Background
Obesity is highly prevalent all over the world, due to changes in our lifestyle and diet [
1,
2]. It is estimated that obesity has affected more than 600 million adults and 100 million children at present [
2]. Accumulating evidence has demonstrated that obesity is the most important and common cause of insulin resistance [
3,
4]. During obesity, adipose tissue changes the number and size of adipocytes. In the meantime, cells of various types in stromal vascular fraction (SVF) of adipose tissue, especially adipose tissue macrophages (ATM), undergo numerical and functional changes. These biological processes are termed as “adipose tissue remodeling” [
5]. Adipose tissue remodeling regulates physiological functions of adipose tissue, which plays a significant role during the pathogenesis and etiology of obesity-induced insulin resistance [
5].
Trigger receptor expressed on myeloid cells 2 (TREM2), which belongs to the immunoglobulin superfamily of receptors [
6], is mainly expressed on myeloid cells, such as macrophages [
7], dendritic cells [
8] and microglia [
9,
10] for regulating various cell biological behaviors including survival, proliferation, differentiation, phagocytosis and inflammatory response [
6‐
13]. Recent studies have shown that TREM2 is also expressed on mature adipocytes [
14]. Furthermore, TREM2 can act as a lipid sensing receptor to recognize and bind lipids [
9]. In animal models of obesity, TREM2 gene expression was up-regulated in adipose tissue [
14‐
16]. However, it is unknown whether TREM2 regulates obesity-induced insulin resistance via adipose tissue remodeling. In the present study, we tried to determine the effect of TREM2 gene deficiency on adipose tissue remodeling in mice of high-fat diet (HFD), and explored the effect of TREM2 on obesity-induced insulin resistance. We first examined obesity, insulin resistance and adipose tissue remodeling in TREM2 knockout (TREM2
−/−) and wild-type (WT) mice under HFD challenge. Then, we determined adipocyte hypertrophy and adipocyte death of epididymal adipose tissue (EAT). Next, we explored numerical changes of macrophages and its underlying mechanism. After that, we measured inflammatory response of adipose tissue macrophages in HFD mice. Finally, we evaluated hepatic steatosis in mice under HFD feeding.
Materials and methods
Animals and diets
All animal experiments in this study were approved by the Animal Care and Use Committee of Zhejiang University. WT mice of C57BL/6 were purchased from Shanghai SLAC Laboratory Animal Co. TREM2
−/− mice with the background of C57BL/6 were generously provided by Professor Macro Colonna (Department of Pathology and Immunology, School of Medicine) from Washington University in St. Louis [
12]. All animals in this research were kept in the Laboratory Animal Center of Zhejiang University under an environmentally controlled condition, with temperature stable at 22 ± 2 °C, humidity stable at 55 ± 5% and a 12/12 h light/dark cycle. Male WT and TREM2
−/− mice with the age of 6 weeks and bodyweight of 21.0–23.0 g were both fed with HFD (D12492, 60% kcal of energy from fat, Research Diets) ad libitum for 12 weeks, and control WT and TREM2
−/− mice were fed with controlled-fat diet (CFD) (D12450B, 10% kcal of energy from fat, Research Diets). Food consumption was recorded twice a week and bodyweight was monitored weekly.
Insulin tolerance test (ITT) and glucose tolerance test (GTT)
For ITT, mice were fasted for 6 h before an intraperitoneal injection of insulin with the dosage of 0.8 U/kg bodyweight (for CFD mice) or 1.0 U/kg bodyweight (for HFD mice). For GTT, mice were fasted for 16 h before an intraperitoneal injection of glucose with the dosage of 1.5 g/kg bodyweight. Tail vein blood was collected at 0, 15, 30, 60, 90 and 120 min after injection. Glucose level was measured with a glucometer (Accu-Chek Aviva, Roche Diagnostics).
Tissue and blood collection
Mice were fasted overnight for 16 h before anesthetizing with 4% chloral hydrate. Blood was collected from retro-orbital venous and spun down at 2500 g for 5 min under 4 °C. After separation, serum was stored under − 80 °C for further analysis. Epididymal fat pads were dissected and weighed. After rinsing in PBS, EAT was divided into three parts: one part was kept in a − 80 °C freezer; one part was fixed in 10% neutral-buffered formalin; while the last part was for adipocyte and macrophage isolation.
Blood biochemistry analysis
Serum samples stored under − 80 °C were thawed under room temperature. After 5 min of centrifugation at 350g under 4 °C, supernatant was collected and kept on ice temporarily. Concentrations of fasting glucose (298-65701, Wako Chemicals), free fatty acid (FFA) (294-63601, Wako Chemicals), triglyceride (F001, Nanjing Jiancheng Bioengineering Institute) and total cholesterol (F002, Nanjing Jiancheng Bioengineering Institute) were measured according to the manufacturer’s instructions. While serum concentrations of MCP-1 were determined using commercially-available ELISA kit (MJE00, R&D).
Insulin stimulation
To examine insulin signaling pathway activity in adipose tissue, mice were fasted for 6 h before anesthetizing with 4% chloral hydrate. Left EAT (marked as control) was removed, rinsed in PBS and flash frozen in liquid nitrogen. After that, abdominal cavity was closed up temporarily. Insulin was injected intraperitoneally with the dosage of 1.0 U/kg bodyweight for stimulation. Right EAT (marked as insulin-15 min) was harvested 15 min post injection and rinsed in PBS to remove possible contamination of insulin and flash frozen in liquid nitrogen. All EAT samples were transferred to a − 80 °C freezer for Western blotting.
Adipocyte and macrophage isolation and purification
Adipocyte and macrophage isolation protocol was based on previous publication with a minor modification [
17]. Briefly, epididymal fat pads were minced into small pieces before incubating with collagenase type II (17101015, Gibico) on a 37 °C heated shaker for 40 min. Then, cell suspension was passed through a 100 micron filter. After repeated centrifugations of 1000
g, supernatant layer (floating adipocytes) was collected from top. In the meantime, cell pellet (SVF) was resuspended in ACK Lysing Buffer to remove erythrocytes for further purification of macrophages.
RT-PCR
Total RNA extraction and RT-PCR were performed as published protocol [
18]. The relative gene expression level was normalized to β-actin mRNA expression. Specific primers used in this research for β-actin, TNF-α, IL-1β, IL-6 and iNOS were listed in Table
1.
Table 1
Primers sequences for RT-PCR
β-actin | CGTTGACATCCGTAAAGACC | AACAGTCCGCCTAGAAGCAC |
TNF-α | TACTGAACTTCGGGGTGA | ACTTGGTGGTTTGCTACG |
IL-1β | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
iNOS | CAGGCTGGAAGCTGTAACAAAG | GAAGTCATGTTTGCCGTCACTC |
Western blotting
Samples of adipose tissue for detecting activity of insulin signaling pathway and samples of adipocytes for detecting MCP-1 expression were homogenized in cell lysis buffer supplemented with phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail. After 10 min of incubation on ice, samples were centrifuged at 14,000 rpm under 4 °C for 15 min. Protein layer was extracted by a 1 ml syringe penetrating through floating lipid layer from the top. Protein content was determined by using bicinchoninic acid (BCA) assay. Samples contained 30 μg of protein were separated on 12% Bis–Tris gels (NP0343BOX, Thermo Fisher Scientific). Protein was wet transferred onto polyvinylidene difluoride (PVDF) membranes. Membranes were incubated with specific antibodies against AKT (9272, Cell Signaling Technology), p-AKT (9271, Cell Signaling Technology), MCP-1 (sc-52701, Santa Cruz Biotechnology) and β-tubulin (70-ab009-040, MultiSciences) under 4 °C overnight. All antibodies were diluted 1:1000 in 5% BSA. Membranes were then incubated with corresponding secondary antibodies for 1 h at room temperature. Western blots were developed by enhanced chemiluminescence (20-500-500, Biological Industries) and detected by X-ray films.
Histology and immunohistochemistry analysis
After fixing in 10% neutral-buffered formalin for 72 h, samples were dehydrated and paraffin embedded. EAT was sectioned into 4 μm sections and stained with hematoxylin and eosin (H&E) for morphological evaluation. The cross sectional area of each adipocyte was quantified by using ImageJ software. To determine live adipocytes, EAT sections were first stained with an antibody to perilipin (20R-PP004, Fitzgerald, 1:200 dilution with PBS) followed by a rabbit anti-guinea pig secondary antibody (ab6771, Abcam, 1:2000 dilution with PBS). Dead adipocytes, defined as adipocytes without positive perilipin expression as published before [
19,
20], were counted under random 200× microscopic fields and expressed as the percentage of total adipocytes of each image. To determine macrophage infiltration, EAT sections were first stained with an antibody to F4/80 (MCA497, AbD Serotec, 1:50 dilution with PBS) followed by a goat anti-rat secondary antibody (PV-9004, ZSGB-BIO).
Flow cytometry (FCM)
After removing erythrocytes, SVF was resuspended in PBS and incubated with FcR Blocking Reagent (130-092-575, Miltenyi Biotec) in the dark on ice for 30 min. Then cells were stained with antibodies of PE-CY7-conjugated anti-F4/80 (25-4801-82, eBioscience), PE-conjugated anti-CD11c (557401, BD) and APC-conjugated anti-CD206 (141708, Biolegend). FCM was performed by using LSRFortessa (BD).
Statistical analysis
All analyses were calculated with GraphPad Prism6 software. Results were expressed as the mean ± SEM. The statistical significance was identified with one-way ANOVA (Tukey test for post-hoc comparison) and Student’s t test. A value of p < 0.05 was considered statistically significant.
Discussion
Our experiments demonstrated that TREM2
−/− mice under HFD manifested with increased obesity, insulin resistance and altered adipose tissue remodeling as compared with the WT counterparts. TREM2 deficiency promoted adipocyte hypertrophy and adipocyte death in EAT in HFD mice. Besides, down-regulation of adipocytes-derived MCP-1 expression from TREM2
−/− mice lead to suppressed F4/80
+CD11c
+ macrophage infiltration and CLS formation. Furthermore, inflammatory response was elevated in macrophages in TREM2
−/− mice. In addition, TREM2
−/− mice on HFD exhibited more severe hepatic steatosis. Published articles have revealed that in animal models of obesity, TREM2 gene expression was up-regulated in adipose tissue [
14‐
16]. Thus, we hypothesize that TREM2 may act as a feedback mechanism to curb HFD-induced adipose tissue remodeling. These results suggest that TREM2 plays a critical role during the pathogenesis of obesity-induced insulin resistance via regulating adipose tissue remodeling.
Recently, Park [
14] has reported that mature adipocytes express TREM2 to regulate adipogenesis. In his study, blocking TREM2 with TREM2-Ig suppressed DMI-induced 3T3-L1 preadipocytes and primary mouse embryonic fibroblasts differentiation into mature adipocytes. When adipogenesis was suppressed during obesity, adipocytes underwent adipocyte hypertrophy (to increase the size of adipocytes instead of number) to meet the demand of energy intake [
25]. In our study, we observed enlarged adipocytes in EAT of TREM2
−/− mice on HFD (Fig.
1i), with a mean cross sectional area reaching 5.02 ± 0.20 × 10
4 μm
2 as compared with 2.07 ± 0.08 × 10
4 μm
2 of WT mice (Fig.
2a). Besides, frequency distribution revealed a higher frequency of larger adipocytes in EAT of TREM2
−/− mice (25% percentile: 0.92 × 10
4 μm
2 of WT mice vs. 2.50 × 10
4 μm
2 of TREM2
−/− mice; median: 1.73 × 10
4 μm
2 of WT mice vs. 3.98 × 10
4 μm
2 of TREM2
−/− mice; 75% percentile: 2.99 × 10
4 μm
2 of WT mice vs. 6.32 × 10
4 μm
2 of TREM2
−/− mice) (Fig.
2b), indicating TREM2
−/− mice have developed greater adipocyte hypertrophy, which can be explained by suppressed adipogenesis [
25].
Adipocyte hypertrophy is an important stress factor leading to adipocyte death; besides, hypertrophic adipocytes show features of necrosis as membrane rupture and functional membrane protein loss [
19,
20]. In our study, TREM2
−/− mice displayed higher incidence of adipocyte death (79.97 ± 2.16% of TREM2
−/− mice vs. 66.22 ± 0.90% of WT mice) (Fig.
2c, d), which could be a consequence of greater adipocyte hypertrophy.
Impaired adipogenesis or adipocyte differentiation can bring about a rare medical condition termed as lipodystrophy. Lipodystrophy is characterized by complete or partial loss of adipose tissue, hepatic steatosis and insulin resistance [
26]. Similar phenomena were observed in our study. Mass of EAT (1.99 ± 0.09 g in TREM2
−/− mice vs. 2.38 ± 0.09 g in WT mice) (Fig.
1g) and its proportion to bodyweight (4.15 ± 0.20% in TREM2
−/− mice vs. 5.23 ± 0.23% in WT mice) (Fig.
1h) were both reduced in TREM2
−/− mice. Meanwhile, Mass of livers (1.74 ± 0.09 g in WT mice vs. 2.39 ± 0.10 g in TREM2
−/− mice) (Fig.
6a) and their proportion to bodyweight (3.79 ± 0.18% in WT mice vs. 4.97 ± 0.18% in TREM2
−/− mice) (Fig.
6b) were both increased in TREM2
−/− mice. In addition, histopathology confirmed more severe hepatic steatosis in TREM2
−/− mice (Fig.
6c). Besides, TREM2
−/− mice under HFD feeding demonstrated more severe insulin resistance (Fig.
1d–f and Additional file
3: Figure S3D). We speculate that in mice of HFD feeding, adipogenesis is suppressed due to loss of TREM2, which leads to lipodystrophy.
Under obese state, adipose tissue generates a series of chemokines, among them MCP-1 plays a major role [
23]. MCP-1 is released into bloodstream to recruit monocyte infiltration from circulation. In adipose tissue, monocytes were induced into F4/80
+CD11c
+ macrophages, which surround dead adipocytes and form CLS to isolate and clear dead adipocytes and cellular contents [
22]. In this study, we observed down-regulation of MCP-1 expression in adipocytes from TREM2
−/− mice (Fig.
4d and Additional file
4: Figure S4). Lower circulating MCP-1 levels in TREM2
−/− mice (126.1 ± 7.0 pg/ml of TREM2
−/− mice vs. 176.8 ± 13.9 pg/ml of WT mice) (Fig.
4a) were not sufficient to drive monocyte migration. Therefore, F4/80
+CD11c
+ macrophages were reduced in TREM2
−/− mice as compared to their WT counterparts (7.80 ± 0.62% of TREM2
−/− mice vs. 36.45 ± 3.10% of WT mice) (Fig.
3e, f). Besides, CLS formation was suppressed in EAT of TREM2
−/− mice (Figs.
1i,
2c and
3a).
Macrophages are the main source of pro-inflammatory cytokines in adipose tissue and play a pivotal role in the development of obesity-induced insulin resistance [
24]. TREM2 has been known as an anti-inflammatory regulator in immune process, since it can suppress inflammatory response via blocking Toll-like receptor signaling pathway [
12,
13]. In our study, we observed that macrophages of EAT expressed more pro-inflammatory cytokines such as IL-1β, IL-6 and iNOS in TREM2 knockout mice (Fig.
5).
Published work demonstrated that, down-regulation of TREM2 in adipose tissue in morbid obese patients is associated with advanced insulin resistance [
27], which was in consistent with our experiment (Fig.
1d–f and Additional file
3: Figure S3D). Besides, elevated TREM2 expression was observed in obese animal models [
14‐
16]. Hence, we hypothesize that TREM2 may act as a feedback protective mechanism to curb obesity induced-insulin resistance via regulating adipose tissue remodeling. First, TREM2 alleviates adipocyte hypertrophy and adipocyte death via promoting adipogenesis. Next, TREM2 up-regulates adipocyte-derived MCP-1 expression to recruit F4/80
+CD11c
+ macrophage infiltration to isolate and clear dead adipocytes and cellular contents. In addition, TREM2 attenuates inflammatory response of macrophages in EAT under HFD feeding.
The present study has one major limitation that should be addressed. Our TREM2
−/− mice with the background of C57BL/6 were created according to traditional gene knockout technology [
12]. In short, a portion of the trans-membrane and cytoplasmic domains encoded by exons 3 and 4 was deleted in embryonic stem cells [
12]. Because all cells in TREM2
−/− mice were TREM2 deficient, we can not distinguish whether TREM2 expressed on ATM or adipocytes plays a more important role in the pathogenesis and etiology of obesity-induced insulin resistance. Besides, traditional gene knockout technology allows for the possibilities that TREM2 expression on other tissue cells (yet to be discovered) may influence experimental results. Thus, an animal model with TREM2 conditional knockout (cell-specific knockout) in adipocytes and/or macrophages is warranted in future experiments to delineate the effect of TREM2 on obesity induced insulin resistance.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.