SNP) site in gastric cancer progression is still uncertain. To clarify the functional mechanisms of NFKB1 rs4648068 polymorphism, it is necessary to investigate the changes of NF-κB1 expression at cellular and molecular levels. Accordingly, the polymorphism rs4648068 might play a role in the development of gastric cancer.
In this study, we constructed the recombinant plasmids, containing the different SNP variants to investigate the changes on transcriptional activity of NFKB1. Additionally, the growth and invasion alteration of transduced cells was observed to further demonstrate the biological function of rs4648068 in gastric cancer.
Methods
Patients’ samples and cell lines
In previous study, we conducted a large-scale case–control study on Chinese Han population to investigate the association of rs4648068 polymorphism with gastric cancer or clinic-pathologic variables of gastric cancer patients. To further verify its function, the expression levels were measured with 20 tissues from gastric cancer patients using immunohistochemical staining. Meanwhile, the genomic DNA of these patients was collected to do genotyping. The study design was approved by the Clinical Research Ethics Committee of the Fudan University Shanghai Cancer Center. All of the participants signed informed consent documents prior to participating in this study. Paraffin-embedded gastric cancer tissue samples were collected from 20 patients with gastric cancer who were admitted to Fudan University Cancer Hospital (Shanghai, China) July 2014. All cases were gastric adenocarcinoma confirmed by pathologist. Only the patients whose clinical data (include diagnosis, age, sex, address, disease history, etc.) were intact were selected. The gastric carcinoma cell lines, SGC-7901 cells, MKN45 cells, HGC27 cells and the non-gastric cancer cell lines, 293 T, Hela cells, were generous gifts from Laboratory of Oncology, Fudan University Shanghai Cancer Center, Shanghai.
Sample preparation and NFKB1 genotyping
Genomic DNA was extracted from peripheral blood samples of each study subject using the TIANamp Blood DNA Kit (Tiangen Biotech, China). NFKB1 SNPs rs4648068 were genotyped by SYBR allelic discrimination. The corresponding qRT-PCR specific primers pGL3-RTp1, pGL3-RTp2 and pGL3-RTp3 are listed in Table
1. PCRs were run in a 10 μL reaction solution containing 30 ng of template DNA, 5 μL SYBR Premix Ex Taq (TAKARA, Japan) according to the manual. PCR was performed at 95°C for 10 min and 40 cycles at 95°C for 30 s and 58°C for 30 s. The samples were amplified, read and analyzed in Option® Fluorescence Temperature Cycler (MJ Research, Canada).
Table 1
Primers used in this study
pGL3-RTp1 | 5′ TAA TTG TTA GAG ATT CCA A 3′ | |
pGL3-RTp2 | 5′ TAA TTG TTA GAG ATT CCA G 3′ | |
pGL3-RTp3 | 5′ ACA ATG TTA GAT TTT ACC ATG ATT 3′ | |
pGL-promoterFor1 | 5′GGGGTACCGGTCATCCTAGATCGTACTAAG3′ | KpnI |
pGL-promoterFor2 | 5′GGGGTACCATAAAAGAAGAGAGTGCTGGAG3′ | KpnI |
pGL-promoterRev | 5′GAAGATCTCCTTGACATATCATTTTAGTTG3′ | BglII |
pGL-NFKBFor | 5′GAAGATCTATGACGCCCTTGCACTTGGCAGTGA3′ | BglII |
pGL-NFKBRev | 5′GAAAGCTTTTAGCTGCTTTGAGAAGAGCT3′ | HindIII |
Immunohistochemical staining
Immunohistochemical staining was performed on 6-μm sections from formalin-fixed, paraffin-embedded human tissues. The slides were deparaffinized and rehydrated ingraded ethanol solutions. Antigen retrieval was performed by heating the samples for 20 min in citrate buffer (pH 6.0). The slides were then incubated with a rabbit anti-NF-κB p50 polyclonal antibody (1:100 dilution; ab7971, Abcam) overnight at 4°C. Tissue sections were washed again in PBS and incubated with horseradish peroxidase-conjugated secondary antibodies for 60 min at 37°C. Color was developed using diaminobenzidine as a chromogen and the slides were counterstained with hematoxylin.
Evaluation of immunohistochemical staining results
The NF-κB1 positive tissues were quantified based on the percentage of positive cells which were serially counted in one microscopic field. The cell counting was repeated in five random microscopic fields at × 400 magnification. Two pathologists who were blinded to patient group independently interpreted the IHC staining results using positive index (PI). The positive index (PI) was calculated using the following formulation:
PI = i × p, where
i is intensity of staining (0 for negative, blue; 1 for weakly-positive, light yellow; 2 for medium positive, yellow; 3 for strong positive, brown), and
p is positive percentage of staining (1 for ≦10%; 2 for 11%-50%; 3 for 51%-75%; 4 for >75%) [
11]. Then, the positive index (PI) was calculated for each case. If there were divergences in the PI determined by the two pathologists, slides were rescored until a consensus was reached. Besides, differences in NF-kappaB1 expression between different groups were investigated using Kruskal-Wallis non-parametric test.
The construction of recombinant plasmid
The section containing NFKB1 promoter region with polymorphisms rs4648068 was obtained by PCR using primers pGL-promoterFor1 and pGL-promoterRev (Table
1). DNA templates were extracted from peripheral blood samples of gastric cancer patients using the method described above. The PCR products containing NFKB1 polymorphisms were digested by Bgl II and Kpn I and linked into the vector pGL3-basic (Promega, Madison, WI) to construct recombinant plasmid pGL3-AA and pGL3-GG. Meanwhile, pGL3-GG/TT containing rs4648065 site was established as above described method to investigate the co-effect on rs4648068. Furthermore, the sequence coding selected section of NF-κB1 was amplified to construct the NF-kappaB expression plasmid according to the human NF-κB neclotides sequences (NM_001165412.1) in GenBank. The CDS region containing adjacent three consecutive exons was amplified using pGL-NFKBFor and pGL-NFKBRev (Table
1), subcloned into pGL3-AA and pGL3-GG, named as pGL3-AA-NFKB and pGL3-GG-NFKB respectively, while the random DNA fragments and above PCR products was subcloned into the vector pGL3-basic to construct recombinant plasmid pGL3-mock. The recombinant plasmids pGL3-AA and pGL3-GG were constructed for luciferase assay, while the expression plasmids pGL3-AA-NFKB and pGL3-GG-NFKB were constructed for cell biological experiment. Non-gastric cell lines such as 293 T cells and Hela cells, gastric cancer cell lines such as MKN45 cells, HGC27 cells and SGC7901, were transfected with pGL3-AA and pGL3-GG using Lipofectamine 2000 (Invitrogen) respectively to verify the transcriptional activity of NFKB1 promoter. The expression plasmids were also transfected into SGC7901 cells, designated as 7901-pGL3-mock, 7901-pGL3-AA, and 7901-pGL3-GG. The PCR reactions were carried out at 94°C for 2 min, then a 3-step cycle procedure was used (denaturation at 94°C for 30s, annealing at 57.3°C for 40 s, and elongation at 70°C for 3.5 min) for 39 cycles, with a final extension at 72°C for 10 min.
Transfection and luciferase assay
The luciferase assay is one of the most convenient reporter assays to explore the regulation of gene expression in mammalian cell culture. The pGL3-basic vector only has the luciferase gene and lacks regulatory regions, such as promoter sequences. This vector is useful in the study of functional promoter elements to regulate gene expression. Renilla luciferase pRL-SV40 vector was used to normalize and reduce differences in transfection efficiencies and subsequent variations in these experiments.
For our luciferase assays, approximately 7 × 104 of SGC-7901 cells were cultured in a 24-well plate in antibiotic-free media. After attachment, cells were co-transfected with recombinant plasmids and pRL-SV40 vector by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Other cell lines, such as 293 T cells, Hela cells, MKN45 cells and HGC27 cells, were transfected with these plasmids by the same method. LPS (100 ng/mL) was added into wells of stimulation group 24 h later. After 48 h incubation with cell culture media, then cells were lysed in passive lysis buffer (Promega, Wisconsin, USA). Firefly and Renilla luciferase signals were measured by the Dual-Luciferase® Reporter Assay System (Promega, Wisconsin, USA) in Synergy H4 Hybrid Microplate Reader (BioTek, Winooski, USA). Relative luciferase activity (Luc) calculated by the ratio of Firefly and Renilla luciferase signals was used to monitor the efficiency of transfection.
Chromatin immunoprecipitation
Five million SGC-7901 cells were cross-linked with 1% formaldehyde at room temperature for 10 min. Chromatin extracts were obtained by cell lysis buffer. Sonication was performed 14 times for 4.5 s each at Power 25% (Thermo™, Ultrasonic Cell Disruptor, Model XL) resulting in DNA fragments between 150 and 1000 bp in size. Supernatants were collected and submitted to immunoprecipitation with 5 μg of rabbit anti-C/EBPβ polyclonal antibody (sc-150X, Santa Cruz Biotechnology) and 20 μl of magnetic protein A/G beads (Magna ChIP™ A/G, Millipore, USA) overnight at 4°C. In parallel, supernatants were incubated with normal rabbit IgG antibody as negative controls. Protein A/G magnetic beads were washed and pelleted by magnetic separator, and heated in ChIP Elution Buffer with Proteinase K at 65°C for 2 hours to reverse the cross-links of protein/DNA complexes. DNA fragments were purified on offered Spin columns. Finally, 4 μl from a 30 μl extraction were PCR amplified for NFKB1 promoter genes using the primers pGL-promoterFor1 and pGL-promoterRev (Table
1).
Western blot analysis
The rabbit anti-p50, anti-GAPDH antibody and the secondary antibody were purchased from Abcam (Cambridge, MA, USA). The C/EBPβ polyclonal antibody was purchased from Santa Cruz Biotechnology (Santa Cruz Biotechnology, CA, USA). Cultured cells were washed with phosphate-buffered saline and lysed on ice for 30 min with 500 μL lysis buffer (Beyotime, China). The cell lysate was centrifuged at 4°C at 10,000 × g for 15 min. The supernatant nuclear protein was used for Western blot. Twenty micrograms of cell extracts was loaded into 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to Western blot. GAPDH was used as the internal control. Enhanced chemiluminescence detection was performed according to the manufacturer’s instructions using X-photo film (Alpha Innotech, San Leandro, CA) and chemiluminescent substrate (Thermo Scientific, Rockford, IL).
Cell proliferation and invasion assay
For the cell proliferation assay, 7901-pGL3-mock, 7901-pGL3-AA and 7901-pGL3-GG cells were grown at a density of 7 × 104 cells/mL in 24-well plates with regular medium changes. The cell number was counted every 24 hours for 6 days as follows: cells were detached by brief exposure to 0.025% trypsin containing 2 mM EDTA in PBS, washed in culture medium without FBS, and then resuspended in the same medium for manual cell counting. For the invasion assays, matrigel was thawed at 4°C overnight, diluted in cold serum-free culture medium, plated onto 24-well plates preloaded with Transwell™ culture inserts (12 mm diameter, 8 μm pore size; Costar, Cambridge, MA, USA) and incubated for 5 h at 37°C for gelling. The cells were then plated onto the Transwell™ inserts (30,000 cells/well) and cultured at 37°C in 5%CO2. After 16 h, the cells on the upper side of the well were removed and fixed prior to staining with hematoxylin and eosin. Cells migrating to the underside were counted under a microscope. All experiments were repeated at least three times.
Apoptosis assay
SGC-7901 cells were transfected with pGL3-AA-NFKB and pGL3-GG-NFKB respectively. At 48 h after transfection, cells were collected and resuspended in binding buffer containing Annexin V-PE and PI (BD Pharmingen, La Jolla, CA). Cell-associated fluorescence was analyzed with a FACS can instrument and associated Winlist 5 software.
Statistical analysis
For immunohistochemistry PI of NF-κB1 expression, data were analyzed by Kruskal-Wallis non-parametric tests. The difference in the levels of luciferase reporter gene expression between different groups was determined by Student’s t test and One-way ANOVA analysis (SPSS version 13.0; SPSS Inc., Chicago). Differences between variants were considered significant at P < 0.05.
Discussion
Our previous study indicated that NFKB1 polymorphism at intron region (rs4648068) was associated with increased risk of gastric cancer in Chinese Han population. The present study focused on the investigation of NFKB1 transcriptional activity and biological function influenced by rs4648068 (A > G) polymorphism.
It was reported that NF-κB is constitutively activated in gastric carcinoma tissue [
12]. Kwon HC et al. [
13] demonstrated that the expression of NF-κB is increased in human gastric cancer tissue. The nuclear translocation of Rel A (used as a marker of NF-κB activation) was significantly greater in gastric cancer cells than in adjacent normal epithelial cells [
14]. Yamanaka et al. [
15] reported that gastric cancer patients with high levels of NF-κB expression had a lesser overall survival than patients with low levels of NF-κB. The evidence presented above suggested that NF-κB play an important role in the genesis and progression of gastric cancer. Moreover, immunohistochemical staining experiments were conducted to determine in-depth relationship between NF-κB1 expression and SNP site rs4648068. NF-κB1 p50 was found highly expressed in the homozygote GG group compared with the control group. It indicated that the functional site has effects on NFKB1 transcriptional activity and regulates its expression.
The luciferase assay is one of the techniques to study the regulation of gene expression in mammalian cell culture [
16,
17]. The transcriptional activity could be assessed by calculating the relative luciferase activity of plasmid transfected cells [
18]. For luciferase assays, our results showed that the transcriptional activity of NFKB1 was influenced by SNP rs4648068 at gene expression levels. Moreover, the effect on rs4648068 by rs4648065 was also observed at gene transcriptional activity. Our data suggested that rs4648068 GG may upregulate the expression of NFKB1, especially under the influence of rs4648065.
According to our data, the SNP rs4648068 can enhance the transcriptional activity of NFKB1, especially in LPS response. This indicated that the effect of NFKB1 rs4648068 could be influenced by LPS stimulation. Under the LPS stimulation, subsequent reaction occurs through toll-like receptor (TLR)-4-induced signal transduction, which then targets down-stream NF-κB pathway [
19]. The activation of NF-κB was affected by LPS stimulation [
20]. Similarly, the effect of polymorphism rs4648068 on NF-κB1 expression could be strengthened by LPS stimulation.
Liu et al. reported that various SNPs of cancer related genes are associated with a faster progression of cancers [
21]. Polymorphisms in the promoter regions of genes might potentially modulate the gene expression which in turn influence the cell biological activity [
18,
22]. CHIP assay provided evidence indicating that C/EBPβ can bind to the NFKB1 promoter containing the SNP site [
23], We considered that, C/EBPβ bound better to the GG version of NFKB1 promoter and enhanced the transcription of NFKB1, giving rise to the upregulated p50 expression. In addition, NF-κB1 p50 could bind C/EBPβ and reciprocally induce each other’s expression [
24], forming a transcriptional positive feedback loop. In fact, C/EBPβ was also confirmed upregulated in the homozygote GG group, accompanied with a higher level of NF-κB1. The mechanism for regulating C/EBPβ expression remains unclear, and will be performed in our future work. C/EBPβ:p50 interaction could induce target genes to influence the cell biological activity [
25]. Consequently, the SNP site rs4648068 might influence the cell biological activity by regulating NF-κB1 and C/EBPβ expression.
The NFKB1 polymorphism (rs4648068) was found associated with the cell proliferation and motility in gastric cancer in this study. For the proliferation and invasion assay, the result showed difference in biological activity between transfected cells and control cells. 7901-pGL3-GG cells showed increased ability of growth and invasion, compared with 7901-pGL3-AA cells. For the apoptosis assay, the percentage of apoptosis cells for 7901-pGL3-GG cells decreased significantly, compared with 7901-pGL3-AA cells. The finding suggested that SNP rs4648068 may play a role in regulating gastric cancer cell biological activity.
In this study, we have demonstrated that the NFKB1 polymorphism (rs4648068) is associated with the cell proliferation and motility in gastric cancer. The underlying cellular and molecular mechanisms involve related signaling pathway, such as NF-κB pathway and MAPK pathway. MAPK pathway, as well as NF-κB pathway, is considered the major signaling pathway induced by mediator such as LPS. In the MAPK family, p38 MAPK, c-JNK and ERKs are the most important components. The role of NFKB1 polymorphism (rs4648068) in the regulation of the gene described above should be further studied.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
RQL provided conception and design. YC analyzed the data and participated in drafting the manuscript. XG participated in clinical data and information collection. RX and HZ performed apoptosis assay. JJF collected all samples. LG conceived and supervised the project and reviewed the manuscript. All authors have read and approved the final manuscript.