Background
SALL4 is a zinc-finger transcription factor essential for developmental events and embryonic stem cell (ESC) property maintenance [
1,
2]. It regulates cell type-specific gene expression programs by interacting with OCT4, SOX2, NANOG, and other “core” pluripotency transcription factors [
3–
6]. SALL4 is also a potent tissue stem cell factor. In normal bone marrows (BMs), it is highly expressed in hematopoietic stem/progenitor cells (HSPCs) but decreased in mature blood elements. In cultured HSPCs, forced overexpression of SALL4 markedly upregulated important HSC genes
Meis1,
Cd34,
Runx1,
Bmi1,
cMyc, cyclins, and HOX factors, which led to prolonged ex vivo cell expansion and enhanced cell repopulating in vivo [
7–
9].
SALL4 could be one of a few genes that bridge the unique properties of stem cells and malignancies. Although downregulated or absent in most adult tissues, abnormal SALL4 expression has been detected in various human tumors and leukemias which include acute myeloid leukemia (AML), B-acute lymphoblastic leukemia, and chronic myeloid leukemia (for a review, see Ref. [
10]). Moreover, SALL4 expression was enriched in the side population (SP) of tumor cells, implicating its roles in cancer initiation and drug resistance [
11]. In human AMLs, SALL4 knockdown caused massive cellular apoptosis and great cell growth arrest [
12], while overexpression of SALL4 largely blocked myeloid differentiation and apoptosis that was induced by all-trans retinoic acid (ATRA) [
13]. In animal studies, transgenic mice overexpressing SALL4 (the -B isoform) developed myelodysplastic syndrome (MDS) and AML features, and their BM HSPCs displayed increased serial replating potential [
14] which rapidly induced leukemia in secondarily transplanted mice, indicating the presence of leukemia-initiating cells (LICs).
It is becoming clear that the SALL4 regulatory functions are associated with a variety of chromatin-modifying factors which include DNA methyltransferases (DNMT-1, DNMT-3A, DNMT-3B, DNMT-3L) [
15], the nucleosome remodeling and deacetylase (NuRD) complex components HDAC1 /HDAC2 [
16], the histone demethylase LSD1/ KDM1A [
17], and others [
10]. SALL4 appears to selectively recruit these “epi-factors” to define target genes that control hematopoietic self-renewal, differentiation, and apoptosis, and thus affect their expression levels and control proper cell growth. For example, in NB4 AML cells transduced with lentiviral-SALL4 [
15], there was an overall increased percentage of DNA methylation at various CpG sites of the tumor suppression gene
PTEN promoter and
SALL4 promoter itself. In cultured mouse Lin-Sca-1+ c-kit + (LSK) HSPCs, lentiviral SALL4 overexpression or Cre-induced
Sall4 gene deletion significantly affected LSD1 binding and drastically altered H3K4me3 levels at promoters of differentiation genes
Ebf1,
Gata1, and tumor necrosis factor
Tnf, which significantly altered their transcript levels [
17]. In 32D myeloid progenitor cells with SALL4 overexpression, the H3K4me3 and H3K79me2/3 levels at the SALL4-binding regions of the polycomb group gene
Bmi1 promoter were substantially increased [
18]. The SALL4-mediated H3K4me3 modification is likely due to the SALL4-mixed lineage leukemia (MLL) interaction, which also induced increased H3K4me3 and H3K79me3 at
HOXA9 promoter [
19]. In a separate functional study, a SALL4-specific 12-amino acid peptide interfering its interaction with epi-factors (such as HDAC1/2) induced leukemia death but caused no cytotoxic effects in normal HSPCs in culture nor impaired in vivo engraftment [
20].
Recently, the SALL4 functions have been further linked with the MLL/HOXA9 pathway. SALL4 was demonstrated to interact with MLL protein, and the two factors occupy the same
HOXA9 promoter regions in hematopoietic cells [
19]. Of note, MLL-fusion proteins (MFPs) caused by frequent chromatin rearrangements are potent inducers of oncogenic transformation, and their expression has been considered the main oncogenic driving force in ∼ 10% of human AML patients [
21]. Remarkably, MLL-r leukemias display constant genomic stability, with very few gains or losses of chromosomal regions, but rely heavily on epigenetic dysregulation. In murine MLL-AF9—one of the most common MFPs with poor outcomes—AML model studies, depletion of either DNMT1 [
22], KDM1A/LSD1 [
23], or DOT1L [
24–
26] severely impaired leukemic transformation and disrupted disease progression.
Despite the accumulation of these findings, whether/or how SALL4 is involved in MLL-r leukemogenesis remains undetermined. In the present study, we investigated these issues and also examined the effects of SALL4 loss on normal hematopoiesis in mice, given the consideration of developing SALL4-based therapeutic strategies in the future.
Methods
Plasmids
The pMIG-MLL-AF9-GFP plasmid and the
ψ-eco packaging vector were obtained from Dr. Scott Armstrong [
27]. MEIS1 and HOXA9 retroviral vectors were purchased from Addgene (#21013 and #8515). The pCDH-CMV-3xFLAG-DOT1L vector was created in Baylor College of Medicine Genetic Core. All the plasmids were validated by DNA sequencing and or Western blotting (for 3xFLAG-DOT1L) or GFP fluorescence microscopy (for MLL-AF9-GFP). Detailed data are listed in Additional file
1.
Mice and in vivo tamoxifen administration
The
Sall4
flox/flox mice [
17,
28] have been crossed with
RosaCreER
T2 mice (Jackson Laboratory) to generate
Sall4
f/f
/CreER
T2 mice. For in vivo Cre-recombination, tamoxifen (Sigma-Aldrich) was administered via intraperitoneal injection every 2 days (100 μL of 10 mg/mL in corn oil) for totally five times. Primers used for genotyping are the following: wild type forward: cctcccggaattgcttatct, neo reverse: ctgtccatctgcacgagact, and flox-Sall4 Cre check: gcttctgcctctggtattgc [
28]. All animal experiments were approved by the Institutional Animal Care and Use Committee at Baylor College of Medicine or Stony Brook University Medicine.
Colony-forming unit (CFU), replating, and BM transplantation
Lin-BM cells were isolated and transduced with recombinant MLL-AF9 using published protocols [
17,
29]. Cells (0.5 × 10
4) were plated in methylcellulose media (MethoCult™ M3234, STEMCELL Technologies), and replating was performed every 7–10 days. CFU (with > 50 cells) was scored during each round of plating. For subsequent cell culture, individual colonies were plucked using a P200 micropipettor and transferred to microcentrifuge tubes containing 500 μl of PBS. Pelleted cells were then resuspended in BM culture media [
17] and maintained in a humid 37 °C 5%CO
2-incubator. For in vitro recombination, 4-OHT (Sigma-Aldrich) was resuspended in ethanol and added to cell culture at final concentration of 250 nM. Media was changed daily during culture. For in vivo transplantation, MLL-AF9-transduced cells (5 × 10
5) were injected through a tail vein into lethally irradiated (900 cGY) mice. Recipient mice were maintained on antibiotics for 2 weeks.
Cell cycle analysis
Cells (1 × 10
6/mL) were washed with ice-cold PBS-EDTA, centrifuged at 500
g for 5 min, and fixed with 2 mL 70% ice-cold ethanol at 4 °C for overnight. After fixation, cells were washed again, resuspended in 500 μL PBS solution containing 1× RNAse and propidium iodide(Abcam), and then incubated at 37 °C for 30 min. Fluorescence was measured with a LSR II flow cytometer. The assay was carried out in triplicate, and 10,000 events were analyzed per experiment using the BDFACSDiva software. Data was analyzed with ModFit LT 5.0.
BM hematopoietic stem and progenitor cell analysis
Propidium iodide (Molecular Probes) was used to exclude dead cells. Fluorescence-activated cell sorting (FACS) scheme used to isolate primary mouse BM cells are listed as follows [
30]. The HSC and multipotent progenitor cells (MPP) were defined as HSC (Linneg Sca-1+ c-Kit+, LSK, CD34-CD135-CD150+ CD48−), MPP1 (LSK CD34+ CD135− CD150+ CD48−), MPP2 (LSK CD34+ CD135− CD150+ CD48+), MPP3 (LSK CD34+ CD135− CD150− CD48+), and MPP4 (LSK CD34+ CD135+ CD150− CD48+). For early hematopoietic precursors [
31], BM cells were co-stained with antibodies against lineage markers, Sca1, c-kit, CD34, FcgRII/III, IL7Rα, and flk2.
Chromatin immunoprecipitation (ChIP)
ChIP assays were conducted using a One-Step ChIP kit (Epigentek) with ChIP-grade antibodies against FLAG (Sigma), H3K4me3, H3K79me2/3 (Abcam), and LSD1 (Cell Signaling). Chromatin enrichment was evaluated by qPCR relative to IgG-pulled input DNA. The sequences of the PCR primers were described previously [
25,
26].
Microarray analysis and gene-expression analysis
Total RNA was extracted using TRIZOL reagent and purification with QIAGEN RNeasy Mini Kit. Microarray analysis was performed using Agilent SurePrint mouse G3 Exon 4x180K. The arrays were hybridized and scanned, and data was extracted using Agilent Feature Extraction Software Version 11.0.1.1. The Bioconductor “limma” package (
http://bioconductor.org) was used to analyze the microarray data. The background-corrected data were log2 transformed and quantile normalized. Moderated
t statistics were used to test if genes were differentially expressed between
Sall4 KO and control groups. Benjamini-Hochberg method was used to estimate false discovery rate (FDR). FDR < 0.05 were considered statistically significant.
ChIP-Seq
This was performed by Active Motif (Carlsbad, CA). Briefly, 10 × 10
6 cells were fixed with 1% formaldehyde and quenched with 0.125 M glycine. Chromatin was prepared and sonicated, and the DNA sheared to an average length of 300–500 bp. Genomic DNA (input) was prepared by treating aliquots of chromatin with RNase, proteinase K, and heat for de-crosslinking, followed by ethanol precipitation. An aliquot of chromatin (30 μg) was precleared with protein A agarose beads (Life Technologies). Genomic DNA regions of interest were isolated using 12 μg of anti-SALL4 antibody (Abcam #ab29112). The obtained complexes were eluted from the beads with SDS buffer and subjected to RNase and proteinase K treatment. Crosslinks were reversed by incubation overnight at 65 °C, and ChIP DNA was purified by phenol–chloroform extraction and ethanol precipitation. Illumina sequencing libraries were prepared from the ChIP and input DNAs by the standard consecutive enzymatic steps of end-polishing, dA-addition, and adaptor ligation. After a final PCR amplification step, the resulting DNA libraries were quantified and sequenced on NextSeq 500 (75 nt reads, single end). Reads were aligned to the mouse genome (mm10) using the BWA algorithm. Duplicate reads were removed and only uniquely mapped reads (mapping quality ≥ 25) were used for further analysis. Alignments were extended in silico at their 3′-ends to a length of 200 bp, which is the average genomic fragment length in the size-selected library, and assigned to 32-nt bins along the genome. Peak locations were determined using the MACS algorithm (v1.4.2) with a cutoff of
p value = 1e−7. Peaks that were on the ENCODE blacklist of known false ChIP-Seq peaks were removed. Signal maps and peak locations were used as input data to the Active Motifs proprietary analysis program. Quantitative PCR (qPCR) reactions were carried out in triplicate using SYBR Green Supermix (Bio-Rad) on a CFX Connect™ Real Time PCR system. The resulting signals were normalized for primer efficiency by carrying out qPCR for each primer pair using input DNA. Primer sequences are available upon request.
Statistical analysis
Log-rank test was used to detect difference in animal survival. Independent two-sample
t test was used to detect difference between groups when the assumption of normality met. Otherwise, non-parametric Wilcoxon rank-sum test was used.
Discussion
We report here that loss of SALL4 completely inhibits MLL-AF9 AML initiation and significantly prolongs the latency of disease onset in mouse models. Importantly, SALL4 inactivation did not affect normal hematopoiesis in both conditional global gene targeting and
vav-mediated, hematopoietic-specific gene deletion systems. These in vivo findings strongly support that SALL4 and its regulated networks as ideal therapeutic targets in treating human MLL-AF9 leukemia. Moreover, SALL4 has previously been demonstrated to physically interact with MLL at the MLL-BP domain (N-terminal), which is preserved in both wild type MLL and rearranged MFPs [
19], thus SALL4 requirement may apply to a wide range of MLL-r leukemias driven by different MFPs. Clinically, MLL-r oncoproteins have been found in > 70% of infant leukemia, ~ 10% of adult AML, and many cases of secondary acute leukemias [
46]. While aberrant SALL4 protein expression has been reported in most human AML cases [
14], our work is thus novel in identifying therapeutic targets for this group of notorious malignancies. In future studies, it will be interesting to thoroughly characterize a potential link between SALL4 and MFP expression status in relevant leukemia patients.
In this study, we also report that SALL4 dynamically recruits the histone demethylase LSD1 and the H3K79 methyltransferase DOT1L. Recent studies demonstrated that LSD1 binding at MLL-AF9 target gene promoters decreases the H3K4me2 to H3K4me3 ratio, which promotes MLL-AF9 oncogenic gene program [
23,
47]. Similarly, DOT1l can interact with AF9, and the degree of DOT1L recruitment to MLL-AF9 defines target gene H3K79 methylation levels and transformation potential [
24,
26]. It would be possible that SALL4 and MLL-AF9 together orchestrate recruitment of these epigenetic modifiers, which cooperatively regulate local chromatin structure and coordinately control target gene expression, thereby modulating subsequent proper cell survival. In future studies, it will be necessary to determine if/or how SALL4 expression levels affect DOT1L binding status to MLL-AF9 or whether SALL4 expression levels substantially affect H3K4 and H4K79 methylation status at yet unidentified important MLL-AF9 target genes via these associated epi-factors.
In mRNA microarray assays, we have initially focused on a relatively earlier event with a goal of better identifying SALL4 “direct” downstream targets in MLL-AF9 leukemia. Interestingly, we identified the retinoic acid biosynthesis inhibitor DHRS3 [
48], which could likely contribute to SALL4-mediated inhibitory effects in ATRA-induced AML differentiation [
13]. Further biological studies will be needed to prove this assumption. We also identified that SALL4 regulates important TGFβ factors including TGFβ2, TGFβ3, and TGFβR3. SALL4 regulation of TGFβ signaling in leukemia pathogenesis has not been reported before, while the TGFβ signaling plays critical roles in HSC self-renewal, quiescence, niche regulation, and also AML and ALL leukemogenesis [
36,
37]. Notably, TGFβ stimulated proliferation of myeloid-biased HSCs (My-HSCs) but inhibited lymphoid-biased HSCs (Ly-HSCs) [
49]. Therefore, more in-depth studies are needed to further dissect the effects in leukemia progression that are modulated by the putative SALL4/TGFβ pathway. Additionally, an AF9 regulator SGK1 was identified. SGK1 has been shown to disrupt the assembly of the Af9/Dot1 complex [
38]. Thus, studies regarding if/how SGK1 is involved in the DOT1L/MLL-AF9 protein interaction process may provide more insight into SALL4-mediated epigenetic regulations. Notably, SALL4 ChIP-Seq assay revealed that SALL4 binds to key MLL-AF9 target genes, Hox factors, and important MLL-r leukemia-related genes. Currently, another round mRNA microarray assay with a prolonged 4-OHT treatment (5~6 days in culture) samples are on the way. The expression levels of above-discussed factors, as well as the important MLL-AF9 downstream targets, will be investigated and contrasted to further establish SALL4 governed transcriptional and epigenetic mechanisms in MLL-AF9 leukemia.
In normal animal studies, we unexpectedly identified that SALL4 inactivation barely affected normal hematopoiesis in two distinct
Sall4 deletion mouse models. In a previous study, however, shRNA-mediated
SALL4 knockdown in purified human CD34+ HSPCs resulted in reduced myeloid colony formation and impaired in vivo engraftment [
44]. This discrepancy could be due to the distinct models that were examined. In contrast to in vivo models, the cultured system generally lacks essential elements such as functional compensatory factors, cytokines, bypass mechanisms, optimum hormones, and nutrients but with considerably higher cell-to-cell toxic effects. Supporting this notion, mice depleted with TGFβ, the important HSC regulator which showed potent inhibitory effects on HSPC growth in vitro, also demonstrated unperturbed hematopoiesis in vivo [
50,
51]. Similarly, MEIS1 and RUNX1, both are critical in MLL-AF9 leukemogenesis and in embryonic hematopoiesis but reported less so in adulthood [
52]. Notably, in another SALL4-related study [
19], a 12–amino acid peptide that specifically blocks SALL4-HDAC1/2 interaction resulted in impaired leukemic engraftment in vivo similar to that of
SALL4 knockdown. However, the same peptide treatment caused no cytotoxic effect of the CD34+ HSPCs in culture, nor any negative impact on in vivo engraftment. On the other hand, it needs to be noted that some genes may exert their functions only when cells encounter transplantation or replicative stress [
53]. Additionally, some Vav/Cre knockout models may demonstrate severe hematopoietic defects at very late stages [
54]. Thus, in future studies, serial transplantation assays, stress induction (such as 5-FU treatment), and long-term follow-up of the
Sall4
flox/VavCre mice will be needed to fully clarify SALL4KO effects on normal HSC activities. The HSC-related genes, such as HOX factors,
Bmi1,
Runx1, the TGFβ signaling, and in vitro stem/progenitor cell expansion also need be investigated in parallel.
Acknowledgements
The authors would like to thank the Genomic and RNA Profiling Core at Baylor College of Medicine with funding from the NIH NCI grant (P30CA125123) and the expert assistance of Dr. Lisa D. White, PhD. The authors thank the Cytometry and Cell Sorting Core at Baylor College of Medicine with funding from the NIH (P30 AI036211, P30 CA125123, and S10 RR024574) and the expert assistance of Joel M. Sederstrom. We thank Laurie Levine for helping with the animal care and protocols. We would also like to thank Kimberly Macellaro, PhD, a member of the Baylor College of Medicine Michael E. DeBakey Department of Surgery Research Core Team, for her editorial assistance.