Introduction
Ischemic strokes are the most common type of stroke. Occlusion of cerebrovascular blood flow resulting in a lack of glucose and oxygen delivery to the brain results in rapid cell death and impaired neural function within the affected regions. The resulting functional deficits have a significant impact on an individual’s quality of life and current treatment strategies offer limited success [
1‐
5]. Most available therapies for stroke focus on restoring blood flow and neuroprotection, which have a limited therapeutic window. Cell-based interventions to repair the stroke-injured brain and promote functional recovery have demonstrated some therapeutic efficacy [
6‐
9]. However, a number of challenges including the identification of an appropriate cell type for transplantation that circumvents immune rejection, tumorigenicity, ethical concerns, misguided or misdirected growth, and limited availability in terms of cell isolation and expansion remain [
10‐
13].
Neural precursor cells (NPCs), comprised of neural stem cells and their progeny, have the capacity to differentiate into neural specific cell types, making them good candidates to repair the stroke-injured brain. Although their underlying mechanism of action is not entirely clear, NPCs have demonstrated efficacy in treating several models of stroke, resulting in improved outcomes, including better functional performance, decreased glial scarring, and reduced extent of injury [
14‐
21]. However, harvesting human NPCs is challenging due to their limited availability and location within the brain. Other potential sources of human NPCs are those derived from reprogrammed cells, such as induced pluripotent stem cells (iPSCs), which offer an autologous cell source for transplantation. Unfortunately, iPSCs pose concerns for clinical application because of their acquired pluripotent state during reprogramming in addition to the length of time and complexity required to generate sufficient numbers of cells.
With clinical translation in mind, we examined the therapeutic potential of a population of human cells that have been directly reprogrammed from somatic cells to NPCs
, without passing through a pluripotent state during reprogramming. We address important considerations that may influence transplant success, including the transplant vehicle [
22], and the sex of the stroke-injured mice, which has not been adequately studied to date despite the observation that males and females are differentially responsive to stroke injury [
12,
23‐
26]. Furthermore, we explore the importance of cell survival for recovery and investigate changes in synaptogenesis as a mechanism underlying cell-mediated effects.
Using a preclinical model of cortical stroke, we demonstrate that human directly reprogrammed neural precursor cell (drNPC) transplants delivered during the subacute phase of stroke are sufficient to elicit motor recovery irrespective of recipient sex and transplant vehicle. The observed functional recovery was not correlated with the extent of glial scarring or lesion volumes and did not require long-term xenograft survival. Furthermore, drNPC transplants appear to promote synaptogenesis, as indicated by increased expression of the presynaptic vesicle protein synaptophysin in the ipsilesional hemisphere of transplanted brains. These findings suggest that NPCs may indirectly promote functional recovery by influencing the surrounding tissue, making drNPCs a promising population of cells to treat the stroke-injured brain.
Materials and Methods
Study Design
The experimental design was a controlled laboratory experiment. Male and female animals were used and separated into groups via random assignment by a blinded third party until appropriate numbers of samples were achieved for each group. Behavioral analysis was conducted by an observer blinded to the treatment groups. Tissue and cellular outcomes were evaluated by three separate observers blinded to the experimental groups.
For functional analysis, 10–15 mice per group were analyzed. Using a sensitivity analysis on G*Power (version 3.1) with power = 0.8, we determined the treatment effect size to be ~
f(
V) = 0.65 (
η2partial = 0.3) when analyzing all four treatment groups,
f(
V) = 0.42 when comparing between drNPC and vehicle groups, and
f(
V) = 0.93 when comparing between brains that had surviving drNPCs and those that did not. For tissue outcome comparisons between mice that received drNPCs or vehicle alone, the effect size was always above
d = 0.9 (Gliosis, 0.97; Lesion Volume, 1.51; Synaptophysin, 1.60) with a power = 0.8. All effect size (sensitivity) calculations were based on Cohen’s
d [
27]. Excluded animals were not considered for power and sensitivity analyses.
Animals
Immunocompromised Fox Chase SCID/Beige (8–16 weeks old; CB17.Cg-Prkdc
scidLyst
bg-J/Crl; Charles River Laboratories, Wilmington, MA) mice were singly housed on a 12-h light/dark cycle with food and water provided ad libitum for the duration of testing, starting 3 days prior to stroke, until sacrifice. A total of 87 mice (establishment of stroke,
n = 13, [sex not tracked]; long-term deficit analysis for ET-1 stroke,
n = 13 [7 males, 6 females]; confirmation of stable measures in long-term testing of naïve mice,
n = 8 [6 males, 2 females]; therapeutic evaluation of drNPC transplants,
n = 53 [30 males, 23 females]) were used in this study. Outliers and mice that did not meet our inclusion criteria were removed from the study as described in the
supplementary materials.
Stroke Injury
ET-1 stroke was performed in SCID/Beige mice as previously described [
17,
28,
29]. Briefly, the skull was exposed, a small burr hole was drilled at the site of the right sensorimotor cortex at + 0.6 mm anterior and − 2.25 mm lateral to bregma. Mice received a 1-μL injection of ET-1 (Calbiochem, 800 picomolars) 1 mm deep from the surface of the brain at a rate of 0.1 μL/min using a 2.5 μL Hamilton Syringe with a 26 gage, 0.375″ long needle (Hamilton, Reno, NV). The needle was kept in place for 10 min following the injection and then slowly withdrawn.
drNPC Reprogramming and Preparation
Human bone marrow cells were reprogrammed with transient expression of transcription factors musashi-1 (Msi1), neurogenin-2 (Ngn2), and methyl-CpG binding domain protein 2 (MBD2), as described in detail in the
supplementary material. The cells were cultured until they reached ~ 80% confluence in each passage and collected for transplantation after 4–9 passages
. Sister cultures were prepared for in vitro analysis to characterize the cells using immunocytochemistry and PCR.
Cell Transplantation
For transplantation, drNPCs were suspended in artificial cerebrospinal fluid (aCSF) or Hyaluronan Methylcellulose (HAMC;
supplementary methods) hydrogel (100,000 cells/μL). Cells were transplanted into the stroke site 4 days following stroke with the same surgical procedures used for ET-1-induced ischemia in the sensorimotor cortex. Control animals received 1 μL injections of aCSF or HAMC only.
Live/Dead Assay
A live/dead assay was performed to determine the percent of surviving cells post-injection through the syringe [
30]. Using the same protocol as was used for transplantation, 100,000 cells in 1 μL of vehicle were injected into a well containing 14 μL of warm (37 °C) aCSF at a rate of 0.1 μL/min. Following injection, 15 μL of the live/dead stain solution (0.2% Ethidium Homodimer and 0.05% calcein AM) (L3224, ThermoFisher) was added, followed by a 5-min incubation period after which 220 μL aCSF was added for a final volume of 250 μL. The solution was imaged using an AxioVision Zeiss UV microscope (5× magnification) and images were visualized in FIJI [
31]. The percent of live/dead cells was calculated using the “analyze particles” feature on the FIJI software.
Immunostaining
Fixed tissue and cells were rinsed with 1× phosphate buffered saline (PBS), permeabilized with 0.3% Triton-X100 in 0.01 M PBS for 20 min and blocked in 10% Normal Goat Serum (NGS) with 0.3 M glycine for 1 h at room temperature. Samples were then treated with primary antibodies (Table
1) in 0.01 M PBS and left overnight at 4 °C in a humid chamber. Samples were washed with 1× PBS and exposed to secondary antibodies for 1 h at room temperature (Table
2). The samples were then washed, cover-slipped with mowiol® 4-88 (Sigma-Aldrich), and imaged using an AxioVision Zeiss UV microscope, an Olympus FV1000 confocal point-scanning microscope, or a ZEN Zeiss spinning disk confocal microscope.
Table 1Primary antibodies used in this study
Oct4 | 1:500 | sc-5279 | Santa Cruz | Mouse | IgG2b |
Sox2 | 1:200 | ab97959 | abcam | Rabbit | Polyclonal |
Human nestin | 1:500 | ABD69 | Milipore | Rabbit | Polyclonal |
HuNu | 1:200 | MAB1281 | Milipore | Mouse | IgG |
STEM121 | 1:1000 | Y40410 | Takara | Mouse | IgG1 |
Ki67 | 1:200 | ab16667 | Abcam | Rabbit | Monoclonal |
Ki67 | 1:500 | ab15580 | Abcam | Rabbit | Polyclonal |
TUJ1 | 1:1000 | 802,001 | Biolegend | Rabbit | Polyclonal |
TUJ1 | 1:1000 | T8660 | Sigma | Mouse | IgG2b |
GFAP | 1:600 | Z0334 | Dako | Rabbit | Polyclonal |
Olig2 | 1:200 | AB9610 | Milipore | Rabbit | Polyclonal |
NeuN | 1:500 | ABN78 | Milipore | Rabbit | Polyclonal |
Synaptophysin | 1:400 | AB32127 | Abcam | Rabbit | Polyclonal |
DAPI | 1:10000 | D1306 | Invitrogen | N/A | N/A |
Hoechst 33342 | 1:1000 | H3750 | ThermoFisher | N/A | N/A |
Table 2Secondary antibodies used in this study
Goat anti-mouse | 1:400 | 488 |
Goat anti-rabbit | 1:400 | 488 |
Goat anti-rabbit | 1:400 | 568 |
Goat anti-mouse | 1:400 | 555 |
Goat anti-mouse | 1:400 | 568 |
Lesion Volume Analysis
Following cresyl violet staining (see
Supplementary methods), serial 20- μm thick coronal sections (200 μm apart) spanning a total of 3–4 mm surrounding the injury site were imaged at 5× magnification using an AxioCam ICc1 camera. The cortical lesion was measured on FIJI using the lasso and polygon tools to outline and quantify the total cortical lesion infarct area, as defined by the area with atypical tissue morphology including pale areas with lost Nissl staining and areas filled with dark pyknotic stained debris [
32]. The total volume of the injury was estimated by averaging the area measured in each coronal section and multiplying by the total length of the scar, which was calculated from the number of sections in which the lesion was present.
Gliosis Measurement and Analysis
A set of serial coronal sections (20 μm thick) immunostained for GFAP
+ expression were visualized at 5× magnification at 200 μm intervals using FIJI [
31]. The total area of cortical GFAP
+ expression was measured in each section. Measurements were taken from anterior to posterior through the scar and the maximal GFAP expression, as well as the total gliosis volume, was calculated per brain.
Synaptophysin Imaging and Quantification
All of the images were taken with identical parameters using confocal microscopy on a ZEN Zeiss spinning disk confocal microscope to generate z-stacks comprised of eight optical sections at 0.49 μm per section. The channel exposure was fixed at 1000 ms throughout the imaging of the entire set. Quantification of total synaptophysin-positive pixels per analyzed brain section was conducted by using FIJI [
31] to measure the number of positive pixels in the perilesional areas. The mean pixel intensity in two perilesional regions of interest (ROIs) was used to measure the amount of staining (Fig.
7a), as this measure represents the sum of all detected bright pixels (gray values) divided by the total number of pixels within the channel. Imaging, ROI selection, and analysis were conducted by a blinded observer.
Cellular Characterization and Quantification
Three cell culture wells per biological replicate were stained for each specific antibody and were counted within the field of view in five areas within each well at 20× magnification. The percentage of each cell type was calculated as a percent of all DAPI or Hoechst labeled cells.
For in vivo analysis, coronal sections 20 μm thick at 200 μm intervals were immunostained for HuNu or STEM121 and antibodies found in Table
1. Total numbers of surviving transplanted cells were calculated by extrapolating the average number of surviving drNPCs per section over the total number of sections that contained drNPCs (ranging from 15 to 20 sections). To analyze proliferation, the numbers of Ki67
+/HuNu
+ cells were counted in the same representative sections and calculated as a percent of all HuNu
+ cells. Cell differentiation in vivo post-transplantation was analyzed by immunohistochemistry in brains that had surviving drNPCs.
Reverse Transcription Polymerase Chain Reaction
Cultured drNPCs were collected into Buffer RL (Norgen Biotek) with β-mercapthenol and then processed according to the manufacturer’s directions using Total RNA Purification Kit (Norgen Biotek — Cat#17200). Cycling conditions consisted of polymerase activation and DNA denaturation (3 min at 98 °C), followed by 35 cycles of 10 s at 95 °C and 30 s at 60 °C. Primer sequences used are listed in Table
3.
Table 3Polymerase chain reaction primer sequences used in this study
Sox2 | Fwd GGAGCTTTGCAGGAAGTTTG Rev. GGAAAGTTGGGATCGAACAA | 460 |
Oct4 | Fwd CTGAGGGTGAAGCAGGAGTC Rev. CTTGGCAAATTGCTCGAGTT | 170 |
Nanog | Fwd AAGGCCTCAGCACCTACCTA Rev. GAGACGGCAGCCAAGGTTAT | 979 |
Nestin | Fwd GCGTTGGAACAGAGGTTGGA Rev. TGGGAGCAAAGATCCAAGAC | 327 |
Pax6 | Fwd CAATCAAAACGTGTCCAACG Rev. TGGTATTCTCTCCCCCTCCT | 431 |
Ascl1 | Fwd GTCGAGTACATCCGCGCGCTG Rev. AGAACCAGTTGGTGAAGTCGA | 220 |
CD133 | Fwd CAGTCTGACCAGCGTGAAAA Rev. GGCCATCCAAATCTGTCCTA | 200 |
Map2 | Fwd TCAGAGGCAATGACCTTACC Rev. GTGGTAGGCTCTTGGTCTTT | 320 |
Actb | Fwd TCACCCACACTGTGCCCATCTACGA Rev. CAGCGGAACCGCTCATTGCCAATGG | 295 |
GAPDH | Fwd CTCTGCTCCTCCTGTTCGAC Rev. GCGCCCAATACGACCAAATC | 121 |
Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
Samples were collected into Buffer RL (Norgen Biotek) and processed according to the manufacturer’s directions using Total RNA Purification Kit (Norgen Biotek — Cat#17200). cDNA synthesis was carried out with iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad — Cat# 1725034). RT-qPCR reactions were prepared according to the manufacturer’s directions using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad — Cat# 172-5270). RT-qPCR was carried out on Bio-Rad CFX384 Touch Real-Time PCR System (Bio-Rad). Cycling conditions consisted of polymerase activation and DNA denaturation (3 min at 98 °C), followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C. All reactions were concluded by incubation at 65 °C and increasing the temperature (at 0.5 °C increments) to 95 °C for melting-curve analysis. Prior to performing relative expression analyses, standard curves were generated for targets (see below) via the serial dilutions of pooled cDNA. In accordance with MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines, the amplification efficiencies (E) of reported runs were between 97% and 113% and R2 > 0.9 with minimum two technical replicates per reaction. The Bio-Rad SYBR Green Assays used were Nestin (qHsaCED0044457), Tuj1 (qHsaCED0005794), Olig2 (qHsaCED0007834), Gfap (qHsaCID0022307), BDNF (qHsaCED0047199), and Gapdh (qHsaCED0038674). Relative expression data were normalized to the reference gene Gapdh to control for variability in expression levels and were analyzed using the Livak and Schmittgen (i.e., 2−ΔΔCT) and Pfaffl methods. The relative expression of each target was assessed by unpaired two-tailed t test. A p value of less than 0.05 was considered significant.
Enzyme-Linked Immunosorbent Assay (ELISA)
Brain-derived neurotrophic factor (BDNF) released into the conditioned medium of drNPC cultures that were differentiated towards a neural lineage was measured by antigen-capture ELISA at different time points and compared to the release of BDNF in the conditioned medium of mature neurons (cat #1520, ScienCell). Conditioned medium from each group was collected, centrifuged, and then stored at − 80 °C until assaying. BDNF concentrations were measured by ELISA kit (BDNF Emax Immunoassay System, Promega Corporation, USA), according to the manufacturer’s instructions. Briefly, 96-well ELISA immunoplates were coated with Anti-BDNF (CatNb#G700B) diluted 1/1000 in carbonate buffer (pH 9.7), and incubated at 4 °C overnight. The following day, all wells were washed with TBS-Tween 0.5% before incubation with Block/Sample buffer 1× at room temperature for 1 h without shaking. After blocking, standards and samples were added to the plates and incubated and shaken (450 ± 100 rpm) for 2 h at room temperature. Subsequently, after washing with TBS-Tween wash buffer, plates were incubated for 2 h with Anti-Human BDNF (1:500 dilution in Block & Sample 1× Buffer) at 4 °C. After incubation, plates were washed five times with TBS-Tween 0.5% wash buffer and 100 μl of diluted Anti-IgYHRP Conjugate was added to each well (1:200 dilution in Block & Sample 1X Buffer) and incubated for 1 h at room temperature with shaking (450 ± 100 rpm). Then, plates were washed five times with TBS-Tween 0.5% wash buffer and 100 μl of TMB One Solution was added to each well. Following 10 min incubation at room temperature with shaking (450 ± 100 rpm) for the BDNF plate, a blue color formed in the wells. After stopping the reaction by adding 100 μl of 1 N hydrochloric acid, the absorbance was read at 450 nm on a microplate reader (Synergy 4) within 30 min of stopping the reactions. Concentration of released BDNF in the supernatants was determined according to the standard curves. BDNF concentrations were compared using an unpaired, two-tailed t test for each time point.
Behavioral Tests
Behavioral analysis was performed using the foot fault task, measuring gross motor functions such as coordination and balance, as well as fine sensorimotor function like reaching and stepping [
33], 3 days prior to injury (baseline) and at 3, 8, 18, and 32 days post-stroke; and the cylinder test at 3 days prior to injury and at 3 and 32 days post-stroke. Detailed methods of behavioral tests can be found in the
supplementary material. All behavioral tests were recorded with a digital camera (SX 60 HS, Canon) and viewed on VLC Media Player (Version 2.2.1, VideoLAN Organizarion). Videos were scored by a blinded observer.
Statistical Analysis
Statistical analysis was performed using Prism 6 (GraphPad Software, San Diego, CA) and IBM SPSS Statistics (International Business Machines Corp., Armonk, NY). Data was analyzed using a variety of statistical methods which can be found in the
supplementary material. All data is reported as mean ± SEM.
Discussion
We have shown that drNPC transplantation during the subacute phase in a pre-clinical mouse model of stroke is able to promote functional recovery, regardless of the transplant vehicle or the sex of the recipient. Furthermore, we found that functional recovery does not require the long-term survival of transplanted cells, and that recovery is maintained beyond transplant survival. In the brains of mice that did have surviving drNPCs at late survival times, the majority of the transplanted drNPCs remained undifferentiated and non-proliferative. Most interesting, brains that received drNPC transplants had higher levels of synaptophysin in the perilesional stroke-injured cortex, supporting the idea that synaptogenesis may underlie the drNPC-mediated recovery.
Cell survival is a challenge common to transplant therapies in general. Herein, we used two transplant vehicles with the goal of establishing the best parameters to enhance cell survival and promote recovery. Interestingly, the frequency and absolute number of viable drNPCs observed in vivo were not different between HAMC and aCSF. Previous studies report that HAMC has pro-survival properties and improves cell transplant survival outcomes using murine cells [
17,
35‐
37], which has been attributed in part to the immunomodulatory effects of HAMC [
38‐
41]. Accordingly, the lack of pro-survival effects of HAMC in this study may be due to the immunomodulatory advantage of HAMC being negated in the immunodeficient mouse strain (lacking adaptive immune cells). Of note, drNPC proliferation was also not affected by the vehicle. In both vehicles, the proliferative ability of drNPCs decreased following injection into the stroke-injured brain; dropping from 71.8 ± 4.0% at time of transplantation to approximately 10% by 4 days post-transplant. Importantly, we also found no evidence of tumor formation in any of the animals, similar to previous work with drNPCs [
42].
Our results indicate that the long-term survival of transplanted cells is not necessary for maintaining functional recovery, although their presence at early times is important, as vehicle-only treated mice did not recover. We found no correlation between functional recovery and the extent of gliosis or lesion volumes, consistent with observations in other models of stroke where interventions lead to recovery but had no effect on tissue outcomes [
43‐
45]. The mechanism by which transplanted cells mediate recovery is still unknown but there is evidence that suggests transplanted cells can promote recovery through trophic support, by promoting plasticity and synaptogenesis, inducing angiogenesis, immunomodulation, reducing excitotoxicity, and even activating endogenous cells to proliferate and migrate to the site of the lesion [
15,
16,
18,
20,
43,
45‐
55]. Notably, the short-term survival of the transplanted cells is consistent with the hypothesis that the presence of drNPCs promotes recovery through an indirect mechanism.
Our observation that drNPC transplants lead to functional recovery and increased synaptophysin expression in the perilesional stroked hemisphere suggests that one underlying mechanism for drNPC-mediated recovery for stroke is enhancing host brain plasticity; through increased synaptogenesis via the development of new synaptic junctions, potentially resulting from axonal sprouting and endogenous cortical remapping [
43,
56]. Exploring the secretome of transplanted drNPCs may provide further insight into the mechanisms and pathways that result in functional recovery.
Supplementary to our findings, recent studies transplanting drNPCs that were pre-differentiated towards an oligodendrogenic fate prior to transplantation in a rat model of spinal cord injury resulted in improved functional outcomes via migration and integration within the injured tissue, where they participated in tissue sparing and axonal remyelination [
42]. Thus, it is possible that the observed mechanism of recovery depends on a variety of factors, such as injury, host, and status of drNPCs, which is an important consideration for drNPCs as autologous transplants since they could have additional mechanisms of action related to cell replacement in humans.
drNPCs have the potential to provide a safe, autologous, and plentiful source of cells for clinical neural repair strategies and our findings support the conclusion that drNPCs are a promising candidate to treat stroke. The potential of translating the results from our study to the clinic raises important questions with regard to the optimal timing of transplantation and the associated mechanism that induces recovery. Transplantation of drNPCs in a different model that produces a larger lesion or a chronic model of stroke, in addition to selective ablation of transplanted cells at various times post-stroke, may provide additional insight into the optimal therapeutic window for transplantation and further our understanding of the underlying cell-based mechanisms that promote recovery. Further understanding of these mechanisms will support the development of novel therapeutics for neural repair.
Acknowledgments
We would like to thank Nadia Sachewsky for helping with drNPC culture work, Monoleena Khan and Ritika Kompella for helping with tissue processing and preparation, Ricky Siu for assisting with animal surgery, and Priya Anandakumaran, Ana Fokina, and Tobias Fuehrmann for helping with HAMC preparation and drNPC suspension. Thank you to Emily Gilbert and Jessica Livingston for their discussions and assistance.
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.