Introduction
Brucella is a facultative anaerobic intracellular bacterium that causes brucellosis in human. Brucellosis is a contagious zoonotic disease, also known as undulant fever. The
Brucella infects human through direct or indirect contact with contaminated animal products (such as eating raw meat or unpasteurized dairy products) [
1]. It is mainly distributed in Central America, South America, Africa and Asia [
2]. It was listed as a class B infectious disease in China. Xinjiang is an agricultural region in northwest of China with abundant livestock products. The high morbidity percent of brucellosis is an average of 36.01 / 100,000 from 2014 to 2016 [
3].
Brucellosis patients have non-specific symptoms, such as fever, fatigue, hyperhidrosis, myalgia, and joint pain [
4]. Brucellosis can involve tissues and system but mainly affect joints and skeletal system [
5]. According to reports, spondylitis is the most frequent complication of brucellosis and primarily affects the lumbar and thoracic vertebrae [
6]. Back pain and sciatica are the most common complaints. In the existing environment, the diagnosis of brucellar spondylitis (BS) is still difficult. While blood culture of
Brucella are the high accuracy for diagnosis brucellosis, the false negative rate of this method is still high. Thus, clinicians usually combine clinical manifestations (lower back pain, etc.), serological examination (IgM/IgG antibody levels) and imaging examination to diagnose BS.
Chemokines as a superfamily of chemotactic cytokines play an important role in leukocyte chemotaxis.
Brucella infects the host will interfere with the host’s immune system and activate the function of immune cells [
7]. Naive CD4
+ T cells differentiate into T-helper type 1 (Th1) cells and T-helper type 2 (Th2). Th1 cells play a critical role against
Brucella by secreting interferon-gamma (IFN-γ), interleukin-6 (IL-6) and tumor necrosis factor (TNF). C-X-C motif chemokine receptor 3 (CXCR3) is a G protein-coupled receptor [
8]. IFN-γ can stimulate the production of ligands that induce CXCR3 [
9]. The activation and migration of lymphocytes / mononuclear macrophages were regulated by receptor-ligand interactions. This effect plays an important role in immune regulation, inflammation and infection. CXCR3 ligands include C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10).
In previous reports, BS caused serious damage to the body. High expression of IFN-γ has important clinical significance in brucellosis. Xu [
10] reported that the increased level of IFN-γ and TNF-α in the serum of patients with acute brucellosis. Freeman [
11] found that CXCR3 was significantly increased in severe chronic non-obstructive diseases. Pallett [
12] reported that the CXCR3 gene was amplified in severe hepatitis B cells. Most patients have mild symptoms after
Brucella infection, however, someone could recover after infection, while in others the spread of the infection causes severe brucellosis. With the development of infection, chemokines recruit a large number of inflammatory cells to the infection site. The infiltration of these inflammatory cells further aggravated the pathological damage. We analyzed the expression of CXCR3 and its ligands to explore the degree of inflammation damage in BS patients.
Materials and methods
Patients
This study is a descriptive observational. Patients diagnosed with BS were recruited in spine surgery at two hospitals in Xinjiang, Urumqi from 2015 to 2019. The study was approved by the ethics committee of Xinjiang Medical University. The patients were categorized as acute phase (with symptoms less than 3 months), subacute phase (3–6 months) and chronic phase (more than 6 months). The clinical symptoms and laboratory results were collected. The paravertebral cartilage tissue (include close and distant tissue) and peripheral blood of 29 BS patients were collected. 15 healthy controls were enrolled. The consent of patients was received at the same time. The data used to support the findings of this study are available from the corresponding author upon request.
The inclusion criteria of BS patients: 1. Patients have a history of contact with Brucella infected livestock or livestock products, consumption of raw meat and unpasteurized dairy products. 2. The patients have a persistent pain in the lower back, sacroiliac, fever, sweating, fatigue, or joint pain for days or even weeks. 3. Brucella was detected after one-week blood culture. 4. Tube agglutination test is positive. 5. Magnetic Resonance Imaging (MRI) reports that the adjacent surface of vertebra is destroyed, and there are hyperplasia and sclerosis. 6. Exclude patients with other immune, neoplastic diseases and HIV infection.
Specimens
BS tissue specimen (n = 29) and corresponding peripheral blood samples (n = 29) was obtained. All samples were collected at the close and distant normal tissues, by which tissues in vitro were washed in PBS (Boster, CN), and fixed in 4% paraformaldehyde (Beijing Chemical Works, CN) for 24–48 h. Then the tissues were decalcified in 10% EDTA decalcification solution for 21–30 days. The samples were then embedded in paraffin and sectioned transversely at 4 μm continuously to make parallel sections. Peripheral blood (3 ml) was drawn from each subject and treated with Ficoll-Hypaque Solution (Tianjin TBD, CN) to get peripheral blood mononuclear cells (PBMCs).
Hematoxylin-eosin (H&E) staining
H&E staining was performed according to routine procedure, including hematoxylin (Solarbio, CN) staining for 3 min, eosin (Solarbio, CN) staining for 2 min, 1% hydrochloric acid differentiation, ethanol gradient dehydration, neutral gum seal, and microscopic observation of histopathological changes.
Immunohistochemistry (IHC) staining
In short, sections, 4 μm thick, were deparaffinised and hydrated. After antigen retrieval, they were treated with primary antibody (Dilution ratio: Brucella-Ab, 1:200; IFN-γ, 1:100; CXCR3, 1:200; CXCL9, 1:200; CXCL10, 1:200) (Concentration: Brucella-Ab, 5 μg/ml; IFN-γ, 10 μg/ml; CXCR3, 5 μg/ml; CXCL9, 5 μg/ml; CXCL10, 5 μg/ml) (Beijin Bioss, CN) at appropriate dilution at 4 °C overnight. Sections were incubated with secondary antibody (Zhongshan Jinqiao, CN) for 1.5 h. Visualisation was performed with 3, 3′-diaminobenzidine (DAB) as substrate, applied for 1.5 min. Sections were counterstained with Hematoxylin. Antigen expression was analyzed under × 20 medium power lens. Positive signals were required to meet two criteria: irregular patchy dark brown granules; more than five clusters. IHC positive expression area was processed by Image J. The average optical density (AOD) obtained was the final processing results.
Real time PCR (RT-PCR)
Total RNA was extracted from the PBMCs by Trizol reagent (Invitrogen, USA). RNA quantity (> 80 ng/μl) and purity (OD260/OD280 = 1.8–2.0) were determined by nucleic acid quantifier. RNA was treated with DNase I (Takara, Japan) before reverse transcription to eliminate contaminating genomic DNA. cDNA was synthesized by reverse transcription according to the PrimeScript™ RT reagent Kit (Takara, Japan). The total amount of RNA was 3.75 μl. For RT-PCR, we mixed a 2 μl cDNA, 1 μl forward primers and 1 μl reverse primers (the final concentration of the primers was 10 μM.), 12.5 μl TB Green Premix Ex Taq (Takara, Japan) and 8.5 μl DEPC water. Thermal cycle parameters were: 95 °C for 30 s for 1 cycle, then 95 °C for 5 s, and 60 °C for 30 s for 39 cycles. Primer sequences are shown in Table
1. GAPDH was used as the internal control. The relative expression was calculated by the comparative cycle threshold method (2
-△△t).
IFN-γ |
Forward | CTAATTATTCGGTAACTGACTTGA | NM_000619.3 |
Reverse | ACAGTTCAGCCATCACTTGGA | |
CXCR3 |
Forward | ATGCGAGAGAAGCAGCCTTT | NM_001142797 |
Reverse | TCCTATAACTGTCCCCGCCA | |
CXCL9 |
Forward | GAAGCAGCCAAGTCGGTTAGTG | NM_002416.2 |
Reverse | AATCATCAGCAGTGTGAGCAGTG | |
CXCL10 |
Forward | TGGCATTCAAGGAGTACCTC | NM_001565.3 |
Reverse | TTGTAGCAATGATCTCAACACG | |
GAPDH |
Forward | CATCCACTGGTGCTGCCAAGGCTGT | NM_001289745.2 |
Reverse | ACAACCTGGTCCTCAGTGTAGCCCA | |
Enzyme-linked immuno sorbent assay (ELISA)
Serum levels of IFN-γ, CXCL9, CXCL10 (eBioscience, Austria) and autoantibodies against CXCR3 (CellTrend GmbH Luckenwalde, Germany), were detected in accordance with ELISA kit instructions. Standard wells, blank control wells and sample wells were set on 96-well plates. The diluted standard was added to the standard well, the sample dilution was added to the blank control well, and the test serum was added to the sample well. Then they were placed in 37 °C incubator for 60 min. After washing, color development and termination, the absorbance (A) was detected at a wavelength of 450 nm. For anti-CXCR-3-antibodies, the CXCR-3-receptor has been pre-coated onto a microtiter plate. During the first incubation the anti-CXCR-3-antibodies of the samples are immobilised on the plate. The autoantibodies are detected with a POD labeled antihuman IgG antibody. In the following enzymatic substrate reaction the intensity of the colour correlates with the concentration and/ or avidity of anti-CXCR-3-antibodies. The concentration was determined according to the standard curve.
Statistical analysis
All data in this study were analyzed by SPSS 22.0 and GraphPad Prism 8.0. Quantitative data with normal distribution were expressed as mean ± standard deviation (SD) and t-test was used for comparison between groups. Quantitative data with a non-normal distribution are presented as medians (interquartile ranges), and the groups were compared using a Wilcoxon rank-sum test. The receiver operating characteristic (ROC) curve was established to evaluate the diagnostic value. The area under the curve (AUC) was calculated. The Youden index was used to determine the optimal cutoff value. A two-tailed p value of < 0.05 was considered to indicate significance.
Discussion
Over recent years, the morbidity of BS has increased significantly, BS becomes a major health of the global population [
13]. Xinjiang province is an animal husbandry region of China, the morbidity of brucellosis is high. However, BS still has an insufficient evidence for the diagnostic report. The increase in patients in this area will cause economic losses. In the past 5 years, the number of BS patients in our hospital has increased year by year.
In this study, 96.5% of BS patients were in the chronic phase, which was higher than the report of brucellosis [
14]. It indicated that many patients in Xinjiang were not diagnosed timely. Epidemiologically, contacting with animals or consumption of uncooked, disinfected milk and dairy products are the major risk factors for infected persons [
15]. The study showed that 34.5% of BS patients become infected by eating raw and uncooked dairy products and there are 62.1% of BS patients contacted with cattle or lambs, indicating that helping lambing is the main risk for infection.
After
Brucella infects the human body, the endplate of the vertebral body, which have a rich blood supply, is the first infection vertebral bodies of
Brucella. It invades the intervertebral disc and vertebral body, causing spondylodiscitis. 29 BS patients, the most common was lower back pain, followed by hyperhidrosis, fatigue and fever (Table
3). Bone and joint pain and significant weight loss could be observed in nearly half patients. The bone and joint damage of the patients prevented them from engaging in regular physical activity. Their life quality was lower than before. The most common findings on physical examination were hepatomegaly and splenomegaly, which accounted for one quarter of the patients. In this study, fever is not the main feature of BS patients, which is related to the chronic phase of disease (96.5%).
Brucella survives and reproduces in host phagocytic cells. After it infects the host, it survives and replicates by escaping the host immune system. The infection from the acute stage to the chronic stage is related to various factors, such as the type of bacteria, diagnosis time and immune system response, etc. [
16]. After
Brucella has been phagocytosed, the innate immune system attempts to clear it, the differentiation of Th1 cells activates the production of IFN-γ, and IFN-γ plays a key role in fighting intracellular bacteria infection [
17].
This research found that the protein expression of IFN-γ is increased in the close tissue of BS patients, and the mRNA expression of IFN-γ in PBMCs is also increased. IFN-γ has multiple effects on the immune system [
18], especially in the initial stages of many immune reactions. CXCR3 is predominantly expressed on Th1 lymphocytes, and its agonists CXCL9 and CXCL10 are IFN-γ-inducible chemokines that promote Th1 responses.
Seiler [
19] found that CXCR3 affects granuloma formation after intracellular bacterium infection. In this study, we demonstrated that the CXCR3 and its ligands (CXCL9 and CXCL10) are highly expressed in
Brucella infected tissues and PBMCs. Studies have shown that chemokine receptors and ligands interaction have played an important role in leukocyte migration to immune response sites [
20].
CXCL10, as known as interferon-gamma-inducible protein 10 (IP-10), was identified as a chemokine secreted by several cells types in response to IFN-γ [
21]. Figure
1c showed that IFN-γ and CXCL10 were expressed in the close lesion tissue of BS patients, and the nuclear stain were dark brown, which was different from the distant normal tissue. When
Brucella infects host, CXCL10 gradient from
Brucella infected tissues recruits CXCR3
+ immune cells to regulate immune responses around the lesion tissue [
22], aggravating the degree of inflammation in patients with BS.
CXCL9 was first obtained by Farber [
23] using differential hybridization technology from mouse IFN-γ stimulated macrophage RAW 264.7. The CXCL9/CXCR3 axis regulates immune cell migration, differentiation, and activation [
24]. Figure
1c showed that CXCL9 was slightly increased in the close lesion tissue compared with the distant. The expression levels of CXCL9 were further increased in the PBMCs and serum of BS patients (Fig.
1a, b).
Of course, our research has a few limitations. First, our sample size is small, the time period of collecting samples is relatively large. The morbidity of BS patients is only a small part of brucellosis. Secondly, those markers in other types of infectious disease were not observed in our study. In the next study, we will further explore those markers expression in other infectious spondylitis.
Conclusion
The mechanism of bone destruction caused by BS is complicated. As a rare type of brucellosis, BS seriously affects human life quality during the infection period, it is getting more and more attention in Xinjiang. This study focus on analyzing the expression levels of CXCR3 and its IFN-γ-induced ligands (CXCL9 and CXCL10) in BS patient tissues and PBMCs. In summary, it was found that IFN-γ, CXCR3 and CXCL10 were highly expressed in the mRNA and protein of BS patient tissues and PBMCs. When Brucellosis invades the body, it causes an immune response and awakens the immune cells, those cells produce chemokines. They continuously infiltrate the inflammatory site, aggravate the inflammatory damage, and the repeated attacks are difficult to recover for BS patients. It is important to explore the interaction between CXCR3 and its ligands to better explain the degree of inflammatory damage of BS disease.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.